a statistical analysis of morphemes

... socioeconomic change, and the geography of displacement, Journal of Urban Affairs, 18(1): 39-62 Mallach, A (2008) Managing neighborhood change A framework for sustainable and equitable revitalization Presented ... http://www.nytimes.com/2013/02/14/nyregion/report-citesshortcomings -of- affordable-housing-plan.html?_r=1& Jacobs, J (2004) Dark Age Ahead Toronto: Random House of Canada Jerzyk, M (2009) Gentrification’s third way: An analysis of housing policy & gentrification ... large sample population rather than a high probability of association Though Cramer’s V statistic was used to approximate the degree of association between variables, all of them were considerably

Ngày tải lên: 18/10/2022, 12:15

... Beta A Statistical Analysis of a Stock’s Volatility Courtney Wahlstrom Iowa State University, Master of School Mathematics Creative Component Fall 2008 Amy Froelich, Major Professor Heather ... Member Travis Sapp, Committee Member Beta: A Statistical Analysis of a Stock’s Volatility With recent economic uncertainty, discussion of the volatility of the stock market is unavoidable Describing ... should fall at a higher rate as well On the contrary, a stock with a relatively small β value maintains a much steadier price over time than the market This can be summarized in the following chart

Ngày tải lên: 19/10/2022, 02:03

... Cristobal M, Gianola D, Im S (1992) Marginal likelihood and Bayesian approaches to the analysis of heterogeneous residual variances in mixed linear Gaussian models Comput Stat Data Anal 13, 291-305 ... Original article Statistical analysis of ordered categorical data via a structural heteroskedastic threshold model JL Foulley D Gianola 2 1 Station de génétique quantitative et appliquée, ... ratio statistic for fitting the entertained model against a saturated model having as many parameters as there are alge- braically independent variables in the data vector,

Ngày tải lên: 09/08/2014, 18:22

... collection, analysis, and interpretation of data, and also not in writing of the manuscript Availability of data and materials All the input data, full protocols, and example output files are available ... Kalkatawi M, Alam I, Bajic VB BEACON: automated tool for bacterial GEnome annotation ComparisON BMC Genomics 2015;16:616 Nazarian A, Gezan SA GenoMatrix: a software package for pedigreebased and ... basic analysis of causality can be addressed, independent of the field of research Conclusions In this study, we present SLALOM, a method and its associated software package, for in-depth analysis

Ngày tải lên: 25/11/2020, 14:55

... is change for planar shape, where under the land areas a noticeable decrease takes place It can be seen that for a planar shape, a high fraction of the current is generated at the catalyst layer ... is used to analyse and evaluate the performance of a planar and a tubular-shaped PEM fuel cell 2.1 Computational domain The full computational domains for the planar and tubular-shaped PEM fuel ... distribution of the molar oxygen fraction at the catalyst layer At a tubular shape, the oxygen mole fraction variation is low enough not to cause diffusive limitations, whereas at a planar shape the

Ngày tải lên: 05/09/2013, 14:58

... popular American and Vietnamese reality TV shows. The research is carried out based on the combination of a variety of methods namely qualitative, quantitative, statistics, descriptive, analytic, ... the masters of ceremonies in American and Vietnamese reality television (TV) shows. The data for analysis in this thesis are 160 examples of opening and closing speeches in American English and ... features of both Vietnamese and American languages. They can hopefully be beneficial not only for people working as masters of ceremonies (MCs) but also for students, teachers, users of American

Ngày tải lên: 26/11/2013, 12:41

... to make the EECs as clear, informative and accurate as possible, how to use different types of sentence and connect them naturally as well as how to take the advantage of passive voice to create ... MASTER THESIS IN THE ENGLISH LANGUAGE ii MINISTRY OF EDUCATION AND TRAINING UNIVERSITY OF DANANG -------- PHAM THI NGUYET THO A DISCOURSE ANALYSIS OF ECONOMIC EXPORT CONTRACTS IN ENGLISH AND ... MINISTRY OF EDUCATION AND TRAINING UNIVERSITY OF DANANG -------- PHAM THI NGUYET THO A DISCOURSE ANALYSIS OF ECONOMIC EXPORT CONTRACTS IN ENGLISH AND VIETNAMESE Field: The English Language Code:

