as of now first line combination treatments with nucleoside and nucleotide analogs or peg ifn α nucleos t ide analogs are not indicated there is only one study comparing a combination therapy with lam a
Báo cáo khoa học: "Combination therapy with docetaxel and S-1 as a first-line treatment in patients with advanced or recurrent gastric cancer: a retrospective analysis" docx
... 10.1186/1477-7819-8-40 Cite this article as: Tanabe et al., Combination therapy with docetaxel and S1 as a first- line treatment in patients with advanced or recurrent gastric cancer: a retrospective analysis World ... W, Narahara H, Hara T, Takagane A, Akiya T, Takagi M, Miyashita K, Nishizaki T, Kobayashi O, Takiyama W, Toh Y, Nagaie T, Takagi S, Yamamura Y, Yanaoka K, Orita H, Takeuchi M: S-1 plus cisplatin ... retrospective study demonstrated that the docetaxel and S-1 combination has good clinical activity with acceptable toxicity when administered as a first- line treatment for patients with advanced...
- 7
- 407
- 0
báo cáo hóa học:" Discontinuation of standard first-line antiretroviral therapy in a cohort of 1434 Malawian children" ppt
... related to 3TC, as shown in Table The median time to substitution of alternative firstline ART was two months, with a range of 10 days to 28.1 months Of the patients on alternative first- line ART, ... Insights into the reasons for discontinuation of the first highly active antiretroviral therapy (HAART) regimen in a cohort of antiretroviral naïve patients I.CO.N .A Study Group Italian Cohort of Antiretroviral-Naïve ... International AIDS Society 2010, 13:31 http://www.jiasociety.org/content/13/1/31 Page of Table Reasons for discontinuation of standard first- line ART regimen Reason for discontinuation of standard first- line...
- 4
- 300
- 0
Báo cáo khoa học: Structures of Phanerochaete chrysosporium Cel7D in complex with product and inhibitors ppt
... weaker than average Both the structural setting and the density suggest that the interactions of Arg240 with sugar compete with a salt link to Asp248, and a hydrogen bond to Gln172 Fewer interactions ... placement of O4 allows the disaccharide to make a direct hydrogen bond to Arg240 The guanidino group of that side chain has rotated slightly, so that it interacts with O4 and O5, instead of O5 and ... this is the only one of the polar interactions that is preserved in this site The hydrogen-bonding capacity of O3 is saturated by interactions with the side chains of His223, Asp209 and Glu212, and...
- 13
- 421
- 0
Báo cáo hóa học: " Research Article Generalization of an Inequality for Integral Transforms with Kernel and Related Results" potx
... Inequalities and Applications 13 Remark 2.20 In the case of Caputo fractional derivative of order α > 0, we well use the n α notation Ms ,t instead of Ms ,t and we replace vi x with ui x , ui x with D a ui ... Let α ∈ R and g ∈ ACn a, b Then the Caputo fractional derivative see 5, p 270 of order α for a function g is defined by t Γ n α α D a g t g n t s a s α n ds, 2.12 where n α 1; the notation of α ... , and q x with QD x Remark 2.21 In the case of L∞ fractional derivative, we will use the notation Ms ,t instead of β α Ms ,t and we replace vi x with Da ui x , ui x with Da ui x , and q x with...
- 17
- 335
- 0
Báo cáo y học: " Efficacy, safety and pharmacokinetic of once-daily boosted saquinavir (1500/100 mg) together with 2 nucleos(t)ide reverse transcriptase inhibitors in real life: a multicentre prospective study" ppt
... copies/ml, or the test had not been requested in cases of treatment interruption for a long period, so that it was not expected to add relevant data The baseline characteristics of the 514 patients included ... maintenance therapy [23,24] We are aware that the open-label characteristics of the study, the heterogeneity of the analyzed population and the lack of available genotypic resistance tests in ... All these factors and its once-daily administration make this regimen make this regimen worth to be considered as an alternative in patients with no SQV resistance-associated mutations In addition,...
- 9
- 326
- 0
báo cáo khoa học: "First-line treatment for chronic myeloid leukemia: dasatinib, nilotinib, or imatinib" ppsx
... imatinib treatment, with activity against a range of BCR-ABL mutations, and an acceptable toxicity profile Inhibitors for T3 15I mutant Resistance to imatinib or relapse in patients with CML arises ... interruption and reduction and/ or supportive care ALT: alanine aminotransferase; AST: aspartate aminotransferase; BID: twice daily; QD: once daily Cytopenias Cytopenias such as neutropenia, thrombocytopenia, ... are active against the T3 15I-mutated form of BCR-ABL are being developed MK-0457, a potent inhibitor of BCR-ABL and aurora kinases, was the first agent to show clinical activity against the T3 15I...
