ca2 mg2 zn2 fe3 na aa and vc was showed in figure 3 53 the result showed that factors affect insignificantly to determination melamine in milk of gold nano
314 CMR 9.00: 401 WATER QUALITY CERTIFICATION FOR DISCHARGE OF DREDGED OR FILL MATERIAL, DREDGING, AND DREDGED MATERIAL DISPOSAL IN WATERS OF THE UNITED STATES WITHIN THE COMMONWEALTH potx
... as to the boundary of the vernal pool The maximum extent of the waterbody shall be based upon the total volume of runoff from the drainage area contributing to the vernal pool and shall be further ... size increases from the description filed with the Notice of Intent, or there are any inaccuracies therein, the applicant must notify the Department in writing and request a determination that the ... minimize the percolation of water through the final cover into the fill material, promote proper drainage of precipitation, minimize erosion of the final cover, facilitate the venting and control of...
- 34
- 983
- 0
Environmental Pollution Liability and Insurance Law Ramifications in Light of the Deepwater Horizon Oil Spill doc
... accordingly Hence, a substantial increase of financial limits is to be justified by the expanding definition of the damage to be covered.55 The EU originally took the point of view that marine ... Developments in Europe, China and the U.S.A., Kluwer Law International, 2006, The Netherlands 35 same time, the flag State has a broad jurisdictional mandate and is not limited to imposing financial penalties ... reviewing their current insurance programs and seeking to top up their cover and looking at terms and conditions and analysts predict that the purchase of business interruption coverage resulting...
- 39
- 458
- 1
Báo cáo khoa học: Functional interplay between viral and cellular SR proteins in control of post-transcriptional gene regulation pptx
... functions together with the E1 protein in viral DNA replication [16] The E2 protein consists of the N-terminal transactivation domain and the C-terminal DNA-binding domain These two functional domains ... H [61] Therefore, SR proteins, together with other RNA-binding proteins, coordinate the coupling of splicing and polyadenylation Viral and cellular SR proteins enhancers of mRNAs [62] In addition, ... 25 26 27 28 29 30 31 32 33 34 35 36 the SARS coronavirus nucleocapsid protein RNAbinding dimerization domain suggests a mechanism for helical packaging of viral RNA J Mol Biol 36 8, 1075–1086...
- 10
- 317
- 0
Báo cáo khoa học: Oxygen binding and its allosteric control in hemoglobin of the primitive branchiopod crustacean Triops cancriformis pdf
... errors in the parameter describing the effector binding in the tT FEBS Journal 274 (2007) 33 74 33 91 ª 2007 The Authors Journal compilation ª 2007 FEBS 33 83 Allosteric control of O2 binding in crustacean ... visualize the in uence of variations in the numbers of Mg2+ binding sites (m) and proton-binding sites (h) per oxygen-binding site FEBS Journal 274 (2007) 33 74 33 91 ª 2007 The Authors Journal compilation ... saturations of the ith point, and k is the number of data points Adair equation To determine the minimum number of interacting binding sites necessary to describe the data, the binding curves were analyzed...
- 18
- 460
- 0
báo cáo hóa học:" Adolescent distinctions between quality of life and self-rated health in quality of life research" ppt
... 2,229 1, 739 917 33 9 160 41 91 40.41 31 . 53 16.62 6.15 2.90 0.74 1.65 48 51 24 3 34 .3 36.5 17.2 6.4 2.1 1.4 2.1 2,0 63 1 ,32 3 841 424 447 166 254 37 .39 23. 98 15.24 7.68 8.10 3. 01 4.60 40 35 21 15 ... both adolescents and adults [1 -3] and monitoring adult QOL continues to be of interest in the United States [4,5] Monitoring adolescent QOL is also beginning to receive attention in some adolescent ... draft the manuscript and was Principal Investigator from the southern state YRBS JWD formatted and performed statistical analyses on the southern state data All authors read and approved the final...
- 9
- 409
- 0
báo cáo hóa học: " Differential aspects of stroke and congestive heart failure in quality of life reduction: a case series with three comparison groups" pot
... imaging) and was established by the attending neurologist from the stroke clinic [8] The diagnosis of CHF was based on signs and symptoms of low cardiac output and was established by the attending ... depression to be present in 30 to 40% of stroke patients [14,19-21], interfering with recovery, return to work and adherence to therapy In one study, depression was the single most important determinant ... status The mBI is a 50-point scale that was applied to quantify impairment in activities of daily living such as grooming, walking, transferring, hygiene and voiding (50 points meaning completely independent...
- 5
- 359
- 0
Báo cáo lâm nghiệp: "Variability of initial growth, water-use efficiency and carbon isotope discrimination in seedlings of Faidherbia albida (Del.) A. Chev., a multipurpose tree of semi-arid Africa. Provenance and drought effect" doc
... plant then ground to a fine powder Samples of total dry mass were burned in a pure O atmosphere, for the quantitative con2 version of C into CO The determination of the 13 isotope ratio (R) was ... along the gas-exchange axis of the PCA presented in figure 3b The drought effect was indicated by the direction of the arrows, resulting in a reduction of vigour, of gas-exchange rates and of Δ, ... Δ, and in an increase of A/g 3. 4 .3 Root biomass fraction (axis 3; 8 .3 % of total variability explained) Root -to- total dry mass ratio (RMR) was correlated with axis 3, with r 0. 53, and not...
