0

a rounded flight path

Tài liệu Choosing A New Career Path ppt

Tài liệu Choosing A New Career Path ppt

Quản trị kinh doanh

... possibilities and creating a new career future, instead of building walls Every goal has at least one path leading to it, often several Jane began to think of how she could discover these paths First, ... future career plans She was concerned that she couldn't afford (financially) to leave her current job, and worried that a temporary decrease in salary in a steppingstone job might create too great ... goals Jane also talked to college counselors, career experts, and located members of an industry related professional association Through these contacts, Jane gained a network of professionals...
  • 3
  • 354
  • 1
Báo cáo khoa học: Phosphorylation of the Saccharomyces cerevisiae Grx4p glutaredoxin by the Bud32p kinase unveils a novel signaling pathway involving Sch9p, a yeast member of the Akt / PKB subfamily pot

Báo cáo khoa học: Phosphorylation of the Saccharomyces cerevisiae Grx4p glutaredoxin by the Bud32p kinase unveils a novel signaling pathway involving Sch9p, a yeast member of the Akt / PKB subfamily pot

Báo cáo khoa học

... Healthcare Ltd, Chalfont St Giles, UK), and the signal was quantified on a Kodak Image Station 440CF and analyzed with Kodak 1d image software Monoclonal antibodies against phosphoserine (cat ... GAL regulon Total mRNAs were extracted and subjected to standard northern blot analysis GAL1 mRNA, and ACT1 mRNA (considered as a loading control), were detected by the use of specific radiolabeled ... Bud32p in a new signaling pathway in yeast C Peggion et al polypeptide in some archaeans, and their human homologs are also able to interact [4] Two recent papers have highlighted the importance of...
  • 15
  • 414
  • 0
Báo cáo khoa học: Mitochondrial biogenesis in mtDNA-depleted cells involves a Ca2+-dependent pathway and a reduced mitochondrial protein import pdf

Báo cáo khoa học: Mitochondrial biogenesis in mtDNA-depleted cells involves a Ca2+-dependent pathway and a reduced mitochondrial protein import pdf

Báo cáo khoa học

... 5Â-GGCTGAGACAAGAA ACGCTGTAT-3Â, TBP sense 5Â-CCTCACAGGTCAAAG GTTTACAGTAC-3Â, antisense 5Â-GCTGAGGTTGCAG GAATTGAA-3Â) PCR amplications were denaturation at 95C for 15 s, annealing at 60C for and polymerization ... CATTCTCGCATCCTAGACATT-3Â, antisense 5Â-GTGC CTGGAAGGTGATGATCA-3Â; COXVb sense 5Â-TGCG CTCCATGGCATCT-3Â, antisense 5Â-CTTCTTTGCAGC CAGCATGAT-3Â; b-ATPase sense 5Â-CCATCCTGGGTA TGGATGAACT-3Â, antisense ... mitochondrial dysfunction is a new signaling pathway that impairs cell proliferation EMBO J 21, 5363 38 Biswas G, Adebanjo OA, Freedman BD, Anandatheerthavarada HK, Vijayasarathy C, Zaidi M, Kotlikoff...
  • 25
  • 485
  • 0
Báo cáo khoa học: Biosynthesis of D-arabinose in mycobacteria – a novel bacterial pathway with implications for antimycobacterial therapy pdf

Báo cáo khoa học: Biosynthesis of D-arabinose in mycobacteria – a novel bacterial pathway with implications for antimycobacterial therapy pdf

Báo cáo khoa học

... terminal Ara6 motifs: Arafb1 fi 2Arafa1 fi 5(Arafb1 fi 2Arafa1 fi 3)Arafa1 fi 5Arafa1 About two-thirds of the terminal b-Araf and the penultimate 2 -a- Araf serve as attachment sites for mycolic acids ... [26] The branched arabinan chains of the arabinogalactan are attached to the linear galactan backbone The arabinan consists of an inner linear region of Araf-(1 fi 5) -a- Araf and of branched non-reducing ... motifs: the Ara6 motif similar to that present in arabinogalactan, and a simplified linear Ara4 motif: Arafb fi 2Arafa1 fi 5Arafa1 fi 5Arafa1 Some of the non-reducing arabinofuranose termini are capped...
  • 21
  • 572
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " Human herpesvirus 8 – A novel human pathogen" potx