- 10
- 478
- 2
Báo cáo y học: "Küttner’s tumor of the sub-mandibular gland associated with fibrosclerosis and follicular hyperplasia of regional lymph nodes: a case report" pdf
... Harada K, Sasaki M, Sato Y, Minato H, Watanabe K, Kurumaya H, Katayanagi K, Masuda S, Niwa H, Tsuneyama K, Saito K, Haratake J, Takagawa K, Nakanuma Y: Abundant IgG4-positive plasma cell infiltration ... the manuscript KK, KS and YA made the final histopathological diagnosis and revised the manuscript for important intellectual content HS provided the clinical data All authors have read and approved ... thank the patient, nurses, and other medical staff Author details Oral and Maxillofacial Surgery, Department of Oral Restitution, Division of Oral Health Sciences, Graduate School, Tokyo Medical...
- 7
- 363
- 0
Báo cáo y học: "The Meq oncoprotein of Marek’s disease virus interacts with p53 and inhibits its transcriptional and apoptotic activities" pps
... CCTTCCCTGACGGCCTATCTGTACCCCTAACGGTGACCCT AGGGTCACCGTTAGGGGTACAGATAGGCCGTCAGGGAAGG L-Meq GCGAATTCTATGTCTCAGGAGCCAGAGCC GGCTCGAGTTATGAGGGCGCAAACTT S-Meq GCGCCCAGCTCTGCTCGACCCCACCACCTCCCATCTGTAC VS-Meq CCCAACCTCCTATCTGTACCCCTCCATCGCCGGGGACGGT ... CCCAACCTCCTATCTGTACCCCTCCATCGCCGGGGACGGT GTACAGATGGGAGGTGGTGGGGTCGAGCAGAGCTGGGCGC ACCGTCCCCGGCGATGGAGGGGTACAGATAGGAGGTTGGG ΔMeq GCTGCAGAGGGCCAATGAACACCGAGGATCCCGAACAGGA TCCTGTTCGGGATCCTCGGTGTTCATTGGCCCTCTGCAGC ... p53 plays a major role in the protection of cells from malignant transformation via its ability to transactivate target gene expression and mediate downstream events, such as apoptosis and cell...
- 11
- 248
- 0
Báo cáo khoa học: "Disintegration of Dung Pats from Cattle Treated with the Ivermectin Anthelmintic Bolus, or the Biocontrol Agent Duddingtonia flagrans" ppsx
... and the statistical analysis was performed with Intercooled Stata 7.0 for Windows NT (Stata Corporation, College Station, Texas, USA) To obtain normal distribution and equal variances, weight of ... m was Disintegration of Cattle Dung Pats designated for deposition of the faecal pats Prior to deposition of the pats, the pasture was mowed to approximately cm The plot area was divided into ... pastures at the Research Centre These cattle were primarily part of a grazing experiment where alternative strategies for gastrointestinal nematode parasite control were investigated The strategies...
- 10
- 192
- 0
Báo cáo y học: "Association of chemokine receptor gene (CCR2CCR5) haplotypes with acquisition and control of HIV-1 infection in Zambians" pdf
... technical staff and students at the virology laboratory at the University Teaching Hospital, Lusaka, the immunogenetics laboratory at UAB School of Public Health; and the data analysis group at UAB ... preparation of multiple drafts of the manuscript LH* performed the laboratory work, participated in the statistical analyses and participated in the preparation of multiple drafts of the manuscript ... manuscript WS assisted in planning the laboratory work, performed the assays, and reviewed the manuscript IB prepared analytic data sets of the clinical, epidemiologic, and genetic data; and assisted in...
- 9
- 386
- 0
Development of liquid phase microextraction techniques combined with chromatography and electrophoresis for applications in environmental analysis
... identification and quantification (by analytical instruments), statistical evaluation and action Chromatographic and electrophoretic instruments coupled with a variety of detectors are very powerful analytical ... preconcentrate the target analytes to a detectable concentration level Sample preparation is a critical step in the entire environmental analytical protocol as contamination or loss of analytes in this ... will affect the ultimate analytical accuracy and quality significantly [1] To date, there are some sample preparation methods that are well established and that provide good extraction and preconcentration...
- 144
- 320
- 0
Patterns and determinants of chinas bilateral intra industry trade with japan and korea
... with China‟s trade data The first analysis shows that due to the significant trade liberalization and trade expansion within East Asia, trading pattern of China and its two major trading partners ... descriptive and empirical analysis The descriptive analysis will investigate the major trade characteristics of Northeast Asia and the evolution of China's trade relation with Japan and Korea It will ... China-Japan (China-Korea) trade, Japanese data (Korean data) on RD and SE are used23 FDI data from Japan and Korea are obtained from Japan Ministry of Finance and the Export-Import Bank of Korea...
