0

art madness and anti psychiatry a memoir

Báo cáo y học:

Báo cáo y học: "The practice of child and adolescent psychiatry: a survey of early-career psychiatrists in Japan" ppsx

Báo cáo khoa học

... design and data collection, and had full access to the data MT performed the statistical analysis and drafted the manuscript All authors have read and approved this paper 23 Acknowledgements The authors ... Focus on psychiatry in Japan Br J Psychiatry 2004, 184:88-92 Hayashi M, Yamazaki K: Surveys on the pregraduate and postgraduate education on child and adolescent psychiatry in Japan Psychiatry Clin ... Child and Adolescent Psychiatry and Mental Health 2009, 3:30 Background In Japan, child and adolescent psychiatry (CAP) is not a separate specialty; instead, it is considered a psychiatric subspecialty...
  • 6
  • 670
  • 0
an unquiet mind_ a memoir of moods and madness - kay redfield jamison

an unquiet mind_ a memoir of moods and madness - kay redfield jamison

Tâm lý - Nghệ thuật sống

... abroad to live—first to Scotland as an undergraduate, then to England as a graduate student, and twice again to London on sabbatical leaves from the University of California—I always knew that ... undergraduate years was trying to escape an inexplicable weariness and despair, St Andrews was an amulet against all manner of longing and loss, a year of gravely held but joyous remembrances ... biology of aquatic mammals and covered not only the biology and natural history of sea otters, seals, sea lions, whales, and dolphins, but also such esoterica as the cardiovascular adaptations made...
  • 110
  • 226
  • 0
Báo cáo y học:

Báo cáo y học: "Teaching child and adolescent psychiatry to undergraduate medical students - A survey in German-speaking countries"

Y học thưởng thức

... medicine,” “evaluation of teaching,” “practical year,” and “preparation for final examination.” The practical year is a Frank and Frank Child and Adolescent Psychiatry and Mental Health 2010, 4:21 ... article as: Frank and Frank: Teaching child and adolescent psychiatry to undergraduate medical students - A survey in Germanspeaking countries Child and Adolescent Psychiatry and Mental Health 2010 ... this article and Maria Craig for editorial assistance Statistical expert: None Financial support: None Author details Clinic for Child and Adolescent Psychiatry, Psychosomatics and Psychotherapy,...
  • 8
  • 538
  • 0
Familiar Letters of John Adams and His Wife Abigail Adams During the Revolution with a Memoir of Mrs. Adams pot

Familiar Letters of John Adams and His Wife Abigail Adams During the Revolution with a Memoir of Mrs. Adams pot

Cao đẳng - Đại học

... Familiar Letters of John Adams and His Wife by John Adams and Abigail Adams and Charles Francis Adam Abigail Adams During the Revolution, by John Adams and Abigail Adams and Charles Francis Adams ... danger, and distress Familiar Letters of John Adams and His Wife by John Adams and Abigail Adams and Charles Francis Adam 23 Deacon Sayward said at table this week in my hearing that there was ... etc., and a very genteel dinner we had Salt fish and all its apparatus, roast chickens, bacon, pease, as fine a salad as ever was made, and a rich meat pie Tarts and custards, etc., good wine, and...
  • 269
  • 350
  • 0
Familiar Letters of John Adams and His Wife Abigail Adams During the Revolution with a Memoir of Mrs. Adams potx

Familiar Letters of John Adams and His Wife Abigail Adams During the Revolution with a Memoir of Mrs. Adams potx

Khoa học xã hội

... Familiar Letters of John Adams and His Wife by John Adams and Abigail Adams and Charles Francis Adam Abigail Adams During the Revolution, by John Adams and Abigail Adams and Charles Francis Adams ... danger, and distress Familiar Letters of John Adams and His Wife by John Adams and Abigail Adams and Charles Francis Adam 23 Deacon Sayward said at table this week in my hearing that there was ... etc., and a very genteel dinner we had Salt fish and all its apparatus, roast chickens, bacon, pease, as fine a salad as ever was made, and a rich meat pie Tarts and custards, etc., good wine, and...
  • 269
  • 481
  • 0
a memoir of jane austen and other family recollections dec 2002

a memoir of jane austen and other family recollections dec 2002

Vật lý

... way We almost hear Mrs Austen delivering her great news in the hall (to Jane and Martha Lloyd, the two aunts who had been away, and not to Jane and Cassandra, as is here implied) There was also ... hearing an early version of Pride and Prejudice read aloud, and in later years the co-operative storytelling that so exasperated Aunt Cassandra Anna’s recollections are the more persuasive and ... letters, addressed from Jane to Cassandra It was with Cassandra that Jane discussed her work in any detail; Cassandra was her chief heiress and executor of her will As such she was almost solely...
  • 352
  • 296
  • 0
báo cáo hóa học:

báo cáo hóa học: " The possible link between the elevated serum levels of neurokinin A and anti-ribosomal P protein antibodies in children with autism" pot

