add a function to a formula by using insert function
A simulation by using cohesive zone model for indentation test in thin film substrate systems
... Mulhearn’s mechanism to a cavity in an elastic-plastic material being expanded by internal pressure He found that the elastic modulus of material played a critical role in this deformation mechanism ... Therefore, the shape of the traction-separation law may also have a significantly effects on the crack initiation and propagation processes Recent numerical simulations by Chandra et al [34] also discovered ... FEM software ABAQUS has two analysis procedures, one of which is ABAQUS/Explicit and the other is ABAQUS/Standard ABAQUS/Explicit is based on explicit FEM method, and ABAQUS/Standard is based on...
- 98
- 376
- 0
Teaching vocabulary to primary children by using story telling method = Dạy từ vựng cho học sinh tiểu học thông qua phương pháp kể chuyện
... Hoang primary school, having an average age of 10 I had a chance to teach classes: 5A1 , 5A2 , 5A3 ; therefore, I have learned about their learning situation and also had the overviews and comparison ... and be able to say something about this character - Plan what the group/s has to each day up to the final day - Allow starting and finishing time to take out and put away all the materials the children ... you are going to work on the project: once a week Make sure that everyone is clear about what they have to and what they have to achieve: draw and colour a picture of a story character and be able...
- 67
- 1,177
- 12
Báo cáo khoa học: "A Method for Relating Multiple Newspaper Articles by Using Graphs, and Its Application to Webcasting" pptx
... Summarization by Graph Search and Matching Proe of AAAI'97, pages 622-628 Y M a a r e k and A Wecker 1994 The Librarian Assistant: Automatically Assemblin Books into Dy- 1313 namic Bookshelves Proc of RIAO ... et al proposed the scatter/gather approach for facilitating information retrieval (Hearst et al., 1995) Maarek et al related documents by using an hierarchical clustering algorithm that interacts ... is defined on the basis of Salton's Vector Space Model (Salton, 1968) Words are extracted from an article by using a morphological analyzer Next, nouns and verbs are extracted as keywords _ di...
- 7
- 419
- 0
Báo cáo y học: "Assisted assembly: how to improve a de novo genome assembly by using related species" pptx
... garnetti (bushbaby) Loxodonta africana (African elephant) Oryctolagus cuniculus (rabbit) Cavia porcellus (guinea pig) Initial Assisted* Initial Assisted* Initial Assisted* Initial Assisted* Bases ... MW, Vaidya AB, Martin DM, et al.: Genome sequence of the human malaria parasite Plasmodium falciparum Nature 2002, 419:498-511 Nagarajan N, Read TD, Pop M: Scaffolding and validation of bac- Genome ... Consortium, Waterston RH, LindbladToh K, Birney E, Rogers J, Abril JF, Agarwal P, Agarwala R, Ainscough R, Alexandersson M, An P, Antonarakis SE, Attwood J, Baertsch R, Bailey J, Barlow K, Beck...
- 9
- 338
- 0
Báo cáo y học: "A call to arms to reduce premature deaths by using inexpensive resuscitation care" potx
... (2004-2009), the Laerdal Foundation for Acute Medicine (Stavanger, Norway) for a randomized trial of a CPR training aid (2007), and the Canadian Institutes of Health Research (Ottawa, ON, Canada) and Medtronic ... CA, USA) in 2007 References 10 11 Competing interests SAW is a member of the American Heart Association (AHA) (Dallas, TX, USA) National Registry for Cardiopulmonary Resuscitation Adult Research ... (San Diego, CA, USA) and Radiant Medical Inc (Redwood City, CA, USA) for single trips in 2006 He consulted for Northfield Laboratories Inc (Evanston, IL, USA) and Paracor Medical Inc (Sunnyvale,...
- 2
- 137
- 0
How to create a Raid Device using Madadm
... distributed in all If one hard disk fails, data on that can be regenerated by the data and parity information in the other two hard disks ###RAID### Raid :need disks Raid :need disks Raid :need disks ... thus increasing the read performance But can be utilize only 50% of the total size Level 5: It is a combination of striping and parity Need at least three hard disks Both parity and data are distributed ... of partitions of sda5,sda6,sda7 This is how we can create a Raid device with level ***RAID 1*** #mdadm create /dev/md0 level=1 raid-devices=2 /dev/sda{5,6} This is how we can create a Raid...
- 3
- 953
- 0
A New Technique Using Headspace Gas Monitoring to Determine Carbon Source Addition in a BNR Process
... the basis of tests using the same batch of sludge sample Acetate and VFAs concentrations were verified using a Hewlett-Packard® 588 0A gas chromatograph, equipped with a flame ionization detector ... in comparable BNR enhancement, as the sodium acetate addition cases A higher P/VFAs molar ratio, observed in TAD addition case, suggested there were other potential carbon substrate available for ... profile of TAD supernatant and NaAc addition Observed CO2 evolution rates were similar in both cases, and the TAD supernatant VFA estimations are shown in Table Estimations showed a substantial overestimation,...
