0

and metastasis by a combination of anti vegf c and enhanced il 12 therapy in an immunocompetent mouse mammary cancer model

Báo cáo khoa học: Netropsin interactions in the minor groove of d(GGCCAATTGG) studied by a combination of resolution enhancement and ab initio calculations pot

Báo cáo khoa học: Netropsin interactions in the minor groove of d(GGCCAATTGG) studied by a combination of resolution enhancement and ab initio calculations pot

Báo cáo khoa học

... torsion angles a, b, c and d are in their usual (–)-gauche, trans, (+)-gauche and (+)-anticlinal ranges, respectively Exceptions are found for the b-angle of A5 and C2 3, which are (+)-ac (144.1° and ... A side -by- side binding with a guanine base was found in d(CGTATATACG) [17] and a novel end-to-end binding of two Nt molecules was determined for d(CCCCCIIIII), d(CBr5CCCCIIIII) and d(CCCBr5CCIIIII) ... 6–31G* calculations of the interaction between (A) the amidinium end and bases A2 5, T8 and G9; and (B) the guanidinium end and bases A5 , T28 and A6 Intermolecular geometry constraint according to...
  • 11
  • 483
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " A Novel Method to Fabricate Silicon Nanowire p–n Junctions by a Combination of Ion Implantation and in-situ Doping" docx

Hóa học - Dầu khí

... even higher in special cases) depending on what kind of current conduction mechanism is dominating A value close to for the ideality factor indicates that recombination across the p–n junction through ... implanting it with phosphorus We present the details of the fabrication process, the expected dopant profiles in the NW, and electrical characterization of individual NW p–n diodes and explain ... ions at room temperature was used to obtain a rectangular dopant profile The implantation energies were 45 and 25 keV corresponding to doses of 1.3 1014 and 123 Fig The scheme of fabricating axial...
  • 4
  • 332
  • 0
Báo cáo y học:

Báo cáo y học: "Inhibitory effects on HAV IRES-mediated translation and replication by a combination of amantadine and interferon-alpha" doc

Báo cáo khoa học

... evaluated the HAV antiviral activity of amantadine and IFN-alpha We initially examined the effects of this combination on HAV IRES-mediated translation using a luciferase reporter assay Huh7 cells ... amantadine and IFN-alpha was stronger than those of Page of amantadine alone, IFN-alpha alone, and untreated control (Figure 4) IFNs are proteins induced by lymphocytes and other cells including ... IFN-alpha Suppression effects at 48 h after transfection by the combination of amantadine and IFN-alpha against HAV replication were stronger than those by amantadine or IFN-alpha monotreatment...
  • 5
  • 301
  • 0
Intravesical tumor necrosis factor alpha gene therapy mediated by a novel liposome system in an orthotopic murine bladder cancer model

Intravesical tumor necrosis factor alpha gene therapy mediated by a novel liposome system in an orthotopic murine bladder cancer model

Tổng hợp

... strategy has been tested in many cancer models and the clinical trials are under going in various cancer patients such as 20 melanoma, renal cell carcinoma, colon cancer, lung cancer, brain tumor and ... is AJCC/UICC (Table 1.1) Traditionally, Ta and T1 papillary urothelial carcinoma are called superficial cancer and T2 and above are termed as muscle invasive cancer Table1.1: Pathological staging ... cancers are transitional cell carcinoma (TCC) Other types of bladder cancer such as squamous cell carcinomas (5%), adenocarcinoma (1%), primary lymphoma, sarcoma, rhabdomyosarcoma and leiomyosarcoma...
  • 121
  • 180
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Japanese Dependency Parsing Using Co-occurrence Information and a Combination of Case Elements" pdf

Báo cáo khoa học

... the training data)1 Reranking Candidate Candidate Candidate Candidate Candidate We estimated the co-occurrence probability of the particle set and the co-occurrence probability of the case element ... dependencies have the following characteristics: Japanese dependency analysis taking account of co-occurrence information and a combination of multiple cases One constraint in Japanese is that multiple ... have an effect on improving the parsing accuracy We can also verify that the parsing accuracy improves by using imprecise information obtained from an automatically parsed corpus Klein and Manning...
  • 8
  • 481
  • 0
A Guide to the Analysis of Fish Marketing Systems Using a Combination of Sub-sector Analysis and the Sustainable Livelihoods Approach potx