Ngày tải lên: 26/11/2013, 13:26

... lexical choices and syntactic features are also important to make a good speech. Let us take an example in the graduation speech of the US president, Barrack Obama, at the University of Michigan ... SPEECHES Layout is identified as the way in which the parts of something are arranged, and the layout of a graduation speech is the way in which the writer arranges and organizes the parts or ideas ... (4.1)President Faust, members of the Harvard Corporation and the Board of Overseers, members of the faculty, proud parents, and, above all, graduates.[46] Thanking: The procedure of thanking appearing

Ngày tải lên: 26/11/2013, 13:27

... activate a set of assumptions as to the meaning of what has gone beforehand or will generate a set of expectations as to what may follow. A cohesive device can be defined as a word, phrase or clause, ... qualitative and quantitative methods. Also, statistical, descriptive and contrastive approaches are resorted to find out the features of English School Announcement. 3.2. DATA COLLECTION AND ANALYSIS ... research, analyzing data based on syntactic and semantic features of English School Announcement, finding and discussing the result of analysis above, suggesting some implications of teaching and

Ngày tải lên: 26/11/2013, 13:28

... and learning of English language to Vietnamese students, especially law students as well as translation of legal documents. 1.3. RESEARCH QUESTION 1. What are the discourse features of ECAs and ... into parts for layout analysis. - Analyzing data: ECAs and VCAs are analyzed in terms of layout, lexical choices, syntactic structures, and cohesive devices to give out the frequencies of occurrence. ... The standard form of the signature for ECAs: On behalf of Name of the Union (Signature) Full name Title On behalf of Name of the Company (Signature) Full name Title 14 The formula of the signature

Ngày tải lên: 26/11/2013, 13:30

... LEXICO-GRAMMATICAL FEATURES OF ADES 4.2.1 Transitivity An analysis of the data in terms of Transitivity reveals many worth-considered results Of 40 AdEs, there are totally 2478 clauses - the 2280 ranking ... use language to express ideas and achieve goals Through language, individuals establish and maintain social identity and relationships The study of language in use, Discourse analysis, has become ... Thi Thanh Mai (2007), etc As regards genre analysis, research on academic writing has examined a variety of genres such as research article (Swales,1990), sales promotion letters, job applications

Ngày tải lên: 26/11/2013, 13:31

... even many cultural and social aspects It is crucial for a translator to fully understand all the denotations and connotations of a word so that he can avoid making any loss of connotative meanings ... man’s emotions, man’s mental and physical state, man’s actions and man’s ways of CHAPTER LITERATURE REVIEW AND THEORETICAL BACKGROUND 2.1 PREVIOUS RESEARCH Many authors had written a number of ... pragmatic and sociocultural features of each subtype of words: noun, verb, adjective, and adverb - The grammatical, semantic, pragmatics and sociocultural features of words denoting female characteristics

Ngày tải lên: 26/11/2013, 13:31

... the statistical tests and to obtain more accurate results, the researcher attempted to control and adjust the factors (that is, to treat them as covariates and keep them constant) by using analysis ... of covariance (ANCOVA) tests Mean scores and standard deviations for all the variables were calculated and compared ANCOVA tests were performed to investigate (a) whether there were significant ... Her research interests focus primarily on the comparative analysis of organizational communication in multinational corporations; and secondly, the teaching of professional communication and cross-cultural

