0

abuse of dominance in licensing and refusal to license a apos more economic approach apos to competition by imitation and the competition by substitution

A study on the aspects of syntax and semantics of negation in english and the contrastive analysis in vietnamese

A study on the aspects of syntax and semantics of negation in english and the contrastive analysis in vietnamese

Khoa học xã hội

... of grammatical meaning and lexical meaning Grammatical meaning unites all grammatical characteristics of a word and lexical meaning is a realization of a concept or notion Lexical meaning includes ... Syntactic and semantic features of negation of the text of President Barack Obamas inaugural address After having a careful analysis on syntactic and semantic features of negation in English and ... foreign language According to Carl James,1980:10 Contrastive analysis : CA is a form of inter-language study and a central concern of applied linguistics As a matter of fact, CA has had much to offer...
  • 51
  • 1,082
  • 8
Tài liệu Investigating the Role of Poultry in Livelihoods and the Impact of Avian Flu on Livelihoods Outcomes in Africa docx

Tài liệu Investigating the Role of Poultry in Livelihoods and the Impact of Avian Flu on Livelihoods Outcomes in Africa docx

Nông nghiệp

... decrease by almost a quarter in Ghana, by almost a third in Kenya, and by half in Ethiopia This scenario also affects livestock income, reducing it by almost a third in Kenya and by almost half in ... countries in SSA The study countries include Ethiopia and Kenya in East Africa and Ghana and Nigeria in West Africa The HPAI virus has been circulating in SSA since February 2006, when the first case ... implemented by the Kenya National Bureau of Statistics and the Human Resources Social Services Department of the then Ministry of Finance and Planning Finally, for Ethiopia we used the data from the...
  • 40
  • 759
  • 0
Báo cáo khoa học: Mechanisms of accumulation of arachidonate in phosphatidylinositol in yellowtail A comparative study of acylation systems of phospholipids in rat and the fish species Seriola quinqueradiata pot

Báo cáo khoa học: Mechanisms of accumulation of arachidonate in phosphatidylinositol in yellowtail A comparative study of acylation systems of phospholipids in rat and the fish species Seriola quinqueradiata pot

Báo cáo khoa học

... from the liver of yellowtail, and found that the one-sided accumulation of arachidonic acid into PtdIns is attained in the presence of large amounts of docosahexaenoic acid and that several acyltransferase ... systems of the yellowtail enable PtdIns to accumulate arachidonate in the presence of large amounts of docosahexaenoic acid and a limited supply of arachidonic acid As PtdIns plays an important role ... clarify the involvement of the PtdIns cycle in the accumulation of arachidonic acid in PtdIns of fish Fig Effects of docosahexaenoic acid (DHA) on the incorporation of [14C]arachidonic acid (*AA)...
  • 8
  • 619
  • 0
Protection against South American leaf blight of rubber in Asia and the Pacific region pptx

Protection against South American leaf blight of rubber in Asia and the Pacific region pptx

Lâm nghiệp

... Thailand, Indonesia, Viet Nam, Sri Lanka, Malaysia, southern part of India, tropical part of China, part of Lao PDR, Myanmar, Bangladesh, Brunei, Cambodia, the Philippines and Papua New Guinea ... guidelines to further assist countries efforts to safeguard against the incursion of SALB into the PRA area The purpose of this PRA is to: i examine and evaluate the risks of SALB being associated ... spread to Trinidad and Central American and to Bahia and Sao Paulo areas of Brazil was presumably through infected material when attempts were made to grow rubber in these regions The spread of...
  • 112
  • 559
  • 0
Báo cáo y học:

Báo cáo y học: " Recent developments of acupuncture in Australia and the way forward" pot

Báo cáo khoa học

... developments of acupuncture in Australia indicate that through adequate and appropriate evaluation, acupuncture is being integrated into mainstream health care in Australia Competing interests The authors ... CX, AZ, AY, SZ and DS interpreted the data and revised the manuscript All authors read and approved the final version of the manuscript Acknowledgements The authors thank the researchers at the ... Goods Administration and the Australian New Zealand Clinical Trial Registry Following the introduction of the Consolidated Standards of Reporting Trials (CONSORT Statement) in 1996 [28] and its...
  • 4
  • 419
  • 0
Cooperative Security and the Balance of Power in ASEAN and the ARF