A Guide to the Analysis of Fish Marketing Systems Using a Combination of Sub-sector Analysis and the Sustainable Livelihoods Approach potx

Tiếp thị - Bán hàng

... Page 42 Appendix Box A5 : Example of how changes in assets can be analysed and presented Natural capital Social capital Physical capital Financial capital Human capital Vulnerability prices may ... boats and nets), but also the public infrastructure such as landing sites, market facilities and transport infrastructure Financial assets include cash, savings and access to formal and informal ... way in which people can access and make use of their assets Natural capital Natural capital is the quality and quantity of natural resources that are available to people and above all, the access...
  • 95
  • 645
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A Combination of Active Learning and Semi-supervised Learning Starting with Positive and Unlabeled Examples for Word Sense Disambiguation: An Empirical Study on Japanese Web Search Query" pdf

Báo cáo khoa học

... issue The accuracy of the proposed approach withEM is gradually increasing according to the percentage of added hand labeled examples The initial accuracy of with-EM, which means the accuracy with ... its data instances, the number of feature, and the percentage of positive sense instances for each data set Assigning the correct labels of data instances is done by one person and 48.5% of all ... Chapter of ACL, pp 120 -127 McCallum, A and Nigam, K 1998 Employing EM and Pool-Based Active Learning for Text Classification Proceedings of the Fifteenth international Conference on Machine Learning,...
  • 4
  • 441
  • 1
Báo cáo

Báo cáo " A combination of the identification algorithm and the modal superposition method for feedback active control of incomplete measured systems " doc

Báo cáo khoa học

... Conference on Mathematics, Mechanics, and Informatics, Hanoi, 7/10/2006, on the occasion of 50th Anniversary of Department of Mathematics, Mechanics and Informatics, Vietnam National University, Hanoi ... described as (13) and (14) Numerical simulation Considering a base excited building modeled as a vertical cantilever beam as showed in Fig Fig Model of a cantilever beam subjected to base acceleration ... located to obtain a significant contribution of the information of xc This means a large norm of Cc in comparison with the norm of Cr Because the subinterval Tk ended, the information known can...
  • 8
  • 359
  • 0
Báo cáo

Báo cáo " A combination of the identification algorithm and the modal superposition method for feedback active control of incomplete measured systems" doc

Báo cáo khoa học

... Conference on Mathematics, Mechanics, and Informatics, Hanoi, 7/10/2006, on the occasion of 50th Anniversary of Department of Mathematics, Mechanics and Informatics, Vietnam National University, Hanoi ... described as (13) and (14) Numerical simulation Considering a base excited building modeled as a vertical cantilever beam as showed in Fig Fig Model of a cantilever beam subjected to base acceleration ... located to obtain a significant contribution of the information of xc This means a large norm of Cc in comparison with the norm of Cr Because the subinterval Tk ended, the information known can...
  • 8
  • 416
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " A combination of hard and soft templating for the fabrication of silica hollow microcoils with nanostructured walls" pptx

Hóa học - Dầu khí

... Figure SEM images (a, b) CMC-COOH before silica coating, (c) microcoil after silica-coating and calcination The initial weight ratios for the silica coating process were CTAB/NH3(aq.)/CMC-COOH/TEOS ... preparation and characterization by TEM, SEM and SAXS NV participated in TEM observations and in spectroscopic measurements CS, AL-Q and TI participated in the preparation and revision of the manuscript ... prepared by using carbon microcoils and amphiphilic molecules as hard and soft templates, respectively, and both serve as porogens upon calcination Cationic aggregates adsorb on functionalized CMCs...
  • 7
  • 525
  • 0
Báo cáo hóa học:

