america he worked with deaf mutes at boston university soon bell started experimenting with ways of transmitting speech over a long distance this led to the invention of telephone
Anh 8 - Unit 6
... Scouts Association crossing the Atlantic Question 3: What are the Scouting groups that girls can join? The Girl Guides Association and the Camp Fire Boys and Girls Question 4: What are the three aims ... later an American businessman, William Boyce, got lost in London A boy helped him and explained that he was a scout This meeting led to the Scout Association crossing the Atlantic in 1910 Although ... to the Scouts Association crossing the Atlantic in 1910? An American businessman, William Boyce got lost in London A boy helped him and explained that he was a scout This meeting led to the Scouts...
- 55
- 1,615
- 0
Báo cáo y học: " Decreased respiratory system compliance on the sixth day of mechanical ventilation is a predictor of death in patients with established acute lung injury" ppt
... the data ES created the figures and wrote the manuscript HJ and ME helped with the statistical analysis RK and MAM oversaw the research, helped analyzed the data and edit the manuscript All authors ... independently associated with death, multivariate analyses were performed on variables that were associated with death in the exploratory bivariate analyses or of a priori interest These variables included: ... are presented as mean with standard deviation in parentheses Data presented in graphs are mean with error bars indicating the standard error of the mean (SEM) The odds ratios for death are calculated...
- 8
- 351
- 0
Báo cáo khoa học: "The conformation change of Bcl-2 is involved in arsenic trioxide-induced apoptosis and inhibition of proliferation in SGC7901 human gastric cancer cells" doc
... solution was added to each well, the cells were incubated for another hours, and the absorbance at 450 nm was measured by using a microplate reader (BioTek Instruments) The amount of the formazan dye, ... have recently come under increasing scrutiny Arsenic trioxide may be a promising candidate for the treatment of other malignancies The combination therapy of arsenic trioxide and other chemotherapeutic ... had an upward trend and reached a peak at 12 hours and the difference as compared with hour was statistically significant (P < 0.05) By time, the activated Bax also presented an upward trend and...
- 9
- 301
- 0
Tài liệu Báo cáo Y học: Importance of the amino-acid composition of the shutter region of plasminogen activator inhibitor-1 for its transitions to latent and substrate forms pdf
... contribute to maintaining the RCL in a state with a relatively facilitated passage through the gate region during latency transition, via an effect on the conformation of b strand 5A and of the buried ... anilide substrate for uPA The amount of active PAI-1, and thus the specific inhibitory activity, was calculated from the total amount of PAI-1 that had to be present to inhibit half of the uPA ... shutter region affect the rate of latency transition by affecting the rate of passage of the RCL through the gate region Based on the aminoacid sequence of the RCL and b strand 5A being directly...
- 10
- 431
- 0
Báo cáo Y học: The a1b1 contact of human hemoglobin plays a key role in stabilizing the bound dioxygen Further evidence from the iron valency hybrids potx
... between the a and b chains, resulting in the monophasic autoxidation rate over the basic pH range To the acidic autoxidation, essentially the same explanation is valid At acidic pH, the displacing ... include a movement of the iron atom into the heme plane with a simultaneous change in the orientation of the proximal (F8) histidine, a rotation of the a1 b1 dimer relative to the other a2 b2 dimer about ... ´ against the acidic autoxidation must have been produced by the formation of the a1 b1 or a2 b2 contact To see more quantitatively the effect of the a1 b1 or a2 b2 contact on the autoxidation reaction,...
- 10
- 648
- 0
Báo cáo y học: "Proteinase-3 as the major autoantigen of c-ANCA is strongly expressed in lung tissue of patients with Wegener’s granulomatosis" pptx
... 5′-ATCGTGGGCGGGCACGAGGCG (at the beginning of exon 2, corresponding to bases +82 to +101 of the cDNA); and PR-3 ‘antisense’, 5′-GCGGCCAGGGAACGAAAGTGCA (at the end of exon 4, corresponding to bases ... RW, Masi AT, McShane DJ, Mills JA, Stevens MB, Wallace SL, Zvaifler NJ: The American College of Rheumatology 1990 criteria for the classification of Wegener´s granulomatosis Arthritis Rheum 1990, ... 23 24 25 26 Van der Woude FJ, Van Es LA, Daha MR: The role of the cANCA antigen in the pathogenesis of Wegener’s granulomatosis A hypothesis based on both humoral and cellular mechanisms Neth...