Ngày tải lên: 09/12/2013, 16:15

... 1: Articulators and places of articulation Articulators: Involved the movable parts of the mouth Tip of tongue Blade of tongue Back of tongue Places of articulators: Involved the unmovable parts ... consonants and Vietnamese consonants are contrasted Design of the study This paper provides a clear organization consisting main parts that help an easy exploration and practical benefit gained ... airstream is altered in some ways by the positioning of various parts of the mouth This alteration is the basic which helps classify English consonants 1.1 Articulators and places of articulation

Ngày tải lên: 14/12/2013, 16:45

... Mountain Delta States South East Afforestation from cropland Appalachia Afforestation from pasture Great Plains Corn Belt Tillage changes Lake States... agricultural sector, Lewandrowski et al examined ... economic analysis of the impacts of House-passed climate legislation, HR 2454, on U.S. agriculture. The analysis assumes no technological change, no alteration of inputs in agriculture, and no ... covers industrial sectors that have: 1) an energy or greenhouse gas intensity of at least 5% and a trade intensity of at least 15%; or 2) an energy or greenhouse gas intensity of at least 20%. Without

Ngày tải lên: 21/02/2014, 01:20

... susceptibility, and are more persuasive than low or weak fear appeals The results also indicate that fear appeals motivate adaptive danger control actions such as message acceptance and maladaptive fear control ... successes and failures of fear appeals, and fear is reincorporated as a central variable in the model According to the EPPM, the evaluation of a fear appeal initiates two appraisals of the message, which ... outcomes META -ANALYSIS Rationale Meta -analysis is a quantitative method that synthesizes the results of a particular group of studies Researchers gather all available studies on a topic and then

Ngày tải lên: 05/03/2014, 22:21

... 1984b; Jajuga, 1986; Tanaka, 1987; Tanaka and Watada, 1988; Tanaka et al. 1989; Chen, 1988; Diamond, 1988). Later on, the advances in theory have been made with respect to the measurement of vagueness ... Taiwan. Estimating costs of constructing wastewater treatment plants 387 Table 1. Database of all domestic wastewater treatment plants in Taiwan Plant no. Location of treatment plant Design capacity (10 2 CMD) Total ... practice. Data collection, normalization, and analysis Cost information associated with 48 domestic was- tewater treatment plants and 29 industrial waste- water treatment plants was collected and

Ngày tải lên: 15/03/2014, 23:17

... (kid A5 5G) PA55G(+) GACACCGCAAAGCCGCCAGTGCGGGCAAA Change GGC–GCC in A5 5 (kid A5 5G) PT69G()) TTGGCATACGTACCACAGGTGTTGTAC Change ACA–GGA in T69 (kid T69G) PT69G(+) GTACAACACCTCCGGTACGTATGCCAA Change ... TTGTACGTTGCGAACAACCCCGGACAAT Change GAT–GAA in D75 (kid D75E) PD75E(+) ATTGTCCGGGGTTGTTCGCAACGTACAA Change ATC–TTC in D75 (kid D75E) PD75N()) TTGTACGTTGCAATCAACCCCGGACAAT Change GAT–AAT in D75 ... D75N) PD75N(+) ATTGTCCGGGGTTGATTGCAACGTACAA Change ATC–TTA in D75 (kid D75N) PR73H()) ACCACAGGTGTTGTACATTGCGATCAACC Change CGT–CAT in R73 (kid R73H) PR73H(+) GGTTGATCGCAATGTACAACACCTGTGGT Change ACG–ATG

Ngày tải lên: 16/03/2014, 03:20

... case when the firm also offers small packages. We assume that a unit of product in a small package provides the same utility as a unit in a large package. In this case, note that two small packages ... Janakiraman; Ambar Rao; seminar participants at the University of Arizona, University of British Columbia, University of Texas at Austin, University of Texas at Dallas, and Washington ... buy two large packages rather than a single large package and a small package Note that in contrast to this pricing 1 approach, when 1 < 2 , prices of large packages do not change with

Ngày tải lên: 16/03/2014, 11:20