- 6
- 405
- 0
4 Creating a Configuration and Physical Standby Database by Using Enterprise Manager
... Creating a Configuration Click Add Standby Database” to start the wizard 4-6 Copyright © 2006, Oracle All rights reserved Using the Add Standby Database Wizard 4-8 Copyright © 2006, Oracle All rights ... primary database: SQL> ALTER DATABASE FORCE LOGGING; 4-3 Copyright © 2006, Oracle All rights reserved Using Enterprise Manager to Create a Broker Configuration • Use the Add Standby Database ... Wizard to: – Create a broker configuration – Add a database to a broker configuration • Primary database must be started with an SPFILE 4-5 Copyright © 2006, Oracle All rights reserved Creating...
- 24
- 397
- 0
Tài liệu Creating a Logical Standby Database by Using Enterprise Manager ppt
... V$DATABASE • Database guard level is set to ALL by broker automatically on the logical standby database • Database guard level applies to all users except SYS 7-5 Copyright © 2006, Oracle All ... Database with Enterprise Manager Click Add Standby Database.” - 17 Copyright © 2006, Oracle All rights reserved Using the Add Standby Database Wizard Select “Create a new logical standby database.” ... users from making changes to any data in the database – STANDBY: prevents users from making changes to any data maintained by Data Guard SQL Apply – NONE: normal security • Query GUARD_STATUS column...
- 29
- 496
- 0
How to write an effective biz plan a step by step guide
... nghệ châu (AITCV), Hà nội hợp tác với SEAQIP Vietnam tổ chức www.planware.org, Viết kế hoạch kinh doanh, 2001 Practical Business Planning for newventure Kế hoạch kinh doanh tài liệu tham khảo DIRECTION ... nên chuyển sang đơn vị đô-la Mỹ a tỷ giá hối đoái sử dụng Cung cấp thông tin đồng tiền nội đ a Practical Business Planning for newventure 23 tài liệu tham khảo Kế hoạch kinh doanh a Công ty phải ... vay bao gồm thuê tài Thuế - Thuế bất động sản, thu nhập thuế khác Chi phí khác - dịch vụ thuê ngoài, s a ch a, bảo trì, vận chuyển, lại, dự trữ Thanh to n vốn vay - Thanh to n gốc cho khoản vay...
- 96
- 614
- 0
Tài liệu Executing a SQL Server Stored Procedure By Using ActiveX Data Objects doc
... cmd.CreateParameter("CustomerID", ADODB.DataTypeEnum.adChar, ADODB.ParameterDirectionEnum.adParamInput, 5) cmd.Parameters.Append(prm) prm.Value = "CHOPS" OpenNorthwindADOConnection(cnn) cmd.ActiveConnection ... rstCurr.GetString Catch excp As Exception MessageBox.Show(excp.Message) End Try End Sub The last thing that this routine does is open a recordset based on the Command object This is to the use just ... records that are needed In this case, the GetString method is used to assign it to the results text box If you are using a bulk query, shown in the next section, you would use the Execute method To...
- 2
- 450
- 0
A study on using visual aids to teach grammar to the 10th form students at nghi loc III high school
... of visual aids to teach grammar Effect of using visual aids to teach grammar Difficulties in using visual aids to teach grammar Interview and observation are also carried out to add and confirm ... height and are as long as if necessary for the text Easy to make, easy to store, the cards can be used to demonstrate exactly what the teacher wishes and can be flashed again to consolidate learning ... teaching However simple and easy to prepare visual aids are, they contribute a great deal of help to language classroom Language is a means of communication so teaching a language should be as...
- 87
- 1,273
- 9
Learning PHP, MySQL, and javascript a step by step guide to creating dynamic websites
... One -to- Many Many -to- Many Databases and Anonymity Transactions Transaction Storage Engines Using BEGIN Using COMMIT Using ROLLBACK Using EXPLAIN Backing Up and Restoring Using mysqldump Creating a Backup ... JavaScript Errors Using Comments Semicolons Variables String Variables Numeric Variables Arrays Operators Arithmetic Operators Assignment Operators Comparison Operators Logical Operators Variable ... to create the database and table and to set up all the correct fields, but the INSERT command here shows how simple it can be to add new data to a database The INSERT command is an | Chapter...
- 528
- 1,436
- 1
A study on increasing students’ participation in communicative activities in large classes by using group work and questioning technique at marie curie high school, hai phong
... then Situational Language Teaching represented the major British Approach to teaching English as a foreign language In Situational Language Teaching, language was taught by practising basic structures ... theoretical assumption underlying Situational Language teaching (Richards and Rodgers 1991:64) As the scope of Communicative Language Teaching has expanded, it was considered as an approach rather than ... to play a more active and participatory part than in traditional approaches And therefore, the roles of teacher will be re-defined with the change of activity organization because each leaner...