Toán học

... elevated serum levels of neurokinin A and anti- ribosomal P protein antibodies in children with autism Gehan A Mostafa1,2, Laila Y AL-Ayadhi1 Autism Research and Treatment Center, AL-Amodi Autism ... were analyzed by commercially available software package (Statview, Abacus concepts, inc., Berkley, CA, USA) The data were non-parametric, thus they were presented as median and interquartile range ... Mostafa GA, Al-Ayadhi, LY Increased serum levels of anti- ganglioside M1 autoantibodies in autistic children: relation to the disease severity J Neuroinflammation 2011; 8:39 17- Mostafa GA, Al-Ayadhi...
  • 30
  • 522
  • 0
Báo cáo y học:

Báo cáo y học: "Is closer linkage between systemic lupus erythematosus and anti-double-stranded DNA antibodies a desirable and attainable goal" ppsx

Báo cáo khoa học

... anti- Sm antibody results in the fulfillment of two criteria, namely criteria 10 (anti- DNA /anti- Sm antibody) and 11 (a positive antinuclear antibodies (ANA) test, caused by the anti- DNA /anti- Sm antibody) ... classification and diagnosis For example, the previous presence of anti- dsDNA antibodies (by any assay) and accordingly a positive ANA test will qualify a patient with a UV-sensitive rash for SLE classification ... [19,20] The broad definition of ‘antibody to native DNA in an abnormal titer’ [4] reflects technical standards more than 30 years old and has allowed an outgrowth of methods for anti- dsDNA antibody...
  • 3
  • 336
  • 0
Báo cáo y học:

Báo cáo y học: "Adalimumab clinical efficacy is associated with rheumatoid factor and anti-cyclic citrullinated peptide antibody titer reduction: a one-year prospective study" potx

Báo cáo khoa học

... Adalimumab (n = 57) Control RA (n = 55) Total P n.s n.s ANA, antinuclear antibodies; anti- dsDNA, anti- double-stranded DNA autoantibodies; ENA, extractable nuclear antigens; n.s., not significant; ... and more than 0.280 for IgM) [30] Anti- cardiolipin and anti- β2GPI autoantibodies were evaluated at baseline and after and 12 months of adalimumab treatment The sera of the control group of patients ... autoantibodies against non-organ-specific autoantigens have been reported during treatment with TNF-α blocking agents Thus, antinuclear (ANA) and anti- double-stranded DNA (anti- dsDNA) autoantibodies have...
  • 8
  • 762
  • 0
Báo cáo y học:

Báo cáo y học: "PTPN22 polymorphism and anti-cyclic citrullinated peptide antibodies in combination strongly predicts future onset of rheumatoid arthritis and has a specificity of 100% for the disease" ppsx

Báo cáo khoa học

... was 5'-CAACTGCTCCAAGGATAGATGATGA-3 'and the reverse primer was5'-CCAGCTTCCTCAACCACAATAAATG-3' The probes were labelled at their 5' ends with FAM™ (the C allele) and VIC™ (the T allele) and the ... 1858T variant and anti- CCP antibodies ies, RFs (IgG-RF, IgA-RF and IgM-RF) and with HLA-SE in conditional logistic regression analyses The combination of anti- CCP antibodies and carriage of the ... (CT+TT), anti- cyclic citrullinated peptide antibodies (anti- CCP Abs), rheumatoid factors IgM-RF, IgG-RF and IgA-RF, and carriage of human leukocyte antigen shared epitope (HLA-SE) in pre-patients and...
  • 6
  • 322
  • 0
Báo cáo y học:

Báo cáo y học: "The in vivo expression of actin/salt-resistant hyperactive DNase I inhibits the development of anti-ssDNA and anti-histone autoantibodies in a murine model of systemic lupus erythematosus" ppt