Điện - Điện tử

... Ebihara Y: Classic type of Kaposi's sarcoma and human herpesvirus infection in Xinjiang, China Pathol Int 2001, 51(11):845-852 199 Ayuthaya PI, Katano H, Inagi R, Auwanit W, Sata T, Kurata T, Yamanishi ... Maddalena D, Jaffe HW, Weiss RA, et al.: Kaposi's sarcoma-associated herpesvirus and Kaposi's sarcoma in Africa Uganda Kaposi's Sarcoma Study Group Arch Intern Med 1996, 156(2):202-204 128 Mayama ... PA: WB Saunders Company; 1995 Kawano M, Hirano T, Matsuda T, Taga T, Horii Y, Iwato K, Asaoku H, Tang B, Tanabe O, Tanaka H, et al.: Autocrine generation and requirement of BSF-2/IL-6 for human...
  • 32
  • 402
  • 0
báo cáo hóa học:

báo cáo hóa học:" Human herpesvirus 8 – A novel human pathogen" docx

Hóa học - Dầu khí

... Ebihara Y: Classic type of Kaposi's sarcoma and human herpesvirus infection in Xinjiang, China Pathol Int 2001, 51(11):845-852 199 Ayuthaya PI, Katano H, Inagi R, Auwanit W, Sata T, Kurata T, Yamanishi ... Maddalena D, Jaffe HW, Weiss RA, et al.: Kaposi's sarcoma-associated herpesvirus and Kaposi's sarcoma in Africa Uganda Kaposi's Sarcoma Study Group Arch Intern Med 1996, 156(2):202-204 128 Mayama ... PA: WB Saunders Company; 1995 Kawano M, Hirano T, Matsuda T, Taga T, Horii Y, Iwato K, Asaoku H, Tang B, Tanabe O, Tanaka H, et al.: Autocrine generation and requirement of BSF-2/IL-6 for human...
  • 32
  • 259
  • 0
Salmonella A Dangerous Foodborne Pathogen Part 2 ppt

Salmonella A Dangerous Foodborne Pathogen Part 2 ppt

Điện - Điện tử

... Pachuca-Tulancingo, Mineral de la Reforma, Hidalgo 2Laboratory of Food Safety, University Center of Exact Sciences and Engineering University of Guadalajara, Marcelino Garc a Barragán, Guadalajara, Jalisco México ... farmed animals Animals may become infected with Salmonella through environmental contamination, other animals or contaminated feed Both animals and humans can function as Salmonella reservoirs In addition ... Goelzau, Kentucky, Hadar, Agona, Poona, Bandia, Bessi, Brunei, Hull, Istanbul, Javiana, Magherafelt, Molade, Oxford, Rubislaw, Tamale, and Zanzibar Kentucky, Hadar, Enteritidis, Braenderup, Montevideo,...
  • 25
  • 423
  • 0
Salmonella A Dangerous Foodborne Pathogen Part 3 potx

Salmonella A Dangerous Foodborne Pathogen Part 3 potx

Điện - Điện tử

... Fujiwara, Y., Hosoda, T., Kurazono, T., Ohtsuka, K., Yanagawa, K & Yamaguchi M (2008) An outbreak of Salmonella food poisoning at a snapping turtle restaurant, Japanese Journal of Infectious Diseases, ... subjects are affected – salmonellosis may also lead to the patient’s death (Pathan et al., 2010) The severity of Salmonella infections can also be aggravated by the fact that in recent years more and ... of raw vegetables has been attributed to Salmonella (Cantoni & Bersani, 2010) Animal faeces and irrigation water are the main ways for Salmonella to spread to crops (Islam et al., 2004) The water...
  • 25
  • 483
  • 0
Salmonella A Dangerous Foodborne Pathogen Part 4 doc

