boilers where expanded into drums or headers for different diameters and gages of tubes conforming to the requirements of specifications sa 178 grade a sa 192 and sa 226
New technologies or innovative treatment lines for reliable water treatment for P&P and minimization of waste production ppt
... maintaining the concentration of the bath constant The evaporated water can be used as wash water for prior treatments before tinning The advantages of the evapoconcentration technique for water ... the forming wire, determining retention, drainage rate and the formation, and it is also used in the wastewater treatment to separate the colloidal material and in the sludge thickening Factors, ... (PACs) and FeCl3 have been used as coagulants; and combinations of a PAC with an anionic and a cationic polyacrylamide (aPAM and cPAM) have been used as dual systems to induce the flocculation of...
- 147
- 517
- 0
an investigation into conceptual metaphors used for describing happiness and sadness in english and vietnamese
... concept Therefore, many aspects of a word can be used to talk about another concept For example, The storm is in my soul” is derived from the same conceptual metaphor “SADNESS IS A NATURAL FORCE” A ... cultures? Happiness and sadness are basic and fundamental emotions (Ortony and Turner 1990) [19] And yet, how universal or distinct are expressions and understandings of happiness and sadness across ... metaphors and for further researches 3.4 DATA COLLECTION AND DATA ANALYSIS 3.4.1 Data Collection To conduct this research, more than 650 metaphorical expressions describing happiness and sadness...
- 26
- 886
- 6
Flavor enhancement as a tool for increasing pleasantness and intakeof a snack product among the elderly
... indicating the eating order of the samples Half of the subjects ate the regular aroma samples first and half ate the heightened aroma samples first The subjects were asked to rate one sample a day at ... interaction of day and aroma on the pleasantness ratings of the young, implicating an increase in pleasantness of the heightened aroma sample in the presence of health-related information Since the effects ... ethyl alcohol, PEA) and liking of the vanilla beverage at any phase of the study The aim of the present study was to examine the effects of heightened aroma concentration on the pleasantness and...
- 10
- 599
- 1
Tài liệu POLICY FRAMEWORK FOR COMPENSATION, RESETTLEMENT AND REHABILITATION OF PROJECT AFFECTED PERSONS doc
... sufficient for reorganizing: DP can opt for i) cash compensation at replacement cost for land and assets on land, or ii) “land for land” compensation for the whole residential area which DP occupied ... includes market cost of material, plus the costs of material transport, labor and contractor fees, registration and transfer taxes Depreciation of the asset and amount saved in materials will not form ... combination of productive potential, locational advantages, and other factors is at least comparable to the advantages of the old sites, with an estimate of the time needed to acquire and transfer...
- 33
- 426
- 0
Tài liệu Soft Computing for Optimal Planning and Sequencing of Parallel Machining Operations docx
... study of the optimal planning and sequencing for parallel machining operations The combinatorial nature of sequencing and the complication of having precedence and mode constraints make the problem ... WLs The necessary and sufficient condition for a machine tool to be parallel is I Ͼ However, for a parallel machine to perform machining in sequential operations, we can simply set i ϭ and l ϭ A ... to different machining modes and thus cannot be performed on the same spindle at the same time Starting from time 64, MU1 moved back to perform operations 5, and on the new workpiece at WL1 and...
- 34
- 402
- 0
CUPOLOGY. HOW TO BE ENTERTAINING. INTERESTING FACTS FOR BOTH YOUNG AND OLD. TOASTS -- GEMS. HOW TO TELL AGE. PUBLISHED docx
... were the test cup the third and certainty for the sake of the fortunate lady and her family, then your destiny were assured and your mentality would advance into lofty channels by the influence of ... man and woman Something of importance has taken place in your national life and in your financial position, as well as in political and church affairs See the crowing cock and the stork, a change ... illness Fate is silent and sad for a time, as in mourning for the sorrows of the good and true See you the shaft, draped like a funeral pall across the cup? You are also to bury a friend, a worthy...
- 72
- 427
- 0
Báo cáo khoa học: Sequences downstream of the transcription initiation site are important for proper initiation and regulation of mouse ribonucleotide reductase R2 gene transcription ppt
... (product indicated by the lower arrow to the left of the autoradiograph) All bands were quantified using the Scion Image program and the ratio between the upper and lower bands for each assay is presented ... intensity of each band normalized to the band in lane The lower numbers represent the intensity of the bands in lanes and normalized to the band in lane In order to map the position in the R2 5¢-UTR where ... templates TATAWtUTRWt and TATAmutUTRWt in Fig 3D) The Mutation of the R2 TATA-box affects the position for transcription initiation It was possible that the mutation of the TATA-box and the different...
- 11
- 417
- 0
Every Woman Matters: A Report on Accessing Primary Health Care for Black Women and Women of Colour in Ontario pptx
... Facilitators of Health Care Access Barriers and Facilitators for Homeless and Underhoused Women Barriers and Facilitators for Women Living with Physical Disability Barriers and Facilitators for Lesbian ... Soma Chatterjee LLana James Investigators Charmaine C Williams (Principal Investigator) Notisha Massaquoi (Co-Investigator) Project Coordinators Amoaba Gooden Tulika Agarwal Narale Research Assistants ... African, African Caribbean, African Canadian and other women of African ancestry The term “Women of Colour” refers to South Asian or Latin American women and women of South Asian or Latin American ancestry...