Báo cáo hóa học: "Research Article The Problem of Scattering by a Mixture of Cracks and Obstacles" pptx

Hóa học - Dầu khí

... problem can be considered by similar methods in 1, 2, 4 12 and the reference therein Briefly speaking, in this paper we consider the scattering of an electromagnetic timeharmonic plane wave by an in nite ... in nite cylinder having an open crack Γ and a bounded domain D in R2 as cross section We assume that the cylinder is possibly partially coated on one side by a material with surface impedance λ ... time-harmonic electromagnetic plane waves from an in nite cylinder with a mixture of an open crack Γ and a bounded domain D in R2 as cross section For further considerations, we suppose that D has...
  • 19
  • 271
  • 0
Báo cáo toán học:

Báo cáo toán học: "Permutations generated by a stack of depth 2 and an infinite stack in series" potx

Báo cáo khoa học

... generated using a stack of depth two followed by an in nite stack We prove that the algorithm is valid, and that a permutation is accepted if and only if it can be generated by the stacks, if and ... that no permutation containing one can be generated It is routine to check by hand or computer that each of the permutations in B cannot be generated by a stack of depth two followed by an in nite ... on A and a on B, a contradiction the electronic journal of combinatorics 13 (2006), #R68 10 Case: 2.1 and 2.2 apply and b precedes a Suppose that b precedes a in the input Consider the instant...
  • 12
  • 241
  • 0
Báo cáo y học:

Báo cáo y học: "A combination of autoantibodies to cyclic citrullinated peptide (CCP) and HLA-DRB1 locus antigens is strongly associated with future onset of rheumatoid arthritis" potx

Báo cáo khoa học

... probability of being a case, given certain values on the analysed factors In this study, calculations are based on the combination of SE and the analysed autoantibodies This is because anti- CCP antibodies ... anti- CCP antibodies and SE gene carriage gave an OR of 66.8, while the presence of anti- CCP-antibodies alone gave an OR of 25.1 for the risk of developing RA compared with not having any of these factors ... or an RF of any isotype, in comparison with individuals not having any of the factors or having any one of them separately In particular, the combination of SE gene carriage and the presence of...
  • 6
  • 364
  • 0
Báo cáo y học:

Báo cáo y học: "Bonding of articular cartilage using a combination of biochemical degradation and surface cross-linking" pdf

Báo cáo khoa học

... or transplantation The objective of this study was to investigate the initiation of immediate bonding of articular cartilage blocks by means of combining cartilage degradation and cross-linking ... [10] Cartilage can be considered as a composite material consisting of a collagen network and other extracellular matrix components, mainly glycosaminoglycans (GAGs) Collagen and its derivatives ... other extracellular matrix components containing carboxyl groups, such as glycosaminoglycans, can also be cross-linked (c) Genipin reacts in a similar manner as glutaraldehyde, but can only bind to...
  • 11
  • 476
  • 0
Báo cáo y học:

Báo cáo y học: "The discovery of potential acetylcholinesterase inhibitors: A combination of pharmacophore modeling, virtual screening, and molecular docking studies" pptx

Báo cáo khoa học

... Lazar A, Kronman C, Barak D, Ariel N, Shafferman A, Silman I, Sussman JL: Structures of recombinant native and E202Q mutant human acetylcholinesterase complexed with the snake-venom toxin fasciculin-II ... Protein Sci 2008, 17:601-605 Silman I, Sussman JL: Acetylcholinesterase: ‘classical’ and ‘non-classical’ functions and pharmacology Curr Opin Pharmacol 2005, 5:293-302 Inestrosa NC, Alvarez A, ... by in vitro and in vivo biological tests Methods Data preparation Pharmacophore modeling correlates activities with the spatial arrangement of various chemical features in a set of active analogues...
  • 13
  • 389
  • 0
báo cáo khoa học:

báo cáo khoa học: "Carotid angiodysplasia complicated by the use of anti-hypertensive drugs during pregnancy: a case report" ppsx