- 7
- 370
- 0
Báo cáo y học: "Immunomodulatory properties of mesenchymal stem cells: a review based on an interdisciplinary meeting held at the Kennedy Institute" potx
... inside the inflamed parenchyma The responses were more pronounced when MSC treatment was initiated early in the course of the disease Reversal with IL-2 treatment indicates that anergy rather than ... scarring tissue damage is often present On the other hand, MSCs may also actively participate in initiating AD [3], they have the potential to favour spread of melanoma metastases [4] and, although mostly ... stimulate T cells MSCs also inhibit the IL-1 and CD40 ligand induced maturation of immature into mature DCs Aggarwal and Pittenger [28] also demonstrated that MSCs cause immature DCs to decrease...
- 10
- 559
- 0
Báo cáo y học: "Preclinical characterization of DEKAVIL (F8-IL10), a novel clinical-stage immunocytokine which inhibits the progression of collagen-induced arthritis" ppsx
... (saline) All animals were killed with carbon dioxide at the end of the observation period and subjected to necropsy Statistical analysis Data are expressed as the mean ± standard error of the ... this article provide a strong rationale for the clinical investigation of F8-IL10 as a novel biopharmaceutical for the therapy of patients with rheumatoid arthritis who have failed at least two ... relevant findings were observed in the blood biochemical parameters at the end of week and at the end of the treatment period in any groups Pharmacokinetic data were obtained during the toxicology...
- 15
- 266
- 0
Báo cáo y học: "Variations in branching of the posterior cord of brachial plexus in a Kenyan population" ppsx
... 13.3% Page of population differences in anatomy of the brachial plexus This variant anatomy is important in explaining the outcome of attempted subscapular block in hemiplegic patients with painful ... emerge as separate branches from the posterior cord (PC) In this specimen, the PC further gave rise to the medial cutaneous nerve of the arm (Mcna) and medial cutaneous nerve of the forearm (Mcnfa) ... wide range of variation suggests Table Population variance of the incidence of axillary origin of the subscapular nerves AUTHOR POPULATION LowerUppersubscapular subscapular from Axillary from Axillary...
- 5
- 243
- 0
Báo cáo y học: "Sustained remission of rheumatoid arthritis with a specific serotonin reuptake inhibitor antidepressant: a case report and review of the literature" ppsx
... compounds lead to excitotoxicity and calciummediated cell death Taken together, some data support the hypothesis that IDO pathway modulation plays a role in the pathophysiology of cytokine-induced depression ... methotrexate after three years Since the episode of angina, the patient was started on a daily regimen of low-dose aspirin at 75 mg and simvastatin at 40 mg He continued to take various non-steroidal ... modulate inflammatory pain Descending spinal serotonergic pathways from the medulla have long been implicated in the physiology of pain modulation Zhao et al [14] showed that knockout mice that lacked...
- 5
- 318
- 0
Báo cáo y học: "The role of Qa-2, the functional homolog of HLA-G, in a Behcet''''s disease-like mouse model induced by the herpes virus simplex" pptx
... participated in the design of the study and discussion of data analysis SS conceived of the study, participated in its design and coordination, and helped draft the manuscript All authors read ... AGGTCTTAT GGTGCTGTCAC-3', Anti sense: 5'- TGT Page of 12 GTAATTCTGCTCCTTCC -3'; β-actin, Sense: 5'-TG GAATCCTGTGGCATCCATGAAAC -3', Antisense: 5'TAAAACGCAGCTCAGTAACAGTCCG-3'; IFNγ, Sense: 5'-AGCGGCTGACTGAACTCAGATTGTAG ... for natural killer cell inhibitory receptors? Proc Natl Acad Sci USA 1997, 94:5249 49 Kaneko F, Takahashi Y, Muramatsu R, Adachi K, Miura Y, Nakane A, Minagawa T: Natural killer cell numbers and...
- 12
- 287
- 0
Báo cáo y học: " Exploring the black box of quality improvement collaboratives: modelling relations between conditions, applied changes and outcomes" ppsx
... targets into measurable indicators, and teams had to deliver monitoring data to a central database In this study, these monitoring data were used to model the actual success of the teams An agreement ... were capable and willing to deliver enough monitoring data to calculate a before and after measurement (actual outcome) (n = 103) Indicator data were available of 94% of the operating theatre ... agreement was made with the organisation funding the programme (as well as the independent evaluation, of which the current study is a part) that the data collection burden for participating hospital...
