activity theory as a pedagogical framework for the delivery of technology education
Tài liệu Carrots, Sticks, and Promises: A Conceptual Framework for the Management of Public Health and Social Issue Behaviors docx
... Influencing the Selection of Education, Marketing, and Law There are many other variables that can influence managers in their selection of education, marketing, and/or law as classes of strategic ... predicted and tolerable level of externalities for tobacco use have changed dramatically in the past years, and as a result, policy with respect to managing tobacco usage behavior also has changed The ... singular choice of edu cation, marketing, or force of law as a paradigm of choice Each paradigm has a role to play in behavior management; behavior management must be considered from the pragmatic...
- 14
- 780
- 0
Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx
... hyperphosphorylation occurs because of an imbalance in the activity of tau kinases and phosphatases [3] One particular tau kinase pertinent to metal dyshomeostasis in AD is glycogen synthase kinase-3 ... down-regulated by decreased availability of intracellular Cu [83] and up-regulated by increased availability of Cu [84] Collectively, these data present a strong case for the native role of APP ⁄ Ab ... Modulation of metal availability for treating AD P J Crouch et al research attention as potential therapeutic targets Plaques and NFTs, however, cannot be regarded as ‘upstream’ causative factors...
- 9
- 634
- 0
Báo cáo khoa học: Distribution of the extrinsic proteins as a potential marker for the evolution of photosynthetic oxygen-evolving photosystem II ppt
... Chloroplast DNA Cyanidium caldarium Chloroplast DNA Bacillariophyceae (diatoms) Thalassiosira pseudonana Nuclear DNA Chloroplast DNA Odontella sinensis Chloroplast DNA Prasinophyceae Mesostigma viride ... Chloroplast DNA Euglenophyceae Euglena gracilis Chloroplast DNA Chlorophyceae (green algae) Chlamydomonas reinhardtii Nuclear DNA Chloroplast DNA Higher plant Oryza sativa Nuclear DNA Chloroplast DNA ... text for details), although it was not detected by the immunological assays Psb P Cyanobacteria Glaucophyceae Red algae Diatoms Haptophyceae Brown algae Prasinophyceae Euglenophyceae Green algae...
- 11
- 501
- 0
Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc
... type diabetes subjects Immunogenetics 2010, 62:101-107 36 Kawasaki E, Awata T, Ikegami H, Kobayashi T, Maruyama T, Nakanishi K, Shimada A, Uga M, Kurihara S, Kawabata Y, et al: Genetic association ... responsible for a differential glycosylation pattern [24] As such, the presence of a proline rather than a serine at position of the mature IL-2 protein, is associated with an increased glycosylation and ... in the IL-2 signaling cascades is the Jak3 kinase Jak3 -/- mice display symptoms of autoimmunity and accumulation of auto-reactive T cells in the lymphoid organs [48] It has been shown that the...
- 12
- 573
- 0
Báo cáo y học: "The self-organizing fractal theory as a universal discovery method: the phenomenon of life" pptx
... them As an example, anaerobic bacteria and methanogenic archae form compact microbial granules that operate like an organ rather than a group Page 29 of 66 Kurakin Theoretical Biology and Medical ... of cellular constituents Second, in the same way as the pKa of an isolated amino acid and the pKa of the same amino acid embedded within protein matrix may differ dramatically, the redox behavior ... large-scale relaxation and restructuring Note that the adaptability of the whole is built upon and depends upon the adaptability of its individual parts and that the adaptations of a part or the...
- 66
- 320
- 0
A unifield framework for the design of service systems
... with the Same Capacity Productivity Approach for Resource Allocation with the Same Capacity Comparison of Two Approaches in the Same Capacity System Parameters and Strategic Approaches New Allocation ... quadrant to operate similar to factories that can take advantage of economy of scale The lower right quadrant is for a standardized service and high customer participation, this quadrant is labeled ... contact theory (Chase, 1981; Chase and Tansik, 1983) emphasizes the physical presence of the customer in service operations The customer contact approach is regarded as the most influential approach...
- 56
- 393
- 0
Tài liệu "Promoting healthy diets and physical activity: a European dimension for the prevention of overweight, obesity and chronic diseases" doc
... a common forum for action the European Platform for Action on Diet, Physical Activity and Health was launched in March 2005 The Platform brings together all relevant players active at European ... diseases” I STATE OF PLAY AT EUROPEAN LEVEL I.1 Unhealthy diets and lack of physical activity are the leading causes of avoidable illness and premature death in Europe, and the rising prevalence ... attractiveness, availability, accessibility and affordability of fruits and vegetables? – On which areas related to nutrition, physical activity, the development of tools for the analysis of related disorders,...
