blocking queue with multiple locks to allow concurrent put and take on a nonempty queue
Báo cáo khoa học: "Combining a Statistical Language Model with Logistic Regression to Predict the Lexical and Syntactic Difficulty of Texts for FFL" potx
... literature are Pearson’s productmoment correlation coefficient, prediction accuracy as defined by Tan et al (2005), and adjacent accuracy Adjacent accuracy is defined by Heilman et al (2008) as “the ... the adjacent accuracy of classifying the C1 and C2 texts Table 1: Mean Pearson’s r coefficient, exact and adjacent accuracies for both models with the tenfold cross-validation evaluation label for ... vector machines and statistical language models Proceedings of the 43rd Annual Meeting on Association for Computational Linguistics, pages 523–530 M Heilman, K Collins-Thompson, J Callan, and...
- 9
- 514
- 0
Báo cáo sinh học: "The short coiled-coil domain-containing protein UNC-69 cooperates with UNC-76 to regulate axonal outgrowth and normal presynaptic organization in Caenorhabditis elegans" ppt
... plates lacking Leu, Trp and His with 75 mM 3-amino triazol (LWH/3AT plates), onto plates lacking uracil (URA plates) and onto filters for -galactosidase assays Only clones that activated all ... dendrite and the axon Growing axons respond to a wide variety of extracellular attractive and repulsive signals that direct migration to a fated location Although many guidance receptors have been ... In a few cases the axons had unusual large swellings and occasionally meandered along the lateral body wall FMRF-amide (Phe-Met-Arg-Phe-NH2) is a neuropeptide that serves as a neuromodulator, and...
- 26
- 399
- 0
báo cáo khoa học: "Bilateral adrenocortical carcinoma in a patient with multiple endocrine neoplasia type 1 (MEN1) and a novel mutation in the MEN1 gene" potx
... the pancreas and (iv) functioning bilateral adrenal tumors, was established The patient was submitted to an exploratory laparotomy through a bilateral subcostal incision She underwent distal pancreatectomy, ... metastatic disease Thus, the patient underwent an exploratory laparotomy, the intraoperative ultrasonography did not disclosed any other pancreatic lesion and distal pancreatectomy and splenectomy ... Novotny EA, Garrett-Beal L, Ward JM, Libutti SK, Richard Alexander H, Cerrato A, Parisi MJ, Santa Anna-AS, Oliver B, Chandrasekharappa SC, Collins FS, Spiegel AM, Marx SJ: Molecular pathology...
- 7
- 412
- 0
Báo cáo y học: " Relatives Education And Coping Toolkit - REACT. Study protocol of a randomised controlled trial to assess the feasibility and effectiveness of a supported self management package for relatives of people with recent onset psychosis" pdf
... problem, with little or no professional input They can be used as stand-alone interventions or as an adjunct to other forms of intervention This is a rapidly growing area and a recent meta-analysis ... power calculation but on a pragmatic decision balancing sufficient numbers to be able to identify likely barriers to carrying out a larger scale trial, and cost We aim to recruit 100 participants ... this, a baseline interview is conducted to assess eligibility and to complete all the measures A second research assistant (RA2) then contacts the Clinical Trials Unit and provides information about...
- 7
- 305
- 0
Chinas integration to the world economy and impact on economic links with hong kong
... factors affecting trade liberalization and foreign capital absorption, and issues of regional disparity and commodity composition change in trade growth and foreign investment distribution and ... particular issues such as certain area in China that has a very intensive economic relation with Hong Kong are to be probed in Chapter And Chapter goes on to the conclusion and prospects for China’s ... Calculations based on data from Direction of Trade, International Monetary Fund, Washington, D.C, 1991; International Trade Statistics, World Trade Organization, 2002 China’s exports shares with Hong...
- 144
- 831
- 0
21 STUPIDLY SIMPLE WAYS TO GET MORE LIKES AND COMMENTS ON YOUR FACEBOOK PAGE
... _ A CharityHowTo.com publication by John Haydon Click to Share on Twitter HOW TO GET MORE COMMENTS Ask questions about a photo – Share a photo an ask your fans to comment For example, an animal ... _ A CharityHowTo.com publication by John Haydon Click to Share on Twitter ABOUT CHARITYHOWTO AND JOHN HAYDON CHARITYHOWTO WEBINARS HELP NONPROFITS UTILIZE SOCIAL MEDIA AND TECHNOLOGY TO ENGAGE ... increase the amount of likes and comments, you will increase the number of Facebook Page fans Again, it’s a law, not just a nice idea A CharityHowTo.com publication by John Haydon Click to Share on...
- 29
- 584
- 1
Plant reproductive susceptibility to habitat fragmentation: review and synthesis through a meta-analysis pptx
... lowest and highest values of the independent variable (only when each point from the scatter had an associated variance measure and sample size) or calculated the mean value, standard deviation and ... Cordoba Ciencia R .A and L .A are fellowship holders from CONICET, L.G and M .A. A are researchers of the same institution We thank Mauricio Quesada, Kathy Stoner and Diego Vazquez for their ´ valuable ... to be? Responses of insect pollinator faunas and flower pollination to habitat fragmentation In: Disruptions and Variability: the Dynamics of Climate, Human Disturbance and Ecosystems in the Americas...