Cooperative Security and the Balance of Power in ASEAN and the ARF

Tổng hợp

... Authoritarianism in Southeast Asia Comparing Indonesia and Malaysia Edited by Ariel Heryanto and Sumit K Mandal Cooperative Security and the Balance of Power in ASEAN and the ARF Ralf Emmers Cooperative ... Sumatra and Kalimantan in 1997 The haze, that reached 26 Cooperative security: ASEAN and the ARF Malaysia, Singapore and Brunei and parts of Thailand and the Philippines, marked a significant failure ... dispositions in the South China Sea The methodological approach adopted in this monograph aims to combine a theoretical and factual understanding of ASEAN and the ARF The methodology is based on a historical...
  • 214
  • 869
  • 0
Cambridge.University.Press.Allegories.of.Union.in.Irish.and.English.Writing.1790-1870.Politics.History.and.the.Family.from.Edgeworth.to.Arnold.Oct.2000.pdf

Cambridge.University.Press.Allegories.of.Union.in.Irish.and.English.Writing.1790-1870.Politics.History.and.the.Family.from.Edgeworth.to.Arnold.Oct.2000.pdf

TOEFL - IELTS - TOEIC

... Ireland by the operation of the penal laws, the patriarchal family has a crucial role in both Burke’s anti-Jacobin arguments and his prescriptions for ‘‘attaching’’ catholic Ireland to England ... discipline in sexual and familial relations, conceived as central to the maintenance of order For part of what Burke fears in the Jacobin revolt is the unfixing of the proper bounds of feminine and ... among the most important of scholarly tasks at hand today; acknowledging that Ireland and the Irish were assigned a crucial place in the ideological work of English nation-formation in the past...
  • 240
  • 1,195
  • 5
The effects of bottom up techniques in teaching listening skills to first year students at the university of fire fighting and prevention

The effects of bottom up techniques in teaching listening skills to first year students at the university of fire fighting and prevention

Khoa học xã hội

... Initial recognition of meaning of short Material held in STM and Related to materials already held in STM Related materials arriving in STM Meaning extracted from message and retained in LTM ... usually apply the skills, the same uses in listening in their mother tongue, predict what they will hear and try to match them with the things they actually hear Therefore, in teaching listening, the ... speaking, writing and reading can arise from listening, especially from post-listening work The order and organization of a language lesson are usually not decided at the same time integrating these...
  • 46
  • 1,172
  • 4
Slide an investigation into some approaches to vocabulary teaching and learning and the application of games in teaching and learning vocabulary at pre – intermediate level at foreign language center – haiphong university

Slide an investigation into some approaches to vocabulary teaching and learning and the application of games in teaching and learning vocabulary at pre – intermediate level at foreign language center – haiphong university

Khoa học xã hội

... Approaches to language teaching and their relevance to vocabulary 1.4 Recent research about teaching and learning second language vocabulary 1.5 Advantages of the use games in vocabulary teaching ... teaching and their relevance to vocabulary 1.4 Recent research about teaching and learning second language vocabulary 1.5 Advantages of the use of games in vocabulary teaching and learning Part two: ... teaching and learning 1.2.1 A neglect aspect of foreign language methodology 1.2.2 Ineffective vocabulary learning 1.2.3 The status of vocabulary in current language teaching and learning 1.3 Approaches...
  • 29
  • 1,354
  • 2
Báo cáo khoa học: Functional studies of crustacean hyperglycemic hormones (CHHs) of the blue crab, Callinectes sapidus – the expression and release of CHH in eyestalk and pericardial organ in response to environmental stress pot

Báo cáo khoa học: Functional studies of crustacean hyperglycemic hormones (CHHs) of the blue crab, Callinectes sapidus – the expression and release of CHH in eyestalk and pericardial organ in response to environmental stress pot

Báo cáo khoa học

... GGCCATCATACAGGTGACTAGGAGGGT GGGTGATTTGACACACGGTTTTGATGGA ATGGGATATGTTCTCAGT ACAGATTTACGACTCCTCCTG CATGTTGCTGTAGCAGTTTGAT ATATAAGCTTATCCTCTGATAGC GACCCATCATCGAGGACTA ACCACAAGGGTTTCAAGCAG CCACACCAGGAAGGTCTTGT ... GGTGGAGGAAACCTTGGACT ACGTCAACATGTCCGACAAA CGGTGGAGACAACAAGGACT TGCGTTTCGTTTGACTTCAC GGCTGATGGCTTCTCAAAAC Hemolymph titers of PO-CHH and ES-CHH in response to changes in dissolved oxygen Hypoxia induced ... cRNA standards of quantitative RT-PCR, including PO-CHH and ES-CHH, AK and eIF 4A, were initially PCR amplified using a combination of LF and LR primers (Table 1) Further cRNA synthesis and RNA...
  • 12
  • 474
  • 0
A Report to Carnegie Corporation of New York WRITINGNEXT EFFECTIVE STRATEGIES TO IMPROVE WRITING OF ADOLESCENTS IN MIDDLE AND HIGH SCHOOLS potx

A Report to Carnegie Corporation of New York WRITINGNEXT EFFECTIVE STRATEGIES TO IMPROVE WRITING OF ADOLESCENTS IN MIDDLE AND HIGH SCHOOLS potx

Kỹ năng viết tiếng Anh

... cannot read with understanding, think about and analyze what they’ve read, and then write clearly and effectively about what they’ve learned and what they think, then they may never be able to ... today are not meeting even basic writing standards, and their teachers are often at a loss for how to help them In an age overwhelmed by information (we are told, for example, that all available ... Farnan, N (2005, April) An investigation of the influence of teaching grammar in writing to accomplish an influence on writing Paper presented at the annual meeting of the American Educational...
  • 77
  • 565
  • 0
báo cáo hóa học:

báo cáo hóa học:" The European DISABKIDS project: development of seven condition-specific modules to measure health related quality of life in children and adolescents" potx

Hóa học - Dầu khí

... participated in all the research phases and advised RMB and CA during the statistical analysis of the condition-specific modules and revised the manuscript All authors read and approved the final manuscript ... An item was added to a domain if it correlated with a domain, it loaded only on one domain, and it generally made sense to include the item in the domain [29] The reliability of the domain, including ... 'Impact' Over half of the extra items that were included on the basis of clinical relevance after the pilot study analysis were integrated in the final domains Example: the asthma field study analysis...
  • 9
  • 354
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Research Article New Method to Determine the Range of DVB-H Networks and the Influence of MPE-FEC Rate and Modulation Scheme" doc

Hóa học - Dầu khí

... 64-QAM, corresponding with an increase of the range of 1425 m, 176 m, and 1253 m, respectively The lower increase of the range for 16-QAM may be caused by the fact that all range calculations are ... 2.4) 2.3 Parameters Used to Analyze Performance This paragraph defines the parameters used to analyze the range of the DVB-H system First, MpegLock and MpegDataLock are explained Next, parameters ... The ranges are calculated as the distance from a location noted as the “imaginary transmitter” ITx The location ((x, y, z)-coordinates) of this imaginary transmitter is chosen as a weighted average...
  • 10
  • 446
  • 0
báo cáo khoa học:

báo cáo khoa học: " The YlmG protein has a conserved function related to the distribution of nucleoids in chloroplasts and cyanobacteria" pdf

Báo cáo khoa học

... 5'-TCAAGTCTTCCAATTTCTACCCAGTGCTGC-3' for AtYLMG1-1, 5'CCTCAACATATATAACACCATC-3' and 5'-GACAGGTTCAGGTCATAGAAG-3' for At5g21920, 5'-TATCTGAACACTCCGTTGACGGTA-3' and 5'-CAAAGATA AACGGAATACGATC-3' for At4g27990, 5'-GCAATGGGAAGCAGTGGTGG-3' ... identify the inserted 35S-cDNA in the FOX lines, the insertion was amplified by PCR using primers 5'GTACGTATTTTTACAACAATTACCAACAAC-3' and 5'-GGATTCAATCTTAAGAAACTTTATTGCCAA-3', and then sequenced by a ... resistance to kanamycin, was amplified by primers 5'-ATGTCTAGAAGCTATGACCATGATTACGAA-3' and 5'-ATGTC TAGAAAGTCAGCGTAATGCTCTGCC-3' (the XbaI site is underlined), digested with XbaI, and inserted into...
  • 13
  • 453
  • 0
Báo cáo y học:

Báo cáo y học: "Canakinumab relieves symptoms of acute flares and improves health-related quality of life in patients with difficult-to-treat Gouty Arthritis by suppressing inflammation: results of a randomized, dose-ranging study" ppt

Báo cáo khoa học

... designed by AS, NS, PS, DR, VM and UA, and data were gathered and analyzed by Novartis All authors vouch for the accuracy of the data and the analysis, and contributed to the interpretation of the data ... anti-canakinumab antibodies at baseline and at eight weeks post-dose using a validated Biacore® binding assay (Biacore International AB, Uppsala, Sweden) [25] Pain intensity scores (according to the ... impact of anti-inflammatory therapy on quality of life in patients with acute Gouty Arthritis and demonstrates the significant value of potent anti-inflammatory therapy We also report that canakinumab...
  • 13
  • 419
  • 0
Báo cáo thú y:

Báo cáo thú y: "The distribution of four trace elements (Fe, Mn, Cu, Zn) in forage and the relation to scrapie in Iceland" pptx

Báo cáo khoa học

... from the beginning of the year 2000 to the end of January 2009 an atypical form of the disease (Nor98) was found on one farm in Area II and on two farms in Area VI The diagnosis of scrapie in the ... Area VII than in Areas I, III and V It was also significantly higher in Areas II and VI than in Area V Table 3: The means of Fe, Mn, Cu and Zn analyses in forage from farms in Categories and ... units for classification into scrapie categories and are, therefore, the basic random units and repeated samples on a farm are subsampling Regional variations or trends within Areas are in the model...
  • 10
  • 202
  • 0
Báo cáo y học:

Báo cáo y học: " Enhanced macrophage tropism of HIV in brain and lymphoid tissues is associated with sensitivity to the broadly neutralizing CD4 binding site antibody b12" ppsx

Báo cáo khoa học

... [9,10,14] to further examine the association between neutralization sensitivity to reagents targeting the CD4 binding site and macrophage tropism The capacity of HIV to enter macrophages correlated with ... into macrophages is associated with sensitivity to neutralizing mAb b12 and a broadly neutralizing HIVEnhanced Enhanced HIV entry into macrophages is associated with sensitivity to neutralizing ... suggesting that other Env determinants influence exposure of the b12 epitope DuenasDecamp et al showed that an arginine at position 373 in the C3 region, proximal to the CD4 binding site, increased...
  • 7
  • 379
  • 0
Báo cáo y học:

Báo cáo y học: " Effect of chloroquine on reducing HIV-1 replication in vitro and the DC-SIGN mediated transfer of virus to CD4+ T-lymphocytes" pdf

Báo cáo khoa học

... in the absence of CQ CA-p24 or ng/ml was used as input for monitoring replication A) day 37 of passage, B) day 77 of passage, C) day 103 of passage, D) day 147 of passage, E) day 183 of passage ... loss of these amino acids may also explain the reduction in the DC-SIGN mediated transfer of the CQ passaged virus Variation in the V1V2 and V3 regions have also been shown to be involved with altered ... strain to be analyzed and using the assay described below The CA-p24 levels in the culture supernatants were determined using a standard ELISA protocol Virus stocks were generated either in the...
  • 12
  • 316
  • 0
Báo cáo y học:

Báo cáo y học: "Bench-to-bedside review: Avoiding pitfalls in critical care meta-analysis — funnel plots, risk estimates, types of heterogeneity, baseline risk and the ecologic fallacy" ppsx

Báo cáo khoa học

... interactions of these factors means a greater proportion of the unexplained variation can be accounted for – increasing the power of the meta-analysis Other advantages of individual patient data meta-analyses ... gives the appearance of random variation (or the variation might be misassigned to another factor, such as trial quality), whereas in reality it is an important finding The traditional approach has ... using individual patient data Individual patient data meta-analysis Analysing data at an individual patient level is the most powerful meta-analytic technique available Statistical significance...
  • 8
  • 222
  • 0

Xem thêm