arti cial intelligence a term used to describe the use of a system
MODELING OF ESTUARINE WATER QUALITYINTRODUCTION Estuarine water quality is a term used to describe doc
... reach broad areas in the estuary due to mixing within the estuary and the fact that the material will pass through the estuary on its way to the ocean On the other hand, material discharged near ... impact of sources of material to an estuary are dependent upon the character and amount of the material and the location in the estuary where the material enters Materials which enter with the river ... 1966) What are the factors that control the quality of waters in estuaries? The predominant factors are the hydraulic (transport) characteristics of the estuary, the inputs or sources of materials...
- 13
- 277
- 0
Refusals to invitations the use of vietnamese learners of english and the use of native speakers of english a comparison
... the Turkish subjects refused a bit less than the others The Turkish and American subjects used pause fillers and then statements of gratitude and appreciation, while the Laotian respondents used ... situations It was found that the frequency of the use of the speech act of refusal by the Australian NSs of English was different from that by the VLEs Although the VLEs and the Australian NSs of ... perceive the status of the interlocutor in the same way and therefore they not always choose the same strategies for the same speech act in general and the speech act of refusal in particular (Kwon,...
- 44
- 1,183
- 4
cáo khoa học: " A knowledge translation collaborative to improve the use of therapeutic hypothermia in post-cardiac arrest patients: protocol for a stepped wedge randomized trial" pdf
... who are transferred to a participating hospital following an OHCA Trained in-hospital data collectors will complete chart abstraction of the variables related to post-arrest care for each of the ... Michael’s Hospital, Past Chair of the Advance Cardiac Life Support Committee of the American Heart Association and the Co Chair of the Advance Life Support Task Force of the International Liaison Committee ... reporting of laboratory CPR research A statement for healthcare professionals from a Task Force of the American Heart Association, the American College of Emergency Physicians, the American College of...
- 7
- 435
- 0
báo cáo khoa học: " A quasi-experimental test of an intervention to increase the use of thiazide-based treatment regimens for people with hypertension" docx
... method we used to analyze the data ignored its time series nature, and used the patient as the unit of analysis in a "before and after" analysis Using z-tests of pro- Page of 13 (page number ... data warehouse for the prevalence of hypertension, use of thiazides and other anti-hypertensives, and blood pressure goal attainment Assess and establish data quality Review and format GMS and ... Review and present literature on effectiveness of "academic detailing" to change physician behavior Patient and Administrator Liaison Team Provide informational materials to patients and answer their...
- 13
- 344
- 0
báo cáo hóa học:" Long-term follow-up on the use of vascularized fibular graft for the treatment of congenital pseudarthrosis of the tibia" pdf
... years (at 19 years old) after the surgery The average term was 10.6 years and the average age was 18.3 years old It seemed to be characteristic that these pains appeared at late adolescence These ... fibular graft which was secured by several screws End -to- end anasto- Statistical analysis Clinical data were statistically analyzed using the MannWhitney U-test for quantitative data of the term of ... was treated with a brace and it healed Ankle pain Ankle pain was seen in out of the cases, regardless of its severity These pains appeared 12 years (at 19 years old), years (at 17 years old) and...
- 7
- 502
- 0
P L U G - I NT4Decision Making Using ExcelLEARNING OUTCOMES1. Describe the use of the IF pptx
... Goal Seek is an analytical function that allows a value in a formula to be adjusted to reach a desired result or answer Goal Seek can eliminate unnecessary calculations that can be used to determine ... determine a single variable value in a formula For example, a salesperson might participate in a bonus program that pays percent of all sales dollars The salesperson wants to receive a bonus of at least ... option button and type 800 in the text box to the right The Value of option button sets the target cell to a particular goal to determine the variable mix needed to reach the milestone The dialog...
