an illustration of the effect of climate change on the oceanwave climate a stochastic model
Báo cáo khoa học: "The effect of phase change on annual growth increment in eastern larch (Larix laricina (Du Roi) K. Koch)" pptx
... (from the graft union) and diameter (just above the graft union) measurements were taken at the end of each growing season In addition, the primary branches were counted on the main stem All grafts ... and how these changes affect the shape of the growth curve for a particular species Growth potential as a function of age is demonstrated here by grafting scions (of the same diameter and length) ... quadrant of the live crown, and then decapitated and trimmed to a length of 20 cm, so that all were about the same diameter Consequently, all shoots developed from lateral buds on primary branches,...
- 7
- 373
- 0
An analysis of nouns formed by suffixes in english a case study of the textbook solutions pre intermedite
... female humans and animals Eg: Lion (Noun): a large powerful animal of the cat family that hunts in group and lives in parts of Africa and southern Asia Lioness (Noun): a female lion 15 g/ The ... learners a large of vocabulary and grammar There are many reading texts and basing on these reading texts, learners have the chance to know about the culture, the people of many countries in the ... cause a tsunami – an enormous wave The volcano is by the sea If the volcano collapsed, 500 billion tones of rock would fall into the sea The wave would travel away from the Canary Island in all...
- 63
- 988
- 3
an analysis of order submissions on the xetra trading system
... behaviour of cancelations Cancelations on both sides of the market have a negative and significant impact on market orders and a positive impact on limit orders (significant in the case of sell cancelations) ... Stock Exchange (LSE), the Swiss Stock Exchange, Euronext, the Tokyo Stock Exchange (TSE) and at most of German regional exchanges SAP is traded at the NYSE and at the Swiss Stock Exchange Deutsche ... follow each other We also analyse the inter-dependence of market and limit orders and present an exhaustive analysis of the role that cancellations play in the trading process The empirical analysis...
- 29
- 338
- 0
The study: An analysis of common errors on verb tenses and word choices in VietnameseEnglish translation by the secondyear English majors at Dong Thap University
... communication In short, there are four typical types of translation: literal translation, idiomatic translation, translation grammatical features, and translation lexical features However, one of them, ... Translation is the transmission of a thought expressed in one language by means of another language The language used to express the thought directly is called the source language, and the language ... an idiomatic translation reproduces the meaning of the source language in the natural form of the receptor language 1.3.2 Translating grammatical features Each language has its own division of...
- 81
- 1,791
- 1
Tài liệu The Effects of Equipment Age on Spare Part Costs - A Study of M1 Tanks pptx
... average age and the exchange price valuation of total spare part demands Figures 4.1 (M 1A1 ) and 4.2 (M 1A2 ) visually confirm that there is not a strong relationship between the average age of tanks ... Studies of an Age-Cost Relationship Cost Data Are Lacking in Key Areas A critical factor hampering studies of an age-cost relationship is the lack of detailed maintenance-related data for all relevant ... studies have typically focused on the spare parts portion of Operation and Maintenance (O&M) accounts, because good maintenance labor hour data are lacking The lack of labor data, as well as the failure...
- 86
- 578
- 0
Tài liệu The impact of timely information on organisational performance in a supply chain
... International Journal of Mobile Communications, International Journal of Electronic Healthcare and International Journal of Human Resources Management R Anthony Inman is Ruston Building and Loan Professor ... Production Management, Production and Inventory Management Journal, International Journal of Service Industry Management, Production Planning and Control and International Journal of Quality and ... with an estimate of 0.18 and t-value of 2.14 indicating significance at the 0.05 level The relationship between JIT-I and organisational performance is significant at the 0.01 level with a standardised...
- 10
- 621
- 0
Báo cáo lâm nghiệp:" The key-role of topsoil moisture on CO2 efflux from a Mediterranean Quercus ilex forest" docx
... Several data are available on the respiration of Mediterranean ecosystems Most of them were measured in the Mediterranean Basin [4, 5, 10, 15, 26, 32, 37, 38] Some other data dealing with Australian ... Australian ecosystems under Mediterranean climate are also available [12, 29] They all highlight the effect of the summer drought on soil respiration and some of them also show the negative effect of ... of literature considers soil temperature and water content as two of the most important parameters controlling the variations of soil respiration [14, 24, 34, 41] The strong seasonal variations...