- 20
- 303
- 0
Báo cáo khoa học: "Outcomes of resection and non-resection strategies in management of patients with advanced colorectal cancer" doc
... reported in 8% of cases and perforation in 4% [12] In this series the technique of stenting was introduced and developed in the unit during the study period and in the future may reduce the need ... disease remains challenging Individual treatment needs to be tailored to optimise QoL and survival taking into account the side effects and risks of any active intervention In patients that present ... increased trend in the use of self expandable metallic stents (SEMS) A recent systematic review examined the role of SEMS in this situation and showed successful palliation in 90% of 33 6 reported...
- 7
- 327
- 0
Novel dexamethasone-HPMA copolymer conjugate and its potential application in treatment of rheumatoid arthritis pdf
... subcutaneously into the base of the tail [20] The progression of the joint inflammation was monitored daily Special care was given to the rats as the inflammation developed to ensure access to water and ... model [15] In addition to the arthritic ankle joints, the copolymer showed minor deposition to other inflammatory tissues such as the knee joints and the base of the tail where the adjuvant was given ... analysis of the conjugate indicated that there was no detectable free Dex in the purified copolymer conjugate The remaining hydrazide in the conjugate was determined using the TNBS (2,4,6-trinitrobenzenesulfonic...
- 9
- 311
- 0
báo cáo khoa học: " Integration of molecular biology tools for identifying promoters and genes abundantly expressed in flowers of Oncidium Gower Ramsey" pps
... AGAAAGCTGGGTCATCTAAAGTGATTGTGAGGA AAAAAGCAGGCTCAACTTCATTTACTGTAGCTC AGAAAGCTGGGTCATCTAAAGTGATTGTGAGGA 740 AAAAAGCAGGCTTGAAAAATTGTGAG AGAAAGCTGGGTCATCTAAAGTGATTGTGAGGA 36 0 AAAAAGCAGGCTCGGAACTCCACAAG AGAAAGCTGGGTCATCTAAAGTGATTGTGAGGA ... 920 AAAAAGCAGGCTTGATTCAACCCATTC AAAAAGCAGGCTTGCACAGAGGCAAACATATATTT AGAAAGCTGGGTCATTGTTAAGAGTTAGAATTTG AGAAAGCTGGGTCATTGTTAAGAGTTAGAATTTG AGAAAGCTGGGTCATTGTTAAGAGTTAGAATTTG 33 4 AAAAAGCAGGCTCAACGCAAGTTAACC ... 1027 AAAAAGCAGGCTGCCCCAAATGACACCTTA AGAAAGCTGGGTCATTGTTAAGAGTTAGAATTTG 882 AAAAAGCAGGCTCTCCTATTGCACCCATTTTC AGAAAGCTGGGTCATTGTTAAGAGTTAGAATTTG 746 569 OnExpansin AAAAAGCAGGCTTTCATGTTAACAACCATC...
- 14
- 259
- 0
Báo cáo y học: " The posttraumatic stress disorder project in Brazil: neuropsychological, structural and molecular neuroimaging studies in victims of urban violence" pptx
... thirds of this occurring in the 90's In 1980 the leading cause of violent death in the country was traffic accidents but in 2000 it was homicides [6,7] From 1991 to 2000 there was an increase of ... from the tip of the genu to the most anterior part of the CC, the superior boundary will be represented by the inferior border of the anterior cingulate corresponding to a midpoint at the interhemispheric ... particularly in the genoma analysis DRL will be participating in the analysis and interpretation of data JPF and LCQ are post-doc students and will be participating of data analysis and interpretation of...
- 12
- 385
- 0
Báo cáo sinh học: " Genetic effects of static magnetic fields. Body size increase and lethal mutations induced in populations of Drosophila melanogaster after chronic exposure" potx
... release lines (dashed lines) at the 5th generation in the R and lines and at generations 3, and 10 in the C line, further replicated in the C line only at the 4th generation The results show that the ... the L and L veins and the distance between them at the margin of the wing The triangle area was computed by Erone’s formula: was where p is half the perimeter and a, b and c are the lengths of ... only 24 flies in control and treated lines of the C stock at the 1st generation, and a number ranging from 30 to 119 flies in the remaining stocks and generations Measures are given in micrometric...
- 21
- 240
- 0
THE ROLE OF THE CTD PHOSPHATASE RTR1 AND POST-TRANSLATIONAL MODIFICATIONS IN REGULATION OF RNA POLYMERASE II
... the introduction of a single-stranded DNA (ssDNA) carrier to bind to the permeable cell membrane allowing the transforming DNA to work in the nucleus Another improvement was developed in 19 93 ... using both in vivo and in vitro studies S2-P peaks at the 3 end of the transcribed region and signals recruitment of termination factors necessary for the cleavage and polyadenylation of the nascent ... termination of many RNAPII target mRNA genes As with the 5’ end, termination of transcription is marked by dissociation of many of the elongation factors and RNAPII in a coordinated manner to...