- 13
- 316
- 0
Báo cáo y học: "A comparative study of anxiety and depression in patients with bronchial asthma, chronic obstructive pulmonary disease and tuberculosis in a general hospital of chest diseases" ppsx
... patients with somatic disease Additionally, it may hinder adaptation to chronic disease conditions and it is known that adaptation is a crucial survival factor in chronic diseases [22] Conclusion Patients ... BA and COPD have a significantly higher rate of anxiety and depression compared to the general population A probable cause is the chronicity and severity of pulmonary disease Detection and management ... divorce, are closely related to relapses and aggravations of respiratory disease, especially in men, pointing to a link between psychological factors and chronic pulmonary disease [19] Patients with...
- 4
- 669
- 0
Báo cáo y học: "Response to commentary by Dixon and Silman on the systematic review and meta-analysis by Bongartz et al" doc
... Arthritis Research & Therapy Vol No Matteson et al Bongartz T, Sutton AJ, Sweeting MJ, Buchan I, Matteson EL, Montori V: Anti-TNF antibody therapy in rheumatoid arthritis and the risk ... infections and malignancies Systemic review and meta-analysis of rare harmful effects in randomized controlled trials JAMA 2006, 295:2275-2286 Stern R, Wolfe F: Infliximab dose and clinical status: ... 1642 patients with rheumatoid arthritis J Rheumatol 2004, 31:1538-1545 Remicade label information [http://www.remicade.com/global/ hcp/hcp_PI.jsp] Lagakos SW: Time -to- event analyses for long-term...
- 2
- 391
- 0
Báo cáo y học: "Leveraging a clinical research information system to assist biospecimen data and workflow management: a hybrid approach" pptx
... installed on multiple desktops communicating directly with a database) In any case, such systems address longitudinal-clinical-study needs only partially Delegating calendar and analytical-data management ... barcode labels record standard information such as patient ID, event, sample type and aliquot number The samples are batch shipped and aliquots that are received are scanned at the data and sample ... Additional material Additional file 1: Schema documentation Annotated description of the BDMS schema, and schema for role management and user authentication Additional file 2: Microsoft Access...
- 8
- 477
- 0
Báo cáo y học: "Welcome to Journal of Foot and Ankle Research: a new open access journal for foot health professionals.c" ppt
... amalgamation of the Australian Podiatry Council and the New Zealand Society of Podiatrists to form the Australasian Podiatry Council in 1997, the Australian Podiatrist merged with the New Zealand ... additional datasets and movie files http://www.jfootankleres.com/content/1/1/1 historical, national and political barriers impeding the progress and advancement of foot and ankle care What will ... journals, it can take between six and 24 months from acceptance of a paper to final availability in hard copy This delay occurs because of the need to produce paper issues on a monthly, bimonthly...
- 6
- 298
- 0
Báo cáo y học: " Study protocol: The development of a pilot study employing a randomised controlled design to investigate the feasibility and effects of a peer support program following discharge from a specialist first-episode " pdf
... Ruggeri M, Dall'Agnola R: The development and use of the Verona Expectations for Care Scale (VECS) and the Verona Service Satisfaction Scale (VSSS) for measuring expectations and satisfaction with community-based ... PSW and the participant will take place on- site with the case manager and the peer support coordinator present The nature of the intervention will be explained again and both the participant and ... below) and via a telephone call made by the RA to the new treating clinician asking about attendance at appointments and medication adherence These treatment adherence measures were created specifically...
- 7
- 443
- 0
Báo cáo y học: " Simultaneous monteggia type I fracture equivalent with ipsilateral fracture of the distal radius and ulna in a child: a case report" docx
... Monteggia injury with ipsilateral distal radius and ulna fractures [2]; olecranon fracture and distal radial epiphysis [3]; type II Monteggia fracture with fracture separation of the distal radial ... epiphyseal fractures (distal radius and ulna and proximal radius) and a diaphyseal ulnar fracture in the same forearm [7] Four types of Monteggia fractures as well as three equivalent types have ... the radial head; the second most common is fracture of the proximal third of the ulna, lateral angulation of the fracture and lateral dislocation of the radial head; proximal ulna fracture with...
- 4
- 338
- 0
Báo cáo y học: "andidemia on presentation to the hospital: development and validation of a risk score" pptx
... the validation cohort (Table 2) [see Additional data file 2] Derivation and validation of candidemia risk score Univariate analysis revealed that the following variables were associated with candidemia: ... presentation on admission as candidate variables, which is likely to be a strength of our paper because many large-scale databases tend to only have the results of administrative coding and lack actual ... be generalizable to a broad range of patients presenting to acute-care hospitals because they are derived from teaching and non-teaching hospitals and from urban and rural hospitals, and are not...