Báo cáo khoa học

... Carotid angiodysplasia was diagnosed by angiography as the underlying disease Vascular malformation or angiodysplasia is characterized by endothelial hyperplasia and can be classified as hemangioma ... drafted the manuscript BBT participated in the design and coordination of the study MAR and RRMC were involved in drafting the manuscript and revising it critically for important intellectual content, ... review Arch Womens Ment Health 2011, 14(2):89-98 Mulliken JB, Glowacki J: Hemangiomas and vascular malformations in infants and children: a classification based on endothelial characteristics Plast...
  • 3
  • 330
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A Combination of Atrioventricular Block and Sinoatrial Block in a Horse" ppt

Báo cáo khoa học

... this can be accepted as the first published case of a concomitant AVB and SAB in the horse The horse was clinically normal and used for jumping so this type of conduction disturbance could be taken ... 174 A Rezakhani et al Figure Base -apex electrocardiogram recorded from a horse with concomitant second degree atrioventricular and sinoatrial block The underlying rhythm is a slight sinus arrhythmia ... could be taken as a functional block However, periodic checking of the cardiovascular system is recommended Combined atrioventricular and sinoatrial block in a horse References Gabrie F Lekeux...
  • 3
  • 230
  • 0
Báo cáo y học:

Báo cáo y học: "Dissection of a DNA-damage-induced transcriptional network using a combination of microarrays, RNA interference and computational promoter analysis" pot

Báo cáo khoa học

... 5'-GATCCCCGACTCCAGTGGTAATCTACTTCAAGAGAGTAGATTACCACTG GAGTCTTTTTGGAAA-'3 (previously described in Brummelkamp et al [24]) LacZ: 5'-GATCCCCAAGGCCAGACGCGAATTATTTCAAGAGAATAATTCGCGTCT GGCCTTTTTTTGGAAA-3' ... specifically designed to express siRNAs: ATM_I (7218) 5'-GATCCCCCTGGTTAGCAGAAACGTGCTTCAAGAGAGCA CGTTTCTGCTAACCAGTTTTTGGAAA-'3 ATM_II (p480): 5'-GATCCCCGATACCAGATCCTTGGAGATTCAAGAG ATCTCCAAGGATCTGGTATCTTTTTGGAAA-3', ... ATCTCCAAGGATCTGGTATCTTTTTGGAAA-3', a generous gift from R Agami (ATM level was knocked-down using a combination of two different siRNAs.) Rel _A: 5'-GATCCCCGAAGAGTCCTTTCAGCGGATTCAAGAGATCCGCTGAAAG GACTCTTCTTTTTGGAAA -3'...
  • 8
  • 248
  • 0
Báo cáo y học:

Báo cáo y học: "Spontaneous Hemoperitoneum Caused By a Diverticulum of the Sigmoid Colon"

Y học thưởng thức

... we decided to invaginate the diverticulum instead of using diverticulectomy We reported a case of colonic diverticulum that was successfully treated by laparoscopic suture and invagination of the ... vasa recta, which supply the mucosa and submucosa of the colon, penetrate the circular muscle The weakness of the vascular portals in the circular muscle possibly causes mucosal herniation into ... the colon consists of a monolayer of inner circular muscle, which makes its wall weak, as compared to the small intestine that is formed of the inner circular and outer longitudinal muscle layers...
  • 3
  • 531
  • 0
Treatment of Textile Wastewater by a Coupling of Activated Sludge Process with Membrane Separation

Treatment of Textile Wastewater by a Coupling of Activated Sludge Process with Membrane Separation

Môi trường

... capability of a coupling of activated sludge and microfiltration processes with backflushing technique to reduce the organic carbon and color in textile wastewater - 126 - Journal of Water and ... organic loading, food to microorganism ratio (F/M ratio), sludge wastage rate, and sludge settling characteristic in sedimentation tank An increase in biomass concentration will increase degradation ... disadvantage of secondary sedimentation tank is that its separation ability depends on the operating condition in aeration tanks Therefore, the performance enhancement of CASP by increasing MLSS can...
  • 8
  • 434
  • 0

Xem thêm