Báo cáo khoa học

... (%) ash.DNase I = actin-resistant, salt-resistant and hyperactive mutant of DNase I; NS, not significant Total IgG antibodies to ssDNA and anti- chromatin antibodies were measured by ELISA as described ... of age age (a) IgG anti- ssDNA titres in the serum of Apcs-/-, wt.DNase I Apcs- /and ash.DNase I Apcs-/- mice Values are expressed in arbitrary ELISA units (AEU) related to a standard positive sample ... Therapy Vol No Manderson et al Figure lands) with an excitation wavelength at 485 nm and an emission wavelength at 520 nm Statistics The data are presented as mean ± standard error of the mean...
  • 11
  • 558
  • 0
Báo cáo y học:

Báo cáo y học: "Relationship between anti-dsDNA, anti-nucleosome and anti-alpha-actinin antibodies and markers of renal disease in patients with lupus nephritis: a prospective longitudinal study" pdf

Báo cáo khoa học

... nucleosomes and double-stranded DNA (dsDNA), (b) nucleosomes and α-actinin and (c) dsDNA and αactinin Absorbance ratios (ARs) for each assay are plotted against each other The Pearson correlation coefficient ... USA) and using the 'xt' commands for longitudinal data in Stata 9.2 (StataCorp LP, College Station, TX, USA) The aim of the analysis was to assess which antibody level (high-avidity anti- dsDNA, anti- nucleosome ... correlation between anti- nucleosome and high-avidity anti- dsDNA levels (r = 0.6, P = 0.0001) but no correlation between anti- nucleosome and anti- α-actinin or high-avidity anti- dsDNA and anti- α-actinin...
  • 9
  • 442
  • 0
Báo cáo y học:

Báo cáo y học: " Early Anti-inflammatory and anti-arthritic effects of yucca schidigera: A review" pdf

Báo cáo khoa học

... yucca in preventing arthritis by anti- inflammatory activity Yucca contains anti- inflammatory polyphenolics such as resveratrol and yuccaols A, B, C, D and E [18,19] Yucca bark and whole yucca plant ... of yucca on arthritis could involve antiprotozoal, anti- oxidant and anti- bacterial activities As previously mentioned, the drug metronidazole attenuates gastrointestinal inflammation and can prevent ... protozoal theory of causation of arthritis has any merit, a role of yucca in arthritis treatment can be advanced on the basis of the anti- protozoal activity of yucca saponins The chemistry and bioactivity...
  • 7
  • 369
  • 0
Báo cáo y học:

Báo cáo y học: "Anti-inflammatory effects of antidepressant and atypical antipsychotic medication for the treatment of major depression and comorbid arthritis: a case report" pdf

Báo cáo khoa học

... arthritic disease was worsening between early 2005 and 2007, she was started on a number of disease-modifying antirheumatic drugs (DMARDs) and analgesics (oxycodone, tramadol and paracetamol combined ... Eyre: Anti- inflammatory effects of antidepressant and atypical antipsychotic medication for the treatment of major depression and comorbid arthritis: a case report Journal of Medical Case Reports ... Scott LV, Dinan TG: Antidepressant therapy and C-reactive protein levels Br J Psychiatry 2006, 188:449-452 Bianchi M, Panerai AE: Antidepressant drugs and experimental inflammation Pharmacol Res...
  • 4
  • 387
  • 0
Báo cáo y học:

Báo cáo y học: " Implementing clinical guidelines in psychiatry: a qualitative study of perceived facilitators and barriers" pptx

Báo cáo khoa học

... the local leader and at department level was deemed important Academic detailing was also identified as a promoter The expert-facilitated dialogue encouraged others to measure change, and promoted ... analyzed the data TF drafted the manuscript and all other authors participated in a critical revision of the draft as well as contributing important intellectual content All authors read and approved ... example, culture and leadership, evaluation, feedback on performance and facilitation - that are likely to have an influence There were three main areas that differentiated the practitioners at...
  • 10
  • 321
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Identification and characterisation of a novel anti-viral peptide against avian influenza virus H9N" pps