- 90
- 502
- 0
Báo cáo khoa học: "A global model for joint lemmatization and part-of-speech prediction" doc
... bounce for tags VB and NN , and to bouncer for tag JJR One feature looks at the combination of tags corresponding to the differ- We used top three tag-sets and top three lemmas for each tag for training ... respectable The larger improvement for Slavic languages might be due to the fact that there are many more forms of a single lemma and joint reasoning allows us to pool information across the forms ... assignments and will be able to correct the tagging and lemmatization error for bouncer The main source of information our joint model uses is information about the assignments of all words that have the...
- 9
- 430
- 0
Survivability Options for Maneuver and Transport Aircraft - Analytic Support to the Army Science Board pptx
... marketed and sold in the arms market For another, SAM technology and capability continue to improve Whereas the major threat of yesterday might have been the SA- 10s and SA- 12s, there are now SA- 20s ... is to be achieved over protected airspace A fundamental issue that remains to be resolved is one of the reach of SAM and the aircraft that attacks the SAM That is, to what extent can the ... review to ensure high standards for research quality and objectivity Survivability Options for Maneuver and Transport Aircraft Analytic Support to the Army Science Board John Matsumura, Randall...
- 116
- 291
- 0
Báo cáo khoa học: Identification of a preferred substrate peptide for transglutaminase 3 and detection of in situ activity in skin and hair follicles pdf
... greatly appreciate Dr Masatoshi Maki and Dr Hideki Shibata in our laboratory for providing valuable suggestions This work was supported by a Grant-inAid for Scientific Research on Innovative Areas ... Q-x-P-WD-P to TGase and Q-x-x-W-x-W-P to Factor XIII (x and W are any amino acid and hydrophobic amino acid residues, respectively) We applied a similar approach to obtain information regarding the ... pattern, the activated TGase was mainly located in the medulla and the hair cortex However, according to the FITC–pepK5 pattern, TGase activity was observed around the outer root sheath and cuticle and...
- 11
- 645
- 0
Báo cáo khoa học: Analysis of the region for receptor binding and triggering of oligomerization on Bacillus thuringiensis Cry1Aa toxin potx
... ATAAGATGTGGACACCTAATATTCTGT-3¢; R311C-S, 5¢-ATACTGATGTGCATTGTGGCTTTAATTATT-3¢; R3 11C-AS, 5¢-AATAATTAAAGCCACAATGCACATCAGT AT-3¢; S373C-S, 5¢-AATTATACTTGGTTGTGGCCCAA ATAATCA-3¢; S373C-AS, 5¢-TGATTATTTGGGCCACA ... G442 and Y445 for cysteine (R281C-S, 5¢-TTGATGGTAGTTTTTGTGGAAT GGCTCAGA-3¢; R281C-AS, 5¢-TCTGAGCCATTCCACA AAAACTACCATCAA-3¢; Q293C-S, 5¢-ACCAGAATATT AGGTGTCCACATCTTATGGA-3¢; Q293C-AS, 5¢-TCC ATAAGATGTGGACACCTAATATTCTGT-3¢; ... 5¢-TGATTATTTGGGCCACA ACCAAGTATAATT-3¢; N376C-S, 5¢-TTGGTTCAGGCC CATGTAATCAGGAACTGT-3¢; N376C-AS, 5¢-ACAGTT CCTGATTACATGGGCCTGAACCAA-3¢; G442C-S, 5¢TGAGCCAAGCAGCTTGTGCAGTTTACACCT-3¢; G44 2C-AS, 5¢-AGGTGTAAACTGCACAAGCTGCTTGGCT...
- 11
- 588
- 0
báo cáo hóa học:" Gene expression profiling for molecular distinction and characterization of laser captured primary lung cancers" ppt
... microdissection, total RNAextraction was performed with the RNeasy Micro Kit (QIAamp DNA MicroKit Qiagen, Santa Clarita, CA, USA), according to the manufacturer's instruction A standard quality control of the ... looking for pan-cytokeratin, cytokeratin and 7, chromogranin A, synaptophysin and tissue-transcripion-factor1 For validation of the classificator from genetic programming, 13 lung cancer samples ... bladder cancer, glioblastoma, melanoma and leukemia [36] The Qin oncogene, originally isolated from avian sarcoma virus, causes oncogenic transformation Qin is the avian orthologue of mammalian brain...
