... investigate adaptivity in spoken dialogue systems in order to enable users to interact with the speech -based systems ina more flexible and natural way The practical goal of AthosMail is to give an ... naturalness and appropriateness of each system utterance, as well as provide any other comments that they may have on adaptation and adaptive systems All interviewees agreed on one major theme, namely ... Message length 24 lines U: Read Sakari Rantala's message S: Third message, from Sakari Rantala, about Re: Comments about the draft [reads the message] Message read You are in the first message...
... weekly, and the valves were adjusted as required to maintain constant rates The sampling and analytical process was computer controlled TVOC was determined as the sum of all chromatographic peaks in ... with age and in the house parameters, principally air change rate, temperature and relative humidity Air change rates in the house, which was operated at a single defined condition for all the sampling ... the HAC fan was operated continuously with the outdoor air intake sealed, and the indoor temperature was maintained by thermostatic control of the heating or air conditioning equipment Air samples...
... identification and time sequence Medial and lateral tibial plateau bone area was summed to obtain tibial plateau bone area CV have been assessed for the medial and lateral tibial plateau, and found ... pixels was also obtained [20] The assessment of cartilage defects Cartilage defects in the medial and lateral tibial femoral cartilages were graded on the MR images with a classification system as ... increase in BMI adjusted for age, tibial plateau area Odds of tibiofemoral cartilage defects per unit increase in BMI adjusted for age, tibial plateau area, and baseline BMI Odds of bone marrow...
... Lexical entries are themselves classes, and any information they contain is standardly specific to an individual word; lexical and non-lexical classes differ in that analysis and generation take ... representing default information, which we refer to as the 'main' equation set These may be overridden by eontlleting information ina more specific class Each equation ina main set functions as an independent ... property m a y override another when assigned ina main equation set, but cause failure when assigned ina variant set Normally, variant sets are defined so as to be mutually exclusive; a FS that unifies...
... and plan for a strategy in educational management of organizations in Vietnam and Asia [3] However, there are no DSS applications to apply a real case in the domain of an evaluation and a strategic ... strategic planning The final step is to build a Web -based DSS application based on AHP model for an evaluation and a strategic planning of a university Analytic Hierarchy Process (AHP), developed ... an evaluation and a strategic university planning For the implementation, a Web -based DSS is based on ISO 9000 factors for the evaluation and strategic planning for a case study of Vietnam National...
... for (a) training and (b) tagging Machine learning components in Argo In order to ensure flexibility in building workflows, we split the machine learning capability into three distinct processing ... namely feature generator, model trainer and tagger The trainer and the tagger are intrinsic machine learning components, whereas the feature generator is a convenient and customisable processing ... recognition task at jnlpba In Proc of the International Joint Workshop on Natural Language Processing in Biomedicine and its Applications, JNLPBA ’04, pages 70–75, Geneva, Switzerland Association for...
... train leaves at 3:00 pm on Saturday and StoMa), and it takes hour 12 rains The 2nd train leaves at 3:20 p m ever)' da3, and it takes I hour 22 rains The 3rd train leaves at 4:00 pm on Sunda), and ... seventh train leaves at 5:OOpm on Saturda); and it takes I hour 12 rains Please say "list" to hear trains at a time, or say "add constraint" to constrain your departure time or travel day, or say "continue" ... functionality, hints for talking to TOOT, and links to task pages Each task page contained a task scenario, the hints, instructions for calling TOOT, anal a web survey designed to ascertain the depart...
... swift transformation taking place in the global economy makes occupation cluster analysis particularly valuable The global integration of markets has eliminated many regional competitive advantages ... coatings that provide wear-resistance and water-proofing for fabrics in apparel and textiles? Chances are, the people managing apparel and textile businesses in Brown County have no idea of what ... normally fail In contrast, public investments that are the product of open participation and strategic thinking can create sustainable transformations The Who: Building a Leadership Team Capable...
... trailers as their place to roost • Could not be herded into the trailers easily – had to walk up narrow, steep ramp to access trailer doors • Had to be individually caught and manually placed inside ... http://www.motherearthnews.com/Real-Food/2007-1001/Tests-Reveal-Healthier-Eggs.aspx#ixzz27LvkfgLn Other Benefits of Pastured Poultry • Ethical concerns • Appealing appearance of flock to customers You’re not just marketing a product, you are marketing a way of life! Pastured ... advanced feathering – use feathering as a guide for decreasing temperature as the amount of feathering a chick has will dictate its cold-tolerance Look for signs of stress in the chicks to make sure...
... the individual rational balance agents maintain among their beliefs, goals, intentions, commitments, and actions [2] As desiderata for the theory of performatives, we demonstrate that the analysis ... of declarative mood utterances, and then the illocutionary act definitions for requesting and asserting Finally, we combine the various analyses natural language processor's task by making explicit ... understanding, that is, to achieving a state of BMB that he is ina certain mental state Below is a definition of a speaker's requesting an addressee to achieve p Definition {REQUEST spkr addr...