- 109
- 206
- 0
compare the effect of mannitol and hypertonic saline (nacl3%) in treatment of acute elevated intracranial pressure in stroke patient
... able to successfully decrease the intracranial pressure to below 25 mmHg in 73. 9% and NaCl3% was successful in 74.2% of the the patient - Mannitol appeared to be prior to NaCl3% in the first 30 minute, ... doses), NaCl3% had the duration of 3- 6 hour with highest rate of 25% The duration in minute of below threshold in mannitol 21 group was 85 minutes (from 30 -36 0 minutes), in the NaCl3% group was 150 ... group In Vietnam, our result was not optimistic as in the study of Diem Son (2012) on brain injury patient, the duration in mannitol group was 31 2± 53 minutes, in NaCl3% group was 416±77 minutes...
- 24
- 465
- 0
Philips healthcare Vietnam and marketing communication strategy in times of change
... happened in the market in order to figure out how PHC Vietnam influenced from both internal and external factors, including: Macro Environment Analysis: using PESTEL as a tool to find out the external ... Statistic Office) Social factors The size of the private healthcare sector in Vietnam is expanding, especially in the urban areas of the country The availability of private clinics and surgeries ... spending as a percent of GDP surpassing most ASEAN countries and growing up to 8 .3 % of the GDP in 2014 Public Healthcare sector is one of the high priority sectors in investment of Vietnam government...
- 59
- 668
- 4
a contrastive analysis of english and vietnamese resignation letters in terms of discourse structure = phân tích đối chiếu cấu trúc diễn ngôn của đơn thư từ chức trong tiếng anh và tiếng việt
... includes the ideas and the signatures of the employers to express their agreements In the survey, the names of the employees tend to appear in the right corner of the letters; whereas, the names ... Addressing………………………………………………………………………… 43 2 .3. 3 Stating Resignation and Informing the Last Day of Work……………………… 44 2 .3. 4 Giving the Reason of Resignation………………………………………………… 44 2 .3. 5 Expressing the Willingness to Help with the ... her signature and full name on the right corner of the letter, and on the left corner that is the signature and full name of the person who confirms the letter - the manager A Sample of Vietnamese...
- 71
- 1,020
- 3
A contrastive analysis of English and Vietnamese resignation letters in terms of discourse structure
... style of English and Vietnamese resignation letters, this study focuses on comparing and contrasting discourse structure of English and Vietnamese resignation letters Aims of the Study: The aims of ... analyze the discourse structure of resignation letters in English and Vietnamese Besides, in order to find out the similarities and differences between discourse structure of English and Vietnamese ... describes the participants and methods which are applied to collect and analyze the data Chapter – Analysis of Discourse Structure in English and Vietnamese Resignation Letters In this chapter, the...
- 6
- 812
- 7
LV Syntactical, semantic, and stylistic structures in English and Laos newspaper discourses in terms of headlines
... for the next parts of the study The second group relates to the description and contrast of the newspaper headlines in the two languages In addition, the final one to the results of the study, and ... intends to focus on studying the structure of the discourse of newspaper headlines in English and Laos In other words, the aim of the study is to find out the characteristics in linguistics in ... ones, the headline chosen as the subject of study in the thesis is the main headline of both news and commentary articles has the functions of informing and/ or influencing the readers 2.7 The...
- 111
- 325
- 1
Báo cáo Y học: Inhibition of SERCA Ca2+ pumps by 2-aminoethoxydiphenyl borate (2-APB) 2-APB reduces both Ca2+ binding and phosphoryl transfer from ATP, by interfering with the pathway leading to the Ca2+-binding sites ppt
... conformational changes associated with Ca2+ binding to the ATPase, tryptophan fluorescence was monitored in the absence and 45 Ca2+ binding to the ATPase To deduce whether 2-APB was directly affecting Ca2+ ... during the process of Ca2+ binding [32 ] Figure 4A,B illustrates the change in tryptophan fluorescence induced by Ca2+ in the presence and absence of 2-APB both at pH 6.0 and pH 7.2 In all results, ... 11 and 35 0 ± 10 lM in the presence of 30 0 lM and mM 2-APB, respectively These results therefore indicate that 2-APB affects the conformational changes associated with Ca2+ binding to the Ca2+ ATPase...
- 10
- 412
- 0
"Aa" in Dictionary of Slang and Unconventional English potx
... occupational) are the two co-efficients, the two chief factors, the determining causes of the nature of slang, as they are of language in general and of style One kind of eyewash, the army’s innumerable ... cotton US, 1958 a-la-beff noun vaginal intercourse, the woman on hands and knees and the man entering her from behind An allusion to the mating of cattle and the French boeuf TRINIDAD AND TOBAGO, ... influenced the language of the mother country whether in Standard or in unconventional English Usage and Abusage Some of the upstart qualities [of slang] and part of the aesthetic (as opposed to the...
- 40
- 332
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25