- 14
- 539
- 0
UNDERSTANDING SOCIAL INTEGRATION PROCESSES IN THE USE OF ENTERPRISE SYSTEMS (ES) a SOCIAL CAPITAL PERSPECTIVE
... positive social capital in organizations The sections 2.4.1 and 2.4.2 have outlined the key advantages and disadvantages of social capital so as to provide a general notion to facilitate data analysis ... organizational advantage (Nahapiet and Ghoshal, 1998) and, second, to encounter challenges and even turn them to advantages 2.4.2 Social Capital Disadvantages It is an undeniable fact that social ... the social artifacts embedded in the use of an ES These social artifacts, if managed or facilitated properly, will bring value to organizations, as they become strategic capital and a source of...
- 256
- 259
- 0
Báo cáo hóa học: "An Artificial Intelligence Approach for Modeling and Prediction of Water Diffusion Inside a Carbon Nanotube'''' potx
... that in the case of overtraining, usually the total number of fitting parameters in the ANFIS is more than the number of pairs in the training data set The root mean squared error (RMSE) was used ... well to the training data set in such a way that further improvement based on the training data set not only impairs more accurate predictions of the checking data set but may also have adverse ... number to obtain the maximum performance of the designed ANFIS since we should take care of overtraining In a sense, the so-called ‘‘overtraining’’ term indicates that a given ANFIS adapts itself too...
- 5
- 424
- 0
A study to indicate the importance of consumer based-brand equity on consumer perception of brand (a case study of fast food restaurants).pdf
... increase the competitive advantage of the fast food restaurant The basic attribute of a fast food restaurant are also important for a fast food restaurant to excel because the strength of a brand ... McDonald and Max hamburger because the sample is small to represent all the actual customer of both restaurant and also the fact that the students lived together may also have harmonise their answers ... MacDonald can be said to have a larger degree of dispersion of data around the mean than Max hamburger in those attributes Max hamburger had a larger standard deviation than MacDonald in these attributes“its...
- 88
- 986
- 8
A computational study to investigate the effects of insulation and EGR in a diesel engine
... Transactions, vol 92, 1983, p 3.1086 [29] Arash Nemati, Shahram Khalilarya, Samad Jafarmadar, Hassan Khatamnejhad, Vahid Fathi Numerical parametric investigation of a gasoline fuelled partially-premixed ... temperature regions for baseline and adiabatic with EGR cases are the same Also at adiabatic case for 400°CA and 420°CA, these regions more spread out in the main chamber and the values of local ... working as a faculty in the department of Mechanical Engineering at Jubail University, Jubail, Saudi Arabia He also worked as a Professor and Head of department in the Department of Mechanical Engineering,...
- 20
- 643
- 0
A study on the use of language activities to enhance 11th grade student's speaking skill in pham hong thai school, hung nguyen district, nghe an province
... class, language activities are often exerted because the use of language activities is a way for the teacher to improve the students ability to use the language meaningfully Also, they can alter the ... views of the goal of language teaching, the goal of the native speaker and the goal of a proficiency level "A second language learner may attain native 39 speaker levels of proficiency and therefore ... the use of questionnaires enables the research to collect data from a great number of participants The data themselves were more amenable to qualification as well as qualification 44 Finally, the...
- 98
- 807
- 6
Tài liệu HOW TO MEASURE THE IMPACT OF A CRM STRATEGY ON THE FIRM PERFORMANCE doc
... have the help of sophisticated information systems and data warehouses been able to manage a great deal of data The challenge is to capture and measure soft and qualitative information For example, ... Frigo and Krumwiede, 2000; Kaplan and Norton, 1992) They not link the non-financial metrics to financial numbers (e.g Kaplan and Norton, 1992) Traditionally financial and non-financial measures have ... Skandia Navigator (Edvinsson and Malone, 1997) Value Chain Scoreboard (Lev, 2002) Description of measure Sets of human capital indicators are collected and bench-marked against a database Similar to...
- 15
- 796
- 0
Tài liệu In this lab, 2 ISDN routers are required. If ISDN routers are not available, review the lab to become familiar with the process. An Adtran Atlas550 ISDN emulator is used to simulate the switch/ISDN cloud. pdf
... Please refer to the chart at the end of the lab to correctly identify the interface identifiers to be used based on the equipment in the lab The configuration output used in this lab is produced ... Sydney(config-if)#dialer string 5551001 Step Associate dialer profiles a Finally, associate the Dialer Profiles with the Dialer Interfaces that will be used, when needed Create a Dialer Pool, and put the interfaces ... to the chart: • The hostname • The console • The virtual terminal • The enable passwords If there is a problem completing this, refer to the Network Address Translation (NAT) configuration lab...
