a tree sequence alignmentbased

... Forest-to-String Statistical Translation Rules. ACL-07. 704-711. Daniel Marcu, W. Wang, A. Echihabi and K. Knight. 2006. SPMT: Statistical Machine Translation with Syntactified Target Language Phrases. ... decoding algorithm. It translates each span ite- ratively from small one to large one (lines 1-2). This strategy can guarantee that when translating the current span, all spans smaller than the ... current one have already been translated before if they are translatable (line 7). When translating a span, if the usable rule is an initial rule, then the tree sequence on the target side of...

Ngày tải lên: 17/03/2014, 02:20

... statistical machine translation with syn- tactified target language phrases. EMNLP-06. 44-52. Franz J. Och and Hermann Ney. 2004. The alignment template approach to statistical machine translation. ... Zhang, Hongfei Jiang, AiTi Aw, Haizhou Li, Chew Lim Tan and Sheng Li. 200 8a. A tree sequence alignment-based tree- to -tree translation model. ACL- 08. 559-567. Min Zhang, Hongfei Jiang, Haizhou ... ACL-07. 704-711. Daniel Marcu and William Wong. 2002. A phrase- based, joint probability model for statistical machine translation. EMNLP-02, 133-139 Daniel Marcu, W. Wang, A. Echihabi and...

Ngày tải lên: 17/03/2014, 01:20

... participants additional ideas about the uses of XPath. To understand XPath, participants will need good verbal and visual examples, so be ready to diagram XPath examples if required to clarify ... XPath expressions from a list box control. iv Module 6: Using XPath to Navigate a Tree of Nodes Materials and Preparation This section provides the materials and preparation tasks that ... What Is XPath? 2 Lesson: Using XPath 11 Lesson: The Range of Application of XPath 21 Lab 6: Using XPath to Navigate and Select Data 27 Review 37 Module 6: Using XPath to Navigate a Tree...

Ngày tải lên: 10/12/2013, 16:15

... of the signal sequence. Tetracycline-resistant prlA + and prlA4 Table 1. Bacterial strains and plasmids used in this study. Cam r and Amp r indicate resistance to chloramphenicol and ampicillin, ... the Imagequant software (Molecular Dynamics) after scanning of the autoradiogram. In vitro transcription, translation, targeting and cross-linking analysis To generate truncated mRNA, plasmids ... proposed that prlA mutations cause a general relaxation of the export apparatus [21,24] rather than a specific change that results in bypassing a proofreading mechanism of the Sec machinery [25]. The...

Ngày tải lên: 08/03/2014, 09:20

... is a terminating rule, then a tree with a single node labeled by A( w 1 , w 2 )isa derivation tree for A( w 1 , w 2 ). S(aa a aa a, #¯aa a aaa) D(aa a aa a, ¯aa a aaa) F(aa a a, a aaa) A( a, a) ... E (a a a, a aa) D (a a, ¯aa) F (a a, ¯aa) A( a, a) E( a, a) D(ε, ε) A  ( a, a) D(ε, ε) A  ( a, a) D (a a, ¯aa) F (a a, ¯aa) A( a, a) E( a, a) D(ε, ε) A  ( a, a) D(ε, ε) C(ε, #) Figure 1: An ... derivation tree for w is a derivation tree for some S(w 1 , w 2 ) such that w 1 w 2 = w. Example 1 (continued). Figure 1 shows a derivation tree for aa a ¯aa a# ¯aa a aaa. The follo wing lemma should...

Ngày tải lên: 16/03/2014, 19:20

... Computational Linguistics A Tree Transducer Model for Synchronous Tree- Adjoining Grammars Andreas Maletti Universitat Rovira i Virgili Avinguda de Catalunya 25, 43002 Tarragona, Spain. andreas.maletti@urv.cat Abstract A ... we assume that all adjunctions are mandatory; i.e., if an aux- iliary tree can be adjoined, then we need to make an adjunction. Thus, a derivation starting from an initial tree to a derived tree ... auxiliary tree by a special marker. Traditionally, the root label A of an auxiliary tree is replaced by A ∅ once adjoined. Since we assume that there are no auxiliary trees with such a root label,...

Ngày tải lên: 17/03/2014, 00:20

... able to take direct advantage of manually an- notated corpora like the Penn Treebank, which are not marked for derivations and thus assume a stan- dard CFG. Since different TSG derivations can produce ... found that the use of larger subtrees did correlate with accuracy; however, the low overall accuracy (and the fact that there are so many of these large sub- trees available in the grammar) suggests ... EMNLP. Thomas S. Ferguson. 1973. A Bayesian analysis of some nonparametric problems. Annals of Mathe- matical Statistics, 1(2):209–230. Sharon Goldwater, Thomas L. Griffiths, and Mark Johnson. 2009. A Bayesian...

Ngày tải lên: 17/03/2014, 02:20

... climbed a tree The boy climbed a tree. 3. Tại sao lại câu trên lại dịch như vậy? Các bạn thấy từ "boy" trong tiếng Anh là có ngh a là "cậu bé", nhưng khi đứng sau mạo ... người ta gọi là mạo từ xác định. Mạo từ thường đi trước danh từ và nếu mạo từ xác định (the) đi trước danh từ thì nó làm cho danh từ đó đã xác định (người nói và người nghe đã biết danh từ ... "climbed" là dạng quá khứ c a động từ climb (leo trèo). Hay có cách nói khác là động từ climb ở câu này được chia ở thời (thì) quá khứ đơn (simple past tense). Động từ được chia ở thì quá khứ đơn diễn...

Ngày tải lên: 20/03/2014, 00:20

... (5¢-GACGAGTACACGGT GGCCGGATACAACCTCAGGA-3¢) and R450ALo (5¢-TC CTGAGGTTGTATCCG GCCACCGTGT ACTCGTC-3¢); Y452AUp (5¢-ACACGGTGCGCGGAGCCAACCTCAAG ACGTC-3¢) and Y452ALo (5¢-GACGTCCTGAGGTTGG CTCCGGCCACCGTGT-3¢); RA+YAUp (5¢-ACACGGT GGCCGGAGCCAACCTCAGGACGTC-3¢) ... density map and are not included in the final model. Structural data are available in the Protein Data Bank database under the accession number 3NJT. Channel analysis The planar lipid bilayer recordings ... the same buffer as above. Equal amounts of sam- ples were separated by SDS ⁄ PAGE and analysed by western blot with an anti-FhaC serum. This antibody was raised in rats against the periplasmic...

Ngày tải lên: 23/03/2014, 03:20

Ngày tải lên: 23/03/2014, 16:21

Ngày tải lên: 29/03/2014, 00:20

Ngày tải lên: 30/03/2014, 21:20

Ngày tải lên: 31/03/2014, 18:20

Ngày tải lên: 21/06/2014, 20:20

Ngày tải lên: 22/06/2014, 20:20

Ngày tải lên: 25/10/2013, 18:20

... will disable a service until the attacker decides to: go away and SYN no more. This was an elegant attack, for a small number of packets an attacker could freeze a particular service on a host ... have a particular signature, in fact, you could even say it might be somewhat predictable! 21 IDIC - SANS GIAC LevelTwo ©2000, 2001 21 Diary of an Attack The IP spoofing attack started at about ... so that the sender appears to be an unreachable host? – We need a real routable to, unreachable host, such as a PC that gets turned off at night and so forth. – We need to assemble the packet...

Ngày tải lên: 26/10/2013, 23:15

Ngày tải lên: 26/11/2013, 13:16

... RM2 7 acgtgtcaccgcttcctc atgtccgggatctcatcg 2 RM5 1 tgcaacttctagctgctcga gcatccgatcttgatggg 3 RM16 3 cgctagggcagcatctaaaa aacacagcaggtacgcgc 4 RM50 6 actgtaccggtcgaagacg aaattccacgtcagcctcc ... gtgaatggtcaagtgacttaggtggc acacaacatgttccctccatgc 6 RM102 1 aactttccaccaccaccgcgg agcagcaagccagcaagcg 7 RM104 1 cttccaattcaggccggctggc cgccagctgaccatgcatgc 8 RM164 5 tcttgcccgtcactgcagatatcc ... RM206 11 cccatgcgtttaactattct cgttccatcgatccgtatgg 13 RM208 2 tctgcaagccttgtcgatg taagtcgatcattgtgtggacc 14 RM218 3 ttggtcaaaccaaggtccttc gacatacattctacccccgg 15 RM234 7 acaaggccgagaggattccg gctctccggtggctccgattgg...

Ngày tải lên: 28/11/2013, 11:09

... nam 12 Mà cha Javanica Viện Khoa học KTNN Việt nam 13 Tan do Javanica Viện Khoa học KTNN Việt nam 14 Chiêm Phú xuyên Javanica Viện Khoa học KTNN Việt nam 15 Khẩu nua tẩu Javanica ... khoa hc Nụng nghip 21 (2003) cho rằng, mức độ thể hiện u thế lai ở l a theo thứ tự Indica/ Japonica > Indica/ Javanica > Japonica/ Javanica > Indica/ Indica > Japonica/ Japonica. ... đặc điểm c a l a Japonica. Gây tạo l a lai Indica/ Javanica có thể đóng vai trò tơng tự trong việc cải tiến chất lợng hạt cũng nh tăng năng suất l a Indica. L a lai Indica/ Japonica có tiềm...

Ngày tải lên: 28/11/2013, 11:10