- 8
- 371
- 0
Báo cáo y học: "Effect of a small molecule inhibitor of nuclear factor-κB nuclear translocation in a murine model of arthritis and cultured human synovial cells" pps
... 3'-TAAAACAGGGTGTCTGGGGA), IL-1β (5'-TGCACGATGCACCTGTACGA, 3'-AGGCCCAAGGCCACAGGTAT), IL-6 (5'-GTTCCTGCAGAAAAAGGCAAAG, 3'-CTGAGGTGCCCATGCTACATTT), matrix metalloproteinase (MMP)-3 (5'ATGGAGCTGCAAGGGGTGAG, 3'-CCCGTCACCTCCAATCCAAG), ... ELISA Values are expressed as the mean ± standard deviation of three independent experiments supershift assays, anti-p50 antibody virtually abrogated the band of NF-κB, and anti-p65 antibody also ... in activation of RA FLS in an autocrine or paracrine manner [23] Other investigators have shown that an antagonist to CCL2 suppressed arthritis in a murine model [27] MMP-3 is among the cartilage-degrading...
- 12
- 459
- 0
Báo cáo y học: " The impact of mental illness on potentially preventable hospitalisations: a population-based cohort stu" ppt
... federal and Western Australian Departments of Health, and Medicare Australia, for providing the datasets for analysis We also thank the Data Linkage Branch at the Western Australian Department of ... participated in the conception and design of the overall study, and formulation of analysis plan QM researched data and wrote the manuscript CDJH and FMS reviewed and edited the manuscript and contributed ... Relative Socio-Economic Disadvantage (IRSD) [23] and the Accessibility/ Remoteness Index of Australia (ARIA) [24] based on place of residence at the Australian Census date Social disadvantage scores...
- 11
- 409
- 0
Báo cáo y học: "Effect of bladder volume on measured intravesical pressure: a prospective cohort study" ppt
... estimate IAP by IBP may cause clinically relevant overestimation of IAP and hence a false increase in the prevalence and incidence of IAH and ACS Bladder compliance varies within and between patients ... enlargement of one of the intra-abdominal contents, abdominal compliance can be reduced In that situation, it is possible that instillation of a large amount of fluid in the bladder leads to an iatrogenic ... Pearson correlation coefficient and Bland and Altman analysis was used to compare IBP at zero and 50 ml of priming volume Results Patients We studied 13 intubated and mechanically ventilated patients...
- 6
- 336
- 0
Báo cáo y học: " A stochastic model of oncogene expression and the relevance of this model to cancer therapy" ppt
... N particular cell population The mathematical relations that we have formulated can quantitatively determine how ablation of an oncogene's protein activity can result in apoptosis and/or a decrease ... inhibition? The initial survival may vary depending upon other therapies applied such as radiation and/or chemotherapy Table (1) yields theoretical calculations of survival fractions as a function of ... survival, the cell's differentiation status and the cell's transformation status Each of these quantities can be defined within the context of an entropy function and combined to serve as an index...
- 7
- 297
- 0
Studying the physics of design flow incorporating early information using a simulation model
... design activities Predicting change propagation and proper quantification of the change impact on redesign and on the design duration is important to manage the design process Handling coupled activities ... managers must understand how changes can influence the behavior of the project system and react accordingly to these changes (Love et al., 2002) A major concern is to trace the propagation of ... 127 Table 5.6 An illustrative transition matrix 131 Table 5.7 Change propagation in activities ‘c’ and ‘d’ 131 Table 5.8 Impact of change propagation for different degrees of change...
- 290
- 265
- 0
Gene expression changes in the brainstem in a mouse model of orofacial pain
... sensory ganglion of cranial nerves VII, IX and X OROFACIAL PAIN The diagnosis and treatment of facial pain remains a great challenge for oral and maxillofacial surgeons The pain syndromes are classified ... cooperation and help My sincere thank to Jayapal Manikandan, Department of Physiology National University of Singapore, for his valuable time in analysing the microarray data I also thank Mrs ... trigeminal nerve distribution area – ophthalmic, maxillary and mandibular regions, while the mice were still under anaesthesia The injection of carrageenan produced a constant swelling and caused allodynia...