Salmonella A Dangerous Foodborne Pathogen Part 4 doc

Điện - Điện tử

... Istanbul Strait connects the Sea of Marmara to the Black Sea and the Canakkale Strait to the Aegean Sea The Sea of Marmara separates Turkey’s Asian and European regions Being an important water ... alkalinisation; AGLU: ALPHAGLUCOSIDASE; SUCT: SUCCINATE alkalinisation; NAGA: Beta-N-NCETYL-GALACTOSAMINIDASE; AGAL: ALPHA-GALACTOSIDASE; PHOS: PHOSPHATASE; GlyA: Glycine ARYLAMIDASE; ODC: ORNITHINE DECARBOXYLASE; ... Salmonella spp Salmonella spp GGA IMLTa ELLM ILATa - 85 - APPA: Ala-Phe-Pro-ARYLAMIDASE; ADO: ADONITOL; PyrA: L-Pyrrolydonyl-ARYLAMIDASE; IARL: L-ARABITOL; dCEL: D-CELLOBIOSE; BGAL: BETA-GALACTOSIDASE;...
  • 25
  • 372
  • 0
Salmonella A Dangerous Foodborne Pathogen Part 5 doc

Salmonella A Dangerous Foodborne Pathogen Part 5 doc

Điện - Điện tử

... Srinagar S Stanley S Takoradi North America/ Multiple South America Middle East Mexico Europe and Russia Eastern Caribbean Central pacific Central America Africa India/ SE Asia Salmonella Serotype ... South America Middle East Mexico Europe and Russia Eastern Caribbean Central pacific Central America Africa India/ SE Asia Salmonella Serotype Salmonella – A Dangerous Foodborne Pathogen + + ... S Albany S Anatum S Anfo S Arizonae S Atakpam S Augusten S Baguida S Bareilly S Biafra S Blockley S Bovis-mobificans S Bradford S Braender S Brancast S Bredeney S Brunei S Bullbay S Cannstat...
  • 25
  • 374
  • 0
Salmonella A Dangerous Foodborne Pathogen Part 6 docx

Salmonella A Dangerous Foodborne Pathogen Part 6 docx

Điện - Điện tử

... Mesquita Filho”, Araraquara/SP Nascimento, H.M.; D .A Delado; I.F Barbaric Avaliação da aplicação de agentes sanitizantes como controladores crescimento microbiano na indústria alimentícia Revista ... Silveira Efeito cloro na água de lavagem para desinfecção de alface minimamente processada Ciência e Tecnologia de Alimentos, Campinas, v.21, n.2, p.197-201, maio-ago., 2001 Beuchat, L.R Standardization ... comparativa de tratamentos químicos na sanitização de frutas e verduras 2002, 74f Tese (mestrado em Ciência dos Alimentos) - Faculdade de Ciências Farmacêuticas, Universidade Estadual Paulista “Júlio...
  • 25
  • 304
  • 0
Salmonella A Dangerous Foodborne Pathogen Part 7 docx

Salmonella A Dangerous Foodborne Pathogen Part 7 docx

Điện - Điện tử

... precipitated area (Figure 5) Fig Appearance of typical Salmonella colonies in Mac Conkey agar 5.1.3.3 Appearance of Salmonella colonies in Salmonella Shigella agar (SS) Typical Salmonella colonies are ... colonies appear as transparent and colorless in Mac Conkey agar Sometimes the centre appears as pink If there are many organisms that fermantates the lactose, the precipitated area around Salmonella ... Mercek Gda Mikrobiyolojisi Uygulamalar Ed: A. K Halkman Baak Matbaaclk Ltd ti., 358 Sayfa [8] Arda, M (1985) Genel Bakteriyoloji Ankara ĩniversitesi Veteriner Fakỹltesi Yaynlar:402 [9] Arda, M (2000)...
  • 25
  • 330
  • 0
Salmonella A Dangerous Foodborne Pathogen Part 8 pptx