- 10
- 394
- 0
Báo cáo y học: "Global transcriptional responses of fission and budding yeast to changes in copper and iron levels: a comparative study" ppt
... attacaTCTGATAActTTTGTCcagattgGTAGA TAAgcaa taatgtagactattgaaaacaggtctaaccatct attcgtt R73.12 Genome Biology 2007, Volume 8, Issue 5, Article R73 Rustici et al cerevisiae, in which copper starvation leads to delayed ... Metallothioneins Catalase A, peroxisomal and mitochondrial Catalase T, important for free radical detoxification Cu/Zn superoxide dismutase Cell wall mannoprotein 3-ketoacyl-CoA; beta-oxidation of fatty acids ... [Supplementary table 5]) Additional data files The following additional data are available with the online version of this paper Additional data file includes tables providing details on all genes induced...
- 16
- 839
- 0
Roles of siRNAs and miRNAs in host responses to virus infection identification and characterization of a novel viral suppressor of RNA silencing
... discussion and advice They are Wang Shouhai, Guo Huishan, Li Wanxiang, Li Hongwei, Ji Lianghui, Xiao Huogen, Andrew P Lucy, and Fang Yun Thanks also go to all members of Functional Genomics laboratory: ... Carmell et al., 2002) and AGO1, AGO4 from Arabidopsis (Fagard et al., 2000; Zilberman et al., 2003) belong to the Argonaute family Argonaute proteins are ~100 kDa, highly contain two common domains ... Agrobacterium vacuuminfiltration transformation method 2.6 In vitro transcription 2.7 Plant inoculation 2.8 Total plant RNA extraction 2.9 Extraction of plant DNA 2.10 Random labeling of DNA with 32P...
- 195
- 312
- 0
Eating out en francais more than 2,000 food and wine terms in english and french plus mini phrasebook and guide to wine regions (english and french edition) a c
... Sunday and Monday Labour Day, May VE Day, May Ascension Day Whit Sunday and Monday Frances National Day (Bastille Day), 14 July The Assumption, 15 August All Saints Day, November Armistice Day, ... matchstick potatoes alose shad 20 assaisonnement alouette lark [bird] aux amandes with almonds põte damandes almond paste amandine almond tart amer (amốre) bitter amộricaine, sauce the cooking ... sausage or goose cassoulet vộgộtarien vegetarian bean casserole catalane, la with tomatoes, black olives and garlic cavaillon honeydew melon caviar caviar caviar daubergine purộed roasted aubergines...
- 145
- 682
- 0
Tài liệu Báo cáo khoa học: "Learning to Translate with Multiple Objectives" doc
... Sa a Hasan, and Hermann Ney 2008 s Automatic evaluation measures for statistical machine translation system optimization In International Conference on Language Resources and Evaluation, Marrakech, ... features and maximum correlation training for machine translation evaluation In NAACL Chang Liu, Daniel Dahlmeier, and Hwee Tou Ng 2011 Better evaluation metrics lead to better machine translation ... statistical machine translation In ACL A Lavie and A Agarwal 2007 METEOR: An automatic metric for mt evaluation with high levels of correlation with human judgments In Workshop on Statistical...
- 10
- 624
- 0
Báo cáo khoa học: CmtR, a cadmium-sensing ArsR–SmtB repressor, cooperatively interacts with multiple operator sites to autorepress its transcription in Mycobacterium tuberculosis pptx
... CTCGGCCTCAACTACAGTCGT ACAGGTAGCTGAGCAGCAGAC CAGCTAGCTGGCCGGGATAGC P1F P1R GCCGATCATATCTGCTATGG CCATAGCAGATATGATCGGC P2F P2R ATGTACAATTCAGCTCTTGCT AGCAAGAGCTGAATTGTACAT P3F P3R GCTGTTATACCAGTATATGG CCATAT ... CCATAT ACTGGTATAACAGC P4F P4R TGGTGTACTAATTTGATCTATG CATAGATCAAATAGTACACCA H1 CGAGTCGACCGGAGGACCTTT GGCCCTGCGTCGACCGA TCGGTCGACGCAGGGCCAAAG GTCCTCCGGTCGACTCG H2 Experiment CmtR protein expression ... (5¢- to 3¢) P1 GTACTATTGGATCCATGCTGACG P2 GTCCTGTAAGCTTAAGTCGTGTC P3 P4 P6 TTCCCGCATCTCACACGTCA CATATCTGCTATGGATGTAC GTCACACCTTTCGTCGCAGC P8 94RTf 94RTr 1994intR TGTTATACCAGTATATGGTGTACTA CTCGGCCTCAACTACAGTCGT...
- 12
- 462
- 0
báo cáo hóa học: " Microglia use multiple mechanisms to mediate interactions with vitronectin; non-essential roles for the highly-expressed avb3 and avb5 integrins" pptx
... Macrophage and retinal pigment epithelium phagocytosis: apoptotic cells and photoreceptors compete for alpha v beta and alpha v beta integrins, and protein kinase C regulates alpha v beta binding and ... cytometry and biochemical analysis revealed that microglia also express low levels of the alternative vitronectin receptors, avb1 and avb8 integrins Taken together, we conclude that the avb3 and ... (RMV-7), antib1 monoclonal antibody (Ha2/5) or control antibodies were included at a concentration of μg/ml The assay was stopped by adding ml of DMEM and washing off any loosely attached cells The attached...
- 10
- 279
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25