- 17
- 662
- 0
Báo cáo hóa học: " Development and evaluation of one step single tube multiplex RT-PCR for rapid detection and typing of dengue viruses" pdf
... 20 21 Parida MM, Upadhyay C, Saxena P, Dash PK, Jana AM, Seth P: Evalution of a Dipstick ELISA and a rapid Immunochromatographic test for diagnosis of dengue virus infection Acta Virologica 2001, ... (Promega, USA) with dengue virus group-specific consensus primers (D1: 5' TCAATATGCTAAAACGCGCGAGAAACCG 3' and D2: 5' TTGCACCAACAGTCAATGTCTTCAGGTTC 3') Dengue Nested PCR The nested PCR assay was performed ... resulting in an economical way of serotyping [16] The two-step assays are always more prone to contamination due to opening of tubes between the steps All these advantages make this assay a user friendly,...
- 5
- 482
- 0
báo cáo hóa học:" Quality of data collection in a large HIV observational clinic database in sub-Saharan Africa: implications for clinical research and audit of care" docx
... downloads of laboratory data, and the use of prescription data on, for example, anti-TB medication, or fluconazole as a means to flag unreported OIs, such as TB, oesophageal candidiasis and Cryptococcus ... this article as: Kiragga et al.: Quality of data collection in a large HIV observational clinic database in sub-Saharan Africa: implications for clinical research and audit of care Journal of the ... Ministry of Health, Republic of Uganda; 2003 Kamya MR, Mayanja-Kizza H, Kambugu A, Bakeera-Kitaka S, Semitala F, Mwebaze-Songa P, Castelnuovo B, Schaefer P, Spacek LA, Gasasira AF, Katabira E, Colebunders...
- 7
- 455
- 0
báo cáo hóa học: " In vitro and in vivo pre-clinical analysis of a F(ab’)2 fragment of panitumumab for molecular imaging and therapy of HER1-positive cancers" pot
... utilizing the panitumumab F(ab’)2 for monitoring response to radioimmunotherapy and (2) exploiting the panitumumab F(ab’)2 as a targeting vector for radioimmunotherapy of disseminated peritoneal disease, ... compared to intact panitumumab Trastuzumab F(ab’)2 was used as a negative control All values were corrected for on a nanomolar basis The immunoreactivity of the 111 In-panitumumab F(ab’)2 was assessed ... Evaluating the potential of the panitumumab F(ab’)2 for clinical imaging and radioimmunotherapy applications would require larger quantities of the F(ab’) Therefore, a peptic digestion was performed...
- 15
- 452
- 0
Báo cáo hóa học: " Research Article Convergence Theorems Concerning Hybrid Methods for Strict Pseudocontractions and Systems of Equilibrium Problems" pot
... pp 372– 379, 2003 A Tada and W Takahashi, “Weak and strong convergence theorems for a nonexpansive mapping and an equilibrium problem,” Journal of Optimization Theory and Applications, vol 133, ... pp 336–346, 2007 K Nakajo and W Takahashi, “Strong convergence theorems for nonexpansive mappings and nonexpansive semigroups,” Journal of Mathematical Analysis and Applications, vol 279, no ... Journal of Inequalities and Applications 11 P Kumam, A hybrid approximation method for equilibrium and fixed point problems for a monotone mapping and a nonexpansive mapping,” Nonlinear Analysis...
- 14
- 305
- 0
Báo cáo hóa học: " Research Article Sequential Monte Carlo Methods for Joint Detection and Tracking of Multiaspect Targets in Infrared Radar Images" pptx
... that defines the target shape for each aspect state, and a real coefficient φk,l (sn ) ∈ R, that specifies the pixel intensities of the target, again for the various states in the alphabet I For ... infrared airborne radar (IRAR) data The background clutter is simulated from real IRAR images from the MIT Lincoln Laboratory database, available at the CIS website, at Johns Hopkins University An artificial ... with more conventional algorithms for target detection/acquisition and data association For a review of alternative approaches to multitarget tracking, mostly for video applications, we refer the...
- 13
- 355
- 0
Báo cáo toán học: "Plethysm for wreath products and homology of sub-posets of Dowling lattices" pptx
... as a representation of G Sn over Q The main aim of this paper is to find in each case a formula for the character of this representation, analogous to the formulae proved in [4] The last paragraph ... Poset topology: tools and applications, math.CO/060 2226, to appear in Geometric Combinatorics, IAS/Park City Mathematics Series, American Mathematical Society the electronic journal of combinatorics ... equivariant versions of the familiar generating functions for the characteristic polynomials of the partition lattices and their duals In the remainder of the section we give the results of applying...
- 25
- 203
- 0
Báo cáo toán học: "A graph-theoretic method for choosing a spanning set for a finite-dimensional vector space, with applications to the Grossman-Larson-Wright module and the Jacobian conjecture" pdf
... 2, and S1 has a maximal number of vertices We emphasize that a tree can fall into a category in more than one way For example, the tree falls into Category I in three ways, and the tree falls into ... bridge the gap and complete the proof (see Theorem 3.19 and the paragraph before it in [11]) We have duplicated his results for M(4, 4)m = using Mathematica and can attest to the computational complexity ... finite-dimensional vector space V from among a set of vectors X generated combinatorially, when it is not readily apparent how to order X or a canonical spanning set of V in a convenient way The motivation for...
- 21
- 299
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25