- 54
- 333
- 0
báo cáo hóa học:" Randomized phase II study with two gemcitabine- and docetaxel-based combinations as first-line chemotherapy for metastatic non-small cell lung cancer" docx
... responsible for patient care and data acquisition FZ was in charge of quality control and monitoring MDA and ON were responsible for data management and statistical analyses AP, GLF and DAM wrote the first ... status [2,3] Among active chemotherapeutic agents, cisplatin has historically been considered the most effective in both the palliative treatment of metastatic disease and the combined-modality ... platinum-based polychemotherapy remains the standard treatment for metastatic disease We evaluated the preclinical activity of docetaxel and gemcitabine in established NSCLC cell lines (RAL, CAEP)...
- 8
- 538
- 0
Báo cáo hóa học: " First-line chemoimmunotherapy in metastatic breast carcinoma: combination of paclitaxel and IMP321 (LAG-3Ig) enhances immune responses and antitumor activity" pptx
... measurable disease, adequate bone marrow, liver and renal function, and life expectancy of at least months Previous hormonal therapy for metastatic breast cancer or cytotoxic adjuvant chemotherapy ... trastuzumab, had received prior chemotherapy for metastatic breast adenocarcinoma, or radiotherapy within the 30 days prior to first dosing of the study drug, known cerebral metastases or had a disease-free ... chemotherapy was allowed Biphosphonate therapy was allowed if started at least weeks prior to first dosing of the study drug Patients were excluded if they were candidates for treatment with trastuzumab,...
- 11
- 472
- 0
Báo cáo y học: "Assessing the psychometric properties and the perceived usefulness of the BasisRaadsOnderzoek (BARO) as a first-line screening instrument for juvenile offenders" ppt
... development of the BARO, a standardized screening instrument was not available for CPB workers, resulting in a vast qualitative and quantitative variety of reports As a result, it was not clear why ... in the past, it was not possible to compare the duration of BARO administration In the past, it was neither practice to interview youth and parents separately, nor to interview third party informants ... lived with (at least one of) their biological parents at the time of their arrest The majority attended school (94%) Only a small group had had a child protection measure in the past (5%), or had...
- 7
- 382
- 0
Prevalence of Celiac disease in Turkish children with type 1 Diabetes Mellitus and their non-diabetic first-degree relatives pptx
... autoantibodies to tissue transglutaminase in first- degree relatives of patients with type diabetes is not associated with islet autoimmunity Diabetes Care 2001; 24: 504-9 11 Hanukoglu A, Mizrachi A, Dalal ... the Fisher exact probability test A p value of
- 5
- 453
- 0
Comparison of the obstetric anesthesia activity index with total delivery numbers as a single denominator of workload demand in Israeli maternity units doc
... personnel Accordingly, the OAAI is not a measure of the total activity of the obstetric anesthesia services Based on these limitations, it is important to appreciate that although the OAAI is numerically ... epidural analgesia and cesarean anesthesia to the total OAAI in individual hospitals Data for 2005 (left) and 2007 (right) The OAAI correlated with epidural rates and cesarean rates more closely than ... system A national observational study is underway in Israel to assess the obstetric anesthesia workforce supply and work load demand ratio, based on the OAAI, and to correlate this with quantifiable...
- 14
- 610
- 0
Digital Cinema System Specification Version 1.2 with Errata as of 30 August 2012 Incorporated pptx
... Annotation Text parameter (optional), if present, is a free-form, human readable annotation associated with the asset It is meant strictly as a displayable guidance for the user • File Integrity ... and storage 3.3.4.2 Synchronization The Broadcast Wave (.wav) file is required to contain metadata that indicates the first sample of audio data The metadata is also required to contain a continuous ... image essence or audio essence in this state Packaging is a way to organize and wrap this material in such a way as to make it suitable for storage and transmission to its destination, where it...
- 155
- 789
- 0
Báo cáo khoa học: "A Combination of Active Learning and Semi-supervised Learning Starting with Positive and Unlabeled Examples for Word Sense Disambiguation: An Empirical Study on Japanese Web Search Query" pdf
... with- EM, random and without-EM are gradually increasing according to the percentage of added hand labeled examples and catch up that of human and converge at 30 percentage added points This result suggests ... data instances, the number of feature, and the percentage of positive sense instances for each data set Assigning the correct labels of data instances is done by one person and 48.5% of all the ... Input T ← Initial unlabeled dataset which contain ambiguous words # Initialization P ← positive training dataset by full text search on T N ← φ (initial negative training dataset) repeat # selecting...
- 4
- 441
- 1
báo cáo hóa học: " Quality of life in chemical warfare survivors with ophthalmologic injuries: the first results form Iran Chemical Warfare Victims Health Assessment Study" potx
... Authors' contributions 17 BM was the principal investigator and was responsible for the study design, data analysis, and wrote the first draft MRS and BM collected the SF-36 data and extracted patients' ... patients' case records AM analyzed the data and wrote the final manuscript MRS, AM and BM actively contributed to all elements of the study All authors read and approved the final manuscript Acknowledgements ... other warrelated injuries and psychological problems, and history of hospitalization during the last year Statistical analysis In addition to descriptive statistics, the patients' scores on the...
- 8
- 383
- 0
Tìm thêm: xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25