Salmonella A Dangerous Foodborne Pathogen Part 8 pptx

Điện - Điện tử

... csgD (Latasa et al., 2005) Also, these authors demonstrated that a bapA mutant strain showed a significant lower colonization rate at the intestinal cell barrier and consequently a decreased efficiency ... disease: highly adapted to men: Salmonella Typhi and Salmonella Paratyphi A, B and C, agents of typhoid fever; highly adapted to animals: Salmonella Dublin (bovines), Salmonella Choleraesuis and ... expression (Bassler, 1999) Gram-negative bacteria primarily use a variety of Nacylhomoserine lactones (AHLs) as AI (autoinducer-1, AI-1), while Gram-positive bacteria Attachment and Biofilm Formation...
  • 25
  • 255
  • 0
Salmonella A Dangerous Foodborne Pathogen Part 9 doc

Salmonella A Dangerous Foodborne Pathogen Part 9 doc

Điện - Điện tử

... Overview of Healthcareassociated MRSA Atlantaed Clark, G.M.; Kaukmann, A. F.; Gangarosa, E.J (1973) Epidemiology of an international outbreak of Salmonella Agona, Lancet, v.2, p.490-493 Claus, J.W ... Conferencia Apinco de Ciência e Tecnologia Avícolas, 1998, Campinas, Anais , Campinas, FACTA, 1998, p.183-190 Berchieri Jr, A (2000) Salmoneloses Aviárias, In: Doenças das aves, Berchieri Jr, A. ; Macari, ... M .A. F ed Seção 4, p 435-454, FACTA, Campinas, SP Bersot, L.S (2006) Salmonella no Brasil: Sua importância no abate de aves In: V Simpósio de sanidade avícola da UFSM, 2006, Santa Maria, RS Anais...
  • 25
  • 365
  • 0
Salmonella A Dangerous Foodborne Pathogen Part 11 pot

Salmonella A Dangerous Foodborne Pathogen Part 11 pot

Điện - Điện tử

... Update: The National Antimicrobial Resistance Monitoring System Enteric Bacteria (NARMS): Animal Arm United States Animal Health Association Proceedings Dargatz D .A. , Fedorka-Cray P.J., Ladely ... http://www.fsis.usda.gov/ofo/hrds/internat/seminar/slideshows/10 tamu5/index.htm Usera, M A. , A Aladuena, R Gonzalez, M De la Fuente, J Garcia-Pena, N Frias, and M A Echeita, 2002 Antibiotic resistance of Salmonella spp from animal ... acquired in the United States unspecified agents Emerg Infect Dis 2011 Jan;17(1):16-22 Shabarinath, S., H Sanath Kumar, R Khushiramani, I Karunasagar, and I Karunasagar 2007 Detection and characterization...
  • 25
  • 239
  • 0
Salmonella A Dangerous Foodborne Pathogen Part 12 pdf

Salmonella A Dangerous Foodborne Pathogen Part 12 pdf

Điện - Điện tử

... that they are able to be delivered directly to a mucosal surface via nasal, ocular, or oral administration Because most pathogens invade the host through a mucosal surface, an enhanced mucosal ... bacterial, viral, and protozoal pathogens (Layton et al., 2009; O’Meara et al., 2010; Kremer et al., 2011; Layton et al., 2011) These vaccines have an advantage over many other types of vaccines ... spread of pathogenic viruses and bacteria Because there are a large Alternative Strategies for Salmonella Control in Poultry 269 number of Salmonella serovars, each with individual epitopes that...
  • 25
  • 218
  • 0
Salmonella A Dangerous Foodborne Pathogen Part 15 pptx

Salmonella A Dangerous Foodborne Pathogen Part 15 pptx

Điện - Điện tử

... Research, Vol 5, No.6, pp 477-482, ISSN 1990-9233 Astorga Marquez, R.J.; Salaberria, A. E.; Maldonado Garcia, A. ; Valdezate Jimenez, S.; Carbonero Martinez, A. ; Aladuena Garcia, A. , & Casas, A. A ... