getting a sequence value from oracle

... Thumbnailing for Animation Thumbnails from a sequence of Disney’s Rescuers Preparing for Animation: The Art of Thumbnailing PDF produced by www.animationmeat.com 1 Preparing for Animation: The Art ... www.animationmeat.com 6 The Art of Thumbnailing Preparing for Animation: The Art of Thumbnailing PDF produced by www.animationmeat.com 7 The Art of Thumbnailing Preparing for Animation: The Art ... thumbnails. Preparing for Animation: The Art of Thumbnailing PDF produced by www.animationmeat.com 3 The Art of Thumbnailing Preparing for Animation: The Art of Thumbnailing PDF produced by www.animationmeat.com 4 The

Ngày tải lên: 08/03/2014, 11:20

... amino-acid sequence and MS analysis The full amino-acid sequence of the toxin was obtained by direct Edman degradation, using an automatic Beckman sequencer (LF 3000 Protein Sequencer) and samples ... dynamic annealing structure calculations were performed with the CNS software suite [44] Analysis of Na+-channel sequences By searching data banks containing sequences of Na+ channels from human, ... from rat; NaV1.7 from human; Para from fruit fly; NachB1 from squid) Conserved residues are indicated by asterisks, and conservative replacements by dots Acidic amino acids in the extracytoplasmic

Ngày tải lên: 23/03/2014, 12:20

... epidermal growth factor-like repeats from human tenascin studied through a sequence frame-shift approach ´ Francesco Zanuttin, Corrado Guarnaccia, Alessandro Pintar and Sandor Pongor International ... apparatus using a PrePak Cartridge 25 · 100 mm (Agilent) casted on a PrepLC Universal Base apparatus (Waters) and a Zorbax 300SB-C18 9.4 · 250 mm (Agilent) Samples were eluted using a linear gradient ... of experimental data with a three-parameter negative exponential curve (R > 0.99, data not shown) gave an apparent rate constant value of 0.54 min)1 for EGF-14, and values in the range 0.22–0.26

Ngày tải lên: 23/03/2014, 13:20

... explanatory variables and hypotheses Variables Table 1: Explanatory... visitor valued at P9,373.32, the annual aggregate monetary recreational value of Mt Pulag National Park is estimated ... ECO-TOURISM VALUE OF NATIONAL PARK: A CASE STUDY FROM THE PHILIPPINES Gladys M. Navarro 1 Eleanor D. Paca Carlo Rimas ABSTRACT National parks or generally protected areas (PAs) normally ... reveals the value that people place on recreational, tourism or leisure aspects of PAs. The study by Navrud and Mungatana (Navrud & Mungatana, 1994) shows that the Travel Cost (TC) and

Ngày tải lên: 25/03/2014, 20:23

... cultivar by analyzing publicly available EST data The availability of protein sequences derived from these genes allowed us to interpret MS/MS data obtained from an analysis of Butte 86 flour and associate ... sequences with an abundance of glutamine and proline residues The gliadins have molecular weights (MWs) from about 28,000 to 55,000 and are separated into alpha, gamma and omega subgroups, each ... “SuperWheat” database The “SuperWheat” database contained NCBI non-redundant green plant protein sequences, translated sequences (in all six reading frames) of contigs from TaGI Releases 10.0 and

Ngày tải lên: 12/08/2014, 03:21

... minimum and maximum gaps as well as time window GSP is an iterative algorithm, which counts candidate sequences of length k in the kth database scan GSP requires as many full data scans as the ... 1-patterns are maintained in the set F1 Figure 4a depicts a set of trajectories in a 2D space after passing through the trajectory generalization operation Assume that the maximal timestamp ... mining Behavioral sequence patterns · Location-based services · Trajectory Mathematics Subject Classification 68 Introduction The availability and increasingly high accuracy of Global Positioning

Ngày tải lên: 12/12/2017, 04:50

... Net8, and SQL*Plus are registered trademarks of Oracle Corporation. Oracle8 , Server Manager, Enterprise Manager, Oracle Parallel Server and PL/SQL are trademarks of Oracle Corporation. All other ... ways: ■ electronic mail - infodev@us .oracle. com ■ FAX - (650)506-7228 ■ postal service: Oracle Corporation Oracle Server Documentation Manager 500 Oracle Parkway Redwood Shores, CA 94065 USA ... configurations, Oracle8 and the Oracle8 Enterprise Edition. Oracle8 and the Oracle8 Enterprise Edition have the same basic features. However, several advanced features are available only with the

Ngày tải lên: 09/12/2013, 17:15

... (p26-1Bam-s) GCGCGGATCCACCATGGCACTTAACCCATG 546/182 (P26-182 Xho-as) CGCGCCTCGAGTTATGGAGTTGAACTAGCTGT p26-alpha 1–60 and (p26-60Bam-s) GCGCGGATCCACCATGTCCTTGAGGGACACA 297/93 153–192 (p26-153Xho-as) ... Functional analysis of a small heat shock /a- crystallin protein from Artemia franciscana Oligomerization and thermotolerance Julie A. Crack, Marc Mansour, Yu Sun and Thomas H. MacRae Department ... GCGCGGATCCACCATGTCCTTGAGGGACACA 396/132 (p26-192Xho-as) CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT p26-CD40 153–192 (p26-1Bam-s) GCGCGGATCCACCATGGCACTTAACCCATG 459/153 (p26-153Xho-as) CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT p26-CD10

Ngày tải lên: 22/02/2014, 04:20

... contributions The Social Marketing Collaborative consists of the following members: New York (Lead State): John Cahill, Tina Gerardi, Tamara Hubinsky, Sylvia Pirani, Amanda Shephard Illinois: Patti Kimmel ... Community Based Organizations • County Health Departments • State Agencies • Health Maintenance Organizations Because members of the social marketing collaborative believe in “asking your audience, ... current as of January 2002 The enclosed materials are meant to help you increase your knowledge of social marketing and how it can be used to address public health issues Informational materials

Ngày tải lên: 07/03/2014, 00:20

... test tubes. Radioactivity was measured using a gamma counter (LKB, Wallac, Finland). All animals were maintained and handled according to local and national ethical guidelines. Animal model of septic ... plane of a model membrane. ASA, accessible surface area. +, the peptide has an adequate mean surface accessibility ‡ 30%. Peptide Sequence Total number aa Number positive charge Number negative ... documented. For exam- ple, degradation products of elastin or heparan sulfate proteoglycan can act as chemoattractants towards inflammatory cells or activate TLR4, respectively [34,35]. TLR4 activation by

Ngày tải lên: 07/03/2014, 01:20

... values (again) are labeled as functional, social, conditional, emotional, and epistemic Factor analysis is conducted on all 88 variables from the questionnaire and the factors are examined Factors ... felt that a more comprehensive model was needed With that, I began to read the material that was already available and look for additional models that could be examined What follows is an article ... model Factor analysis was then conducted on each Trang 20 As detailed in chapter four, the SNG functional value, as based on this data set and the individual factor analysis results, is made up

Ngày tải lên: 07/03/2014, 02:20

... kDa; BSA, 66 kDa; glutamic dehydrogenase, 55 kDa; ovalbumin, 45 kDa; glyceraldehyde-3-phosphate dehydrogenase, 36 kDa; carbonic anhydrase, 29 kDa; soybean trypsin inhibitor, 20 kDa; a- lactalbumin, ... substrates as VAO, there are some marked differences The catalytic efficiencies (kcat ⁄ KM) for vanillyl alcohol and 5-indanol are higher than those of VAO, whereas vanillylamine and alkylphenols are ... was amplified using genomic DNA from Rhodococcus sp strain RHA1 and the following primers: forward, 5¢-CACCATATGACG CGAACCCTTCCCCCA-3¢ (NdeI site is underlined); and reverse, 5¢-CACAAGCTTCAGAGGTTTTGGCCACGG-3¢

Ngày tải lên: 07/03/2014, 09:20

... Actinobacteria Aquificae Proteobacteria Proteobacteria Proteobacteria Proteobacteria Proteobacteria Proteobacteria Proteobacteria Proteobacteria Proteobacteria Proteobacteria Proteobacteria Proteobacteria ... Siphonosoma cumanense Protein Seq Data Anal 3, 141–147 Yano H, Satake K, Ueno Y & Tsugita A (1991) The amino acid sequence of the beta chain of hemerythrin from Lingula unguis Protein Seq Data Anal ... Tsa family protein Transketolase Translation elongation factor Tu ATP synthase F1, a- subunit Fig Genomic orientation (A) , nucleotide and amino acid sequence (B) of MCA0715 (A) MCA0715 is located

Ngày tải lên: 07/03/2014, 17:20

... illus- trated by an artificial example as well as by a simple real example extracted from the HOG (high osmolarity glycerol response) pathway for hyperosmolarity adap- tation in budding yeast (Saccharomyces ... equations can be obtained by properly chosen n parameter perturbations. All these approaches are based on parameter perturbation experiments which are, however, not always achievable in many practical cases. In ... cerevisiae MAP kinase cascades typically composed of three tiers of protein kinases, a MAP kinase (MAPK), a MAPK kinase (MAPKK) and a MAPKK kinase (MAPKKK), are common signalling modules in eukaryotic

Ngày tải lên: 07/03/2014, 21:20

... A- 6 N-acylD-glutamate amidohydrolase; Alicaligenes faecalis-DA1: Alcaligenes faecalis DA1 N-acyl–D-amino acid amidohydrolase; V paradoxus Iso1: Variovorax paradoxus Iso1 N-acyl-D-amino acid amidohydrolase; ... ShineDalgarno sequence and the N-D-AAase start codon The sequence upstream of the N-D-AAase gene is: 5¢…AGGACAGACGAATG…3¢ (The Shine-Dalgarno sequence and start codon are in bold) The recombinant ... xylosoxydans A- 6 N-acyl-D-amino acid amidohydrolase; A- 6-D45919: Alcaligenes xylosoxydans ssp xylosoxydans A- 6 N-acyl-D-Asparate amidohydrolase; A- 6-D50061: Alcaligenes xylosoxydans ssp xylosoxydans A- 6

Ngày tải lên: 08/03/2014, 16:20

... arms, and flew across the plain But at this instant, a more extraordinary and terrifying... ye fragrant flowers, and, more than all, ye broad and stately oaks, bind your heads, and wave your ... custody, and was handed down as a valuable legacy to his descendants, among whom the present translator has the honour to rank himself. Rice ap Thomas, Esquire, was a man of a most sweet and inoffensive ... harmonious voice to cheer and to animate him. In a word, passion had taken up her abode in his guileless heart before he was aware of her approach. Imogen was fair; and the eye of Edwin was

Ngày tải lên: 15/03/2014, 07:20

... other trehalases that have been isolated and purified from various other organisms, and at least partially charac- terized. Most of these enzymes are from fungi or yeast, and have molecular masses of about ... (http://cmr.tigr.org/tigr-scripts/CMR/Genome- Page.cgi?org_search ¼ & org ¼ gms.). Using the pro- gram tblastn, which compares an amino acid query sequence against a nucleotide sequence database dynamically translated in all six reading frames, all of the ... practical use Glycobiology 13, 93R–104R 19 Ando V, Satake H, Ito K, Sato A, Nakajima M, Takahashi S, Haruyama H, Ohkuma Y, Kinoshita T... this trehalase in M smegmatis Despite the fact that

Ngày tải lên: 16/03/2014, 11:20

... Escherichia coli J Biol Chem 277, 32650– 32658 4 Yoshimura T, Sagami... gtcgggagACCcagctggagaaaaaag-3¢, 5¢-gatgagtcgggagTTTcag ctggagaaaaaag-3¢, 5¢-ggacccgttttgcgACCtcgaaagtgagc-3¢, and 5¢-ggacccgttttgcgTTTtcgaaagtgagc-3¢ ... decreased the rate of auto-oxidation [5], whereas Ala and Asn substitutions at Asp40, an amino-acid residue that interacts via two water mole- cules with the proximal ligand His77, markedly increased ... Chem... sulfate fractionation and dialysis, the protein was subjected to Ni2+ ⁄ nitrilotriacetate ⁄ agarose chromatography (Qiagen, Valencia, CA, USA) Final purification was by Sephadex G-75

Ngày tải lên: 16/03/2014, 13:20

... object-relational database system Illustra [I11941 provides database support for time-series data along with relational data. A time-series is an ADT(Abstract Data Type) value implemented a& amp; a ... and Par- adise [DKLPY94] allow an attribute of a relational record to belong to an Abstract Data Type (ADT). Each ADT defines methods that may be inyoked on values of that type. An ADT can ... catalogs that maintain statistics and store schema information. Further, certain values may be named. Query Language: An E-ADT can provide a query language with which expressions over values

Ngày tải lên: 16/03/2014, 16:20

... and a compass that ever guided me away from the shoals and quicksands. She was an angel companion to me all through the trials and hardships of that awful war. Well, I arrived in Portland, was ... thought a great deal of it as a keep-sake and always gave... assigned to any company I never had to answer roll-call I could go and come as I pleased Once in awhile a guard would halt ... the cannonading came from, but for what, we could not make out. About a mile ahead of us lay a United States gunboat, and every few minutes a puff of smoke, and then a loud bang erang erang erang

Ngày tải lên: 17/03/2014, 02:20