- 8
- 419
- 0
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc
... GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for amplification of pyk The resulting PCR ... equal amounts of formate and acetyl-CoA and the resulting acetyl-CoA is then metabolized into equal amount of ethanol and acetate to maintain the redox balance Discussion In this study we quantified ... (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) were amplified The PCR products were digested with XhoI ⁄ BamHI and BamHI ⁄ XbaI, respectively, and cloned...
- 12
- 616
- 0
Tài liệu Water Pollution Control - A Guide to the Use of Water Quality Management Principles ppt
... of water and/or the quality of the suspended particulate matter, the bottom sediment and the biota Many water quality criteria set a maximum level for the concentration of a substance in a particular ... historical, preferably quantified, information available about their abundance and other critical factors relevant to the state of the organisms • Exhibit a graded response to a variety of human-induced ... under way to select mammalian, avian and reptilian species The absence or presence of Atlantic salmon is used as an indicator of the functional integrity of the Rhine riverine ecosystem and of the...
- 459
- 4,872
- 0
Water Pollution Control - A Guide to the Use of Water Quality Management Principles ppt
... Other international organisations, in particular the International Association for Water Quality (IAWQ) and the International Water Resources Association (IWRA) have provided support to the Working ... Group Additional support has also been received from bilateral and other external support agencies, particularly the Ministry of Foreign Affairs/DGIS of the Netherlands Financial support for the activities ... countries, UN agencies, bilaterals, professional associations, and academic institutions have all contributed over the last three and a half years The Council is grateful to them, and I want to express...
- 14
- 721
- 0
Ten Ways to Improve the Security of a New Computer doc
... sure to research these features before disabling or modifying them The AutoRun feature in Microsoft Windows systems was a default feature at the time of the Conficker malware and was one of the ... automatic updating Enable that feature so your software always has the most current signatures If automatic updates aren’t offered, be sure to install the software from a reputable source, like the vendor’s ... daily, and vendors frequently make new signatures available, so antivirus software will be most effective if the signatures are up to date Many antivirus and antispyware programs offer automatic...
- 5
- 620
- 0
Báo cáo khoa học: A region within the C-terminal domain of Ure2p is shown to interact with the molecular chaperone Ssa1p by the use of cross-linkers and mass spectrometry doc
... identify all the peptides in our list using the available softwares (gpmaw [30], xquest [31] and msx-3d [12]) with a mass tolerance of p.p.m We therefore used MALDITOF-TOF and ⁄ or nanoLC-Orbitrap tandem ... critical for assembly An alternative explanation that can account for this observation is that Ssa1p binds with higher affinity a conformational state of Ure2p as a result of the presence of the N-terminal ... ammonium citrate and 0.1% formic acid) and spotted (0.5 lL) on a stainless steel MALDI target (Opti-TOF; Applied Biosystems) MALDI-TOF-TOF MS and MS ⁄ MS spectra were acquired with a MALDI-TOF...
- 12
- 510
- 0
HYGIENIC PHYSIOLOGY WITH SPECIAL REFERENCE TO THE USE OF ALCOHOLIC DRINKS AND NARCOTICS BEING A REVISED EDITION OF THE FOURTEEN WEEKS IN HUMAN PHYSIOLOGY ppt
... on each side of the chest At the back, they are all attached to the spine In front, the upper seven pairs are tied by cartilages to the breastbone (sternum); three are fastened to each other and ... let others write on slates or on the blackboard At the close of the recitation, let all criticise the ideas, the spelling, the use of capitals, the pronunciation, the grammar, and the mode of expression ... expand, and become an object of great curiosity to the uninitiated By boiling bones at a high temperature, the animal matter separates in the form of gelatine Dogs and cats extract the animal matter...
- 532
- 562
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25