- 12
- 231
- 0
Báo cáo y học: " Intricacies in the surgical management of appendiceal mucinous cystadenoma: a case report and review of the literature" ppt
... calcification and non-specific acute and chronic inflammation A detailed histopathology report of the appendix along with the attached mesoappendix showed a 1.5 cm perforation in the lumen of the appendix ... appendicular mass which was most likely a previously perforated appendix along the lateral abdominal wall The lateral abdominal wall peritoneum was excised with the appendix to prevent any spillage of ... collected the data, helped in its interpretation and drafted the manuscript RA helped in identification and interpretation of pathology along with drafting the manuscript MRK conceived the study, helped...
- 4
- 427
- 0
Báo cáo y học: " Ethnic differences in the adaptation rate of HIV gp120 from a vaccine trial" ppsx
... statistical analyses DVJ, FS, and PWB carried out the molecular genetic studies and immunoassays All authors participated in the design of the study and helped to draft the manuscript All authors read ... estimates remained significant after the Benjamini and Hochberg's adjustment (Table 2) The higher dN/dS ratios observed for blacks suggest that the rate of virus evolution is greater in this ... breakpoints with GARD [15], and then estimating the dN/dS ratios independently for each fragment Mean dN/dS ratios across races and treatments were compared using ANOVA, linear models (lm) and pairwise...
- 3
- 235
- 0
Báo cáo y học: " Trans-inhibition of HIV-1 by a long hairpin RNA expressed within the viral genome" pps
... not replicate to detectable levels The escape variant AS44, with the intermediate length hairpin, replicated only marginally All other AS variants replicated efficiently (results are summarized ... 1B), although these variants reached maximal CAp24 values at least log lower than that of wild-type HIV1 This phenotypic difference can be explained by the Nefminus genotype of these viral strains ... Additional File Graphic quantification of the relative viral abundance in SupT1 and PBMC The density of the PCR products from Figures and were calculated with the ImageJ software Click here for file...
- 14
- 348
- 0
Báo cáo y học: "Electrical muscle stimulation preserves the muscle mass of critically ill patients: a randomized study" ppsx
... work and have read and approved the final manuscript In particular VG participated in the design of the study, data acquisition, analysis and drafting of the manuscript KS, KV and LK participated ... The position of the probe was selected at the midway between the anterior superior iliac spine and the midpoint of the patella and was placed ventral to the transverse plane and perpendicular ... in data acquisition, analysis and drafting of the manuscript PP, AK and AC revised critically the manuscript CR helped with data analysis, revised critically the manuscript and gave approval for...
- 8
- 316
- 0
Báo cáo y học: " The electronic version of this article is the complete one and can be found onlin" pot
... what the big important problems are? Mink: Exactly And what new tools or methods are needed to solve them So here’s a simple idea: At every big meeting of the American Chemical Society and the ... introduction to some important area of biology and end with a list of some of the major outstanding problems in that area and what sort of things would help get them solved That way, people from other ... each other Clifford: Now I’m the one who’s not understanding Mink: What I mean is that Greg is always complaining that chemists can’t understand one another because the physical chemists speak...
- 2
- 190
- 0
Báo cáo y học: "Effect of corticosteroids on the clinical course of community-acquired pneumonia: a randomized controlled trial" pot
... Respira) We are grateful to the patients and their relatives for agreeing to participate in this trial We would like to thank Dr Masuet and Dr Ramon (USAR) for their help with the statistical analysis ... Comparative evolution of C-reactive protein ratio over the days of treatment and between the two study groups The CPR ratio was calculated by dividing every day value by the CPR value at Day Mean ... all of them belonging to the placebo group The duration of MV was 13 days (IQR to 26 days) for the placebo group and days for the only case in the MPDN group The differences not reach statistical...
- 9
- 384
- 0
Báo cáo y học: "The electronic version of this article is the complete one and can be found online" potx
... signaling, it has been proposed that the stimulatory mechanism is based on the ability of glypicans to facilitate and/or stabilize the interaction of Wnts with their signaling receptors, the Frizzled ... the carboxy-terminal end of the CRD domain, and generates two subunits that remain attached to each other by one or more disulfide bonds [7] Whether the convertase-induced cleavage of glypicans ... structural feature shared by all glypicans is the insertion sites for the heparan sulfate (HS) chains, which are located close to the carboxyl terminus This places the HS chains close to the cell...
- 6
- 390
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25