... relevant features (such as L-marking, Case, and 0) If we adhere to the representational paradigm used above, we can define Chains in the following manner: Chain Schevaa Node: C-Node: {Cat,Level,Pos,ID,Ftrs} ... a particular representation provides a formal characterisation of locality Just as phrase structure is defined in terms of branches, we can define Chains as a sequence of links More specifically, ... structures are limited to some combination of binary (non-terminal) and unary (terminal) branches As discussed above, we can characterise the representational framework in terms of nodes and schemas:...
... listener can implicitly convey acceptance [2] by making an utterance which cannot be interpreted as initiating a negotiation dialogue Since both parties are engaged ina cooperative dialogue in which ... accept any claims that the speaker made or to initiate a negotiation dialogue Acceptance can be communicated in two ways Either the listener can explicitly indicate acceptance (e.g., "oh, alright"), ... unrelated to the original Obtain-Info-Ref, though still related to the problem-solving action of Instantiate-Var in order to build a plan to take CIS360 Since a new discourse plan is being pursued,...
... errors ina verb modality corpus for machine translation with a machine-learning method ACM Transactions on Asian Language Information Processing, 4(1):18–37 Tetsuji Nakagawa and Yuji Matsumoto ... 1993 Building a large annotated corpus of English: the Penn Treebank Computational Linguistics, 19(2):310–330 Masaki Murata, Masao Utiyama, Kiyotaka Uchimoto, Hitoshi Isahara, and Qing Ma 2005 Correction ... translation In Proceedings of the 41st Annual Meeting of the Association for Computational Linguistics, Companion Volume, pages 205–208 Eleazar Eskin 2000 Detecting errors within a corpus using anomaly...
... dominating unfocussed material are [-focus] In order to arrive at an accentuation pattern, three rules and a well-formedness condition are to be applied to this input A first rule (see (2)) applies ... arguments are normally labelled s and therefore likely to receive accent, there are some cases where we not want an argument to be accented A case in point are [-focus] pronouns In (Ta) we have ... element of a phrase will bear the accent when the phrase is in focus: after the application of focus assicmment and w/slabelling rules, an accent will be assigned to every terminal that is connected...
... of a web -based HRA with tailored feedback at the workplace In the present study we evaluated initial health-behaviour change among employees who voluntarily participated ina web -based HRA including ... health-behaviour change in general, increase in physical activity and improved diet These findings may imply that the program is capable of stimulating health-behaviour change among those at ... change These findings indicate that among voluntary participating employees, a web -based HRA program with tailored feedback could motivate those in greatest need of health-behaviour change A...
... (indinavir, saquinavir, lopinavir, atazanavir, or fosamprenavir) Statistical Analysis The first analysis evaluated participant characteristics associated with initiation of HAART Baseline variables ... randomized, doubleblind trial comparing combinations of nevirapine, didanosine, and zidovudine for HIV-infected patients: the INCAS Trial Italy, The Netherlands, Canada and Australia Study JAMA 1998, 279:930-937 ... initiate HAART at baseline are summarized in Table Compared with individuals who remained HAART-naive at baseline, those who initiated therapy were more likely to be older (P < 0001), have an...
... heavy pages with appropriate formatting and images if appropriate General Findings The general findings and recommendations from the evaluation are: Finding 1: Instructors are generally motivated ... the appropriate use of internal hyperlinks and anchors so that the user can easily jump around within a page Maintain consistent organization of material Attempting to keep the format of assignments ... Four additional areas of general findings and recommendations are: Finding 1: Instructors are generally motivated to an excellent job of teaching in an online environment but are not always familiar...
... below, and in much more detail in Archer, Garrison, and Anderson (199 9a) Oral and Text -based Communication Traditionally, educational interactions have been based upon oral communications between and ... states that the ``act of collaboration is an act of shared creation and/or shared discovery'' (p 4) Collaboration is an approach to teaching and learning that goes beyond simple interaction and ... of a community of inquiry such that coherence and meaning are apparent As essential as cognitive presence is in an educational transaction, individuals must feel comfortable in relating to each...
... GGAAGGCTGTGCAGTAATCTAGG, TCCCTTTTCCAGCCTGCC, and bioCTGTGCAGT(L)ATCTAGGCTGAAGG; and MICA-250: AAGGTGATGGGTTCGGGAA, TCTAGCAGAATTGGAGGGAG [21], and bioCTCAGGAC(L)ACGCCGGATT For the MICA250 assay, a genotyping ... MICA-25 0A in our data As there are many links between the innate and adaptive immune systems and involvement of pathogens in the initiation of RA is discussed (reviewed by Falgarone and colleagues ... no association of MICA-250, a two-marker haplotype consisting of MICA-25 0A and a certain HLA-DRB1 allele should have the same transmission rate as a two-marker haplotype consisting of MICA-250G...
... smoking for males and females Missing data on age at first sex for male and females Missing data on partners in past year for males and females Missing data on consulting a traditional healer ... (67.5%) Missing marital status for male and female Missing data on education for males and females Missing SES index for 45 males and 69 females Missing data on current smoking for males, and on ever ... literacy are low and the main income-earning activities are growing bananas, coffee and beans, and trading fish [18] HIV seroprevalence reported in this study is a representation of the national...