- 104
- 289
- 0
Land of sweeping change powering australian business towards a connected future
... telecommunications companies are creating partnerships to provide a package of solutions to customers – from hardware and software to network access and integration For instance, Jasper, an American-based ... http://gilgaifarms.com.au/ 10 Land of Sweeping Change: Powering Australian business towards a connected future Land of Sweeping Change: Powering Australian business towards a connected future 11 A lack of ... view them as a software and app development provider whereas one-quarter (24%) see them as a business and management consulting service Land of Sweeping Change: Powering Australian business towards...
- 10
- 155
- 0
An experimental investigation of clocking effects on turbine aerodynamics using a modern
... heat-flux scaling, three-dimensional effects and performance calculations Because of limitations of the experimental apparatus, instrumentation, and data acquisition channels, the first phase of the ... Organization of Dissertation For a work of this size, complexity, and various audiences, one could envision a variety of ways to present the data and to organize the dissertation A decision has ... mechanical and thermodynamic measurements had the same sinusoidal shape with approximately a 0.8% variation in efficiency over the range of clocking positions at the midspan location (although there...
- 345
- 417
- 0
Báo cáo sinh học: " Induction of Th1Immune responses following laser ablation in a murine model of colorectal liver metastase" potx
... ELISPOT assays, data collection and data analysis and wrote the manuscript CM-W contributed to tissue collection, performed statistical data analysis and edited the manuscript MN participated in the ... control animals; b liver parenchyma, c tumor host interface and d an enlarged section of c as shown in the rectangle Panel e depicts a section of liver parenchyma from an LA treated animal immediately ... seen at the tumor host interface of ablated and distant tumors, at the ablation injury front and within vascular lakes of ablated and distant tumors These increases persisted at high levels compared...
- 10
- 556
- 0
báo cáo hóa học:" Induction of Th1Immune responses following laser ablation in a murine model of colorectal liver metastases" pot
... ELISPOT assays, data collection and data analysis and wrote the manuscript CM-W contributed to tissue collection, performed statistical data analysis and edited the manuscript MN participated in the ... control animals; b liver parenchyma, c tumor host interface and d an enlarged section of c as shown in the rectangle Panel e depicts a section of liver parenchyma from an LA treated animal immediately ... seen at the tumor host interface of ablated and distant tumors, at the ablation injury front and within vascular lakes of ablated and distant tumors These increases persisted at high levels compared...
- 10
- 500
- 0
Báo cáo khoa học: "Functional recovery and neural differentiation after transplantation of allogenic adipose-derived stem cells in a canine model of acute spinal cord injury" potx
... tissues and adhesions in the dura mater Most dogs had mild vacuolar formations Cavitation of the gray matter was seen within cranial and caudal lesions of the SCI site Vacuolar formations and cavitation ... tissues and adhesions in the dura mater Most dogs had mild vacuolar formations Cavitation of the gray matter was seen within cranial and caudal lesions of the SCI site The areas positively stained ... (Ha Na Pharm, Korea) at mg/kg Anesthesia was maintained by 2% isoflurane (Ilisung, Korea) in oxygen The minimum alveolar concentration was about 1.5 A multiparameter anesthetic monitor (Datex-Ohmeda,...
- 12
- 309
- 0
Báo cáo khoa học: "Effects of sylvicultural practices on nutrient status in a Pinus radiata plantation: Nutrient export by tree removal and nutrient dynamics in decomposing logging residues" ppt
... Barraqueta and Basagoiti [4] for another Pinus radiata plantation in a less limited site in Northern Spain The P content of the total biomass was slightly lower than the amount contained in the ... Chile The amounts of nutrients contained in the organic horizon were considerably lower than those reported by Barraqueta and Basagoiti [4] for another Pinus radiata plantation located on a more ... extractable K, Ca and Mg in the mineral soil were also substantially higher than those in the total biomass The annual uptake (table III) of nutrients by the stand was estimated as the sum of the...
- 12
- 266
- 0
Báo cáo y học: "Natural evolution of desmoplastic fibroblastoma on magnetic resonance imaging: a case report" ppt
... surgery and revised the manuscript MM performed the histopathological analysis and helped draft the manuscript HM, TM, KM, HY and TY helped draft the manuscript All authors have read and approved the ... enhancement after contrast administration, and nonenhanced areas corresponding to regions showing low SI on noncontrast T1-weighted images The size of the tumor increased over the course of one ... features and is often locally aggressive On the other hand, Marco et al [10] reported that desmoplastic fibroblastoma is a myofibroblastic lesion ultrastructurally demonstrating the presence of fibronexus...
- 4
- 376
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25