- 42
- 616
- 2
Tài liệu ALLOCATION TO REPRODUCTION IN A HAWKMOTH: A QUANTITATIVE ANALYSIS USING STABLE CARBON ISOTOPES docx
... subtropical rangeland offers predominantly C plants for grazing cattle, milk casein was enriched in 13 C relative to C3 plants Amino acids were added to the C3 and C4 sugar diets to a final concentration ... conversion factor was calculated from the amino acid composition of A floridensis eggs, measured as mole percentage (Beckman 6300 Amino Acid Analyzer, Fullerton, California, USA) and converted to mass ... Euphydryas editha Ecological Entomology 12:401–408 Motulsky, H J., and L A Ransnas 1987 Fitting curves to data using nonlinear regression: a practical and nonmathematical review Federation of American...
- 10
- 434
- 0
Tài liệu Báo cáo khoa học: Stimulation of poly(A) synthesis by Escherichia coli poly(A)polymerase I is correlated with Hfq binding to poly(A) tails ppt
... 5¢-GCTTCAGTACTTAGAGAC 5¢-TAATACGACTCACTATAGGGAGACGTAGCACGTTACACC 5¢-GAAAAAAGGGGCCACTCAGG 5¢-T(18)GAAAAAAGGGGCCACTCAGG 5¢GCGTCGCTAATTCTTGCGAGA18TTTCAGAAAAGGGCTG 5¢-C(18)GAAAAAAGGGGCCACTCAGG 5¢-G(18)GAAAAAAGGGGCCACTCAGG ... Forward Reverse Reverse Reverse Forward Reverse 5¢-TAATTAACCCTCACTAAAGGGGTGCTCGGCATAAG 5¢-GCCATGAATATCTCCAACGAG 5¢-CATCCAAAATACGCCATGAATATC 5¢-TAATACGACTCACTATAGGGGCCGCTTAACGTCGCG 5¢-GCTTCAGTACTTAGAGAC ... 5¢-G(18)GAAAAAAGGGGCCACTCAGG 5¢-GAATTGCTGCCGTCAGCTTGA 5¢-TAATTAACCCTCACTAAAGGGAAACGGAGCGGCACCTCTT 5¢-GCGGATCCTGGACCGCAAAAG ompA* ompA105 ompA117 5¢rpsO 5¢rpsO 3¢rpsO 3¢rpsO 3¢rpsO-(T)18 rpsO internal 3¢rpsO-(C)18...
- 10
- 488
- 0
Tài liệu Báo cáo khoa học: "A Bootstrapping Approach to Named Entity Classification Using Successive Learners" pdf
... unlimited raw corpus compensates for the modest recall As a result, large quantities of NE instances are automatically acquired An automatically annotated NE corpus can then be constructed by extracting ... rules are applied to a large raw corpus to automatically generate a tagged corpus Finally, an HMM-based NE tagger is trained using this corpus There is no iterative learning between the two learners, ... fourDigitNum, containsDigitAndAlpha, containsDigitAndDash, containsDigitAndSlash, containsDigitAndComma, containsDigitAndPeriod, otherNum, allCaps, capPeriod, initCap, lowerCase, other Benchmarking and Discussion...
- 8
- 489
- 0
Tài liệu A Practical Guide to Swing Trading by Larry Swing pdf
... fundamental company characteristics Scan criteria are saved in a scan library so they can be used over and over again A scan scenarios (also called a template) can be used to evaluate patterns ... day trading With recent changes in SEC regulations that affect the way brokerage firms administer margin to 'Day Trading' accounts, many day traders have moved away from day trading towards a ... any trading and investment strategy SwingTracker has dozens of technical indicators available for real-time and long-term analysis Available Technical Indicators With price volatility at an all-time...
- 74
- 557
- 0
Báo cáo " A study on urban development through land surface temperature by using remote sensing: in case of Ho Chi Minh City " potx
... Urban areas are already remarkable concentrations of climate vulnerability and projected rates of urban development mean that vulnerability will increase at the same time as the impacts of climate ... The study area Fig The study area 2.2 Data sets Landsat TM and Aster images were used as the main data source in this research Two Landsat TM images have seven bands, included six reflective bands ... the average temperature of land cover It is apparent that where the human is present, the heat is released and increased The highest temperatures are always in industrial zones and urban areas...
- 8
- 499
- 1
smog a report to the people By Lester Lees docx
... reduced to 25 days per year (an additional reduction of 50% and an overall reduction of 90%).23 The Clean Air Act appears to give the Administrator of the EPA discretionary authority to approve an alternative ... stationary sources; also authority for the State to make such data available to the public as reported and as correlated with any applicable emission standards or limitations 18 The plan must also ... enforcement and maintenance of national ambient air quality standards promulgated by the Administrator of the EPA (Table 2) These air quality standards must be attained within three years of the date...
- 174
- 403
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25