Báo cáo khoa học

... 5'ATTTAAGGATCCGAGAGCCATGGA 3' 5'ATGCTGCTCGAGTTATATACAAATGTTGC 3' 5'CATAGAATTCGCAAAAGCAGGAGT 3' 5'TATCGCTCGAGAGTAGAAACAAGGAG 3' 5'AGCCTGGAATTCATGAAAAAATTA 3' 5'CTCACTCGAGACATTTTCAGGGA 3' aIn all of the above mentioned ... AGCCTGGAATTCATGAAAAAATTA 3' 5' ATCGAACTCGAGATTTTCAGGGAT 3' 5' AGGGCTGGCGGTTGGGGGTTATTCGC 3' 5' GAGTCACTTTAAAATTTGTATACAC 3' 5' GATGTTAACGATACCAGCC 3' 5' GCGTGAATGTAAGCGTGAC 3' 5'ATTTAAGGATCCGAGAGCCATGGA 3' ... pC-HA-F pC-HA-R pC-NA-F pC-NA-R pC-P1-FP pC-P1-RP 5' CATAGAATTCGCAAAAGCAGGAGT 3' 5' TATCGCTCGAGAGTAGAAACAAGGAG 3' 5' ATTTAAGGTACCGACAGCCATGGA 3' 5' ATGCTGCTCGAGTATACAAATGTTGC 3' 5' AGCCTGGAATTCATGAAAAAATTA...
  • 12
  • 288
  • 0
Báo cáo y học:

Báo cáo y học: "Immediate determination of ACPA and rheumatoid factor - a novel point of care test for detection of anti-MCV antibodies and rheumatoid factor using a lateral-flow immunoassay" pdf

Báo cáo khoa học

... http://arthritis-research.com/content/12/3/R120 Abbreviations ACPA: autoantibodies against citrullinated protein/peptide antigens; anti- MCV: autoantibodies against mutated and citrullinated vimentin; anti- CCP: autoantibodies against ... in both standardized anti- MCV and RF-ELISA (Orgentec, Mainz, Germany) The ratio of applied antigens and serum anti- MCV antibodies and/ or RF was such that monodentate binding of autoantibodies ... International), were individually conjugated to goat anti- human IgG and IgM (Dianova, Hamburg, Ger- Page of many) and mixed Anti- human immunoglobulin colloidal gold conjugate was dispensed onto a...
  • 5
  • 426
  • 0
Báo cáo y học:

Báo cáo y học: "Surprising negative association between IgG1 allotype disparity and anti-adalimumab formation: a cohort study" doc

Báo cáo khoa học

... infliximab with adalimumab and adalimumab with infliximab As controls we used rabbit anti- adalimumab-idiotype, rabbit anti- infliximab-idiotype and a monoclonal antibody to human IgG (MH16-1) Statistical ... between allotypes and anti- adalimumab antibodies Thirty-nine out of 249 patients had antibodies against adalimumab (16%); in one patient AAA could not be determined Patients without AAA had a significantly ... Mean values ± SD, median and interquartile range, or percentages are shown DAS28, Disease Activity Score in 28 joints; DMARD, diseases modifying anti rheumatic drug antibodies and that all AAA’s...
  • 7
  • 254
  • 0
Báo cáo y học:

Báo cáo y học: "Frequent coexistence of anti-topoisomerase I and anti-U1RNP autoantibodies in African American patients associated with mild skin involvement: a retrospective clinical study" doc

Báo cáo khoa học

... cases J Rheumatol 1997, 24:400-403 28 Mukai S, Sagawa A, Atsumi T, Jodo S, Amasaki Y, Nakabayashi T, Watanabe I, Fujisaku A, Nakagawa S: Three cases of anti- Scl-70 (topoisomerase I) antibody associated ... antitopoisomerase I, and antiU1RNP antibodies J Rheumatol 1993, 20:1961-1963 30 Hietarinta M, Lassila O, Hietaharju A: Association of anti- U1RNP -and antiScl-70-antibodies with neurological manifestations ... study and performed the statistical analysis MSS, MRB, ESS, and WHR enrolled patients for the study and maintained the database MS, AC, and EKLC drafted the manuscript All authors read and approved...
  • 6
  • 357
  • 1
Báo cáo y học:

Báo cáo y học: "Identification of target antigens of antiendothelial cell and anti-vascular smooth muscle cell antibodies in patients with giant cell arteritis: a proteomic approach" potx

Báo cáo khoa học

... extracts: mitochondrial fumarate hydratase, lamin A/ C and vinculin IgG reactivity against vinculin and lamin A/ C in sera from GCA patients and the HC pool are depicted in Figure and Additional ... disease activity in patients with vasculitis, particularly in those with anti- ANCA-associated vasculitis, Takayasus arteritis or GCA [15], although these data remain controversial [36] In addition, ... article as: Rộgent et al.: Identification of target antigens of anti- endothelial cell and anti- vascular smooth muscle cell antibodies in patients with giant cell arteritis: a proteomic approach Arthritis...
  • 15
  • 269
  • 0

Xem thêm