- 22
- 703
- 0
Tài liệu Towards a framework for the study of the neural correlates of aesthetic preference pdf
... Kawabata and Zeki (2004) found activity associated mostly with beautiful images, was most active after a reward and decreased its activity after punishment, whereas the activity in the lateral ... et al., 2006) Another major difference among the three studies is the task that participants were asked to perform Kawabata and Zeki (2004) asked their participants to rate the beauty of the ... encompasses the region identified by Vartanian and Goel (2004), and has been related with the assessment of the relevance of motivational and emotional information and the regulation of emotional...
- 19
- 526
- 0
Báo cáo khoa học: "QARLA:A Framework for the Evaluation of Text Summarization Systems" pdf
... framework, QARLA, that addresses such issues Given a set of manual summaries and another set of baseline summaries per task, together with a set of similarity metrics, QARLA provides quantitative measures ... similarity metrics to compare summaries An evaluation framework should include, at least: • A measure QM,X (a) ∈ [0, 1] that estimates the quality of an automatic summary a, using the similarity ... estimation of the probabilities in KING, QUEEN assumes that the sample sets M, A are not biased If M, A are biased, the results can be statistically significant and yet unreliable The set of examples...
- 10
- 517
- 0
Báo cáo khoa học: "PEAS, the first instantiation of a comparative framework for evaluating parsers of French" potx
... each relation the address of its parameters Of course, all of them are not to be filled in All the information thus annotated is then translated into an XML format Annotation of the example of ... question answering application, where a parser is often needed to parse both the questions and the huge set of candidate answers, the use of XML makes easier the selection of the paser for the task at ... correct the divergent parses.' Last of all, the XML format into which we translate the parses is an open exchange format It is an important asset for portability and reuse of parsing technolgy E.g for...
- 4
- 323
- 0
báo cáo hóa học: " A decision support framework for the discrimination of children with controlled epilepsy based on EEG analysis" pdf
... that data is measured at least at the interval level (assumption (ii)) Homogeneity of variances was tested using Levene's test based on the F-statistic [26] and in this case it was found that the ... the Beta band over the frontal lobe For the Gamma bands, WT also obtained relatively stable scores over the parietal and occipital brain areas, but as shown in the topographic maps earlier, the ... select Theta-Alpha band activity on central and temporal channels (TL, TR, CL and CR) for further analysis of our results from univariate analysis In Table we analyze the spectral biomarkers of the...
- 14
- 454
- 0
Báo cáo hóa học: " Research Article A Framework for the Assessment of Temporal Artifacts in Medium Frame-Rate Binary Video Halftones" pot
... temporal artifacts in the halftone videos Therefore, perceptual quantitative measures for evaluating these artifacts are desirable Quantitative assessment of temporal artifacts can facilitate comparison ... dirty-window-effect For the perceptual evaluation of each artifact, a particular instantiation of the generalized framework, was presented and the associated results were EURASIP Journal on Image and Video ... This instantiation of the flicker assessment framework is depicted in Figure In Figure 9, K, Q, and R each have a value of L, and S have each a value of P has a value of −1 The “Artifact Map” is...
- 11
- 519
- 0
báo cáo khoa học: " Synthetic lethality: a framework for the development of wiser cancer therapeutics" docx
... human salivary gland cancer cells Oral Oncol 2006, 42:593598 44 Hayashi M, Sakata M, Takeda T, Tahara M, Yamamoto T, Okamoto Y, Minekawa R, Isobe A, Ohmichi M, Tasaka K, Murata Y: Up-regulation ... of the most frequently mutated human oncogenes Cancer-relevant KRAS mutations lead to loss of K-Ras GTPase activity, leading to constitutive signaling So far K-Ras has not proven tractable as a ... fitness assays They found that KRAS mutant cells are hypersensitive to loss of the polo-like kinase PLK1, components of the anaphasepromoting complex/cyclosome, and the proteasome Note that all of these...
- 6
- 485
- 0
Báo cáo y học: "GMODWeb: a web framework for the generic model organism database" pptx
... perl-Apache-ParseFormData A Perl library for accessing form data in mod_perl perl-Class-Base A Perl base class for other modules perl-Class-DBI A Perl tool for abstracting database access perl-Class-DBI-ConceptSearch ... include the automatic generation of several web application layers that are manually created in most other frameworks Turnkey uses a database schema, or definition, to automatically create most of an ... websites for other schemata This makes the integration of other datasets extremely easy since websites for each database can be auto-generated using Turnkey In contrast, in systems such as FlyMine and...
- 11
- 366
- 0
Tài liệu Đề tài " A shape theorem for the spread of an infection " pdf
... present case we can take πB = A , which has the great advantage that the path of ρ does not depend on the paths of the other particles This is the reason why the case DA = DB is special We proved ... Thus, the left-hand sides of (3.31) and (3.60) are the same for this choice of Λ We leave it to the reader to check that the right-hand side of (3.60) is at least as large as the right-hand side of ... {A| there are k B-particles at at time 0} k! 710 HARRY KESTEN AND VLADAS SIDORAVICIUS (The probability in the last sum is the same in P f as in the original process.) On the other hand, in the original...
- 67
- 490
- 0
Tài liệu OUTLINES OF DAIRY BACTERIOLOGY A CONCISE MANUAL FOR THE USE OF STUDENTS IN DAIRYING docx
... most available in the form of organic compounds, such as albuminous material Carbon in the form of carbohydrates, as sugar or starch, is most readily attacked by bacteria Inasmuch as the bacteria ... from another As far as these characters can be used, they are taken, but in addition, many characteristics of a physiological nature are added The way that the organism grows in different kinds of ... but they are diluted in proper proportions so as to render them available for bacterial as well as mammalian life Of the nitrogenous compounds, the albumen is in readily assimilable form The casein,...
- 201
- 540
- 0
Tài liệu Interest on Excess Reserves as a Monetary Policy Instrument: The Experience of Foreign Central Banks ppt
... case studies that form the basis for the findings The eight central banks covered are: the Reserve Bank of Australia, the Bank of Canada, the Bank of England, the European Central Bank, the Bank ... which has traded on average about basis points below the Bank Rate over this period, occasionally falling below the Bank Rate by as much as 35 basis points Bank of Canada The Bank of Canada (BoC) ... Monetary Affairs) and Spence Hilton (Federal Reserve Bank of New York), as well as from central bank colleagues at the Reserve Bank of Australia, the Bank of Canada, the Bank of England, the European...
- 49
- 653
- 0
Tài liệu Response statistics for ''''New Legislative Framework for the marketing of products: proposal to align 10 product harmonisation directives to Decision 768/2008.'''' pdf
... check that the manufacturer outside the EU has applied the correct conformity assessment procedure and establish a link to the manufacturer that allows him to obtain the technical documentation, ... • Additional manufacturer obligations: In addition to the obligations that the current legislation already foresees for manufacturers they must provide instructions and safety information in the ... surveillance): The safeguard clause procedure has been reorganised and streamlined The new procedure ensures that the relevant enforcement authorities are informed about dangerous products and that...
- 18
- 425
- 0
Tài liệu Báo cáo khoa học: Hypoxia reduces the expression of heme oxygenase-2 in various types of human cell lines A possible strategy for the maintenance of intracellular heme level pdf
... kit (Amersham Biosciences, Piscataway, NJ, USA) Expression of a- tubulin was examined as an internal control using a- tubulin monoclonal antibody (NeoMarkers, Fremont, CA, USA) Assay for HO catalytic ... incubated at 37 °C for 20 After centrifugation, the supernatant was used to measure the absorbance at 468 nm The amounts of bilirubin formed in the reaction system were calculated using a value of ... R, Takahashi K, Takeda K, Furuyama K, Kaneko K, Takahashi S, Tamai M & Shibahara S (2004) Expression of heme oxygenase-1 is repressed by interferon-gamma and induced by hypoxia in human retinal...
- 12
- 621
- 0
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc
... CP-pyk (5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG ... rate to CPK % Product formation changed significantly as the PK activity was modulated At increased PK activity we found an almost proportional increase in formate and acetate production and a ... ðÀ0:4Þ for the formate flux and Clas Jacetate Clas % ðÀ0:4Þ for the acetate flux 2295 Control analysis of the las operon B Koebmann et al Fig Construction of a strain with the pyk gene deleted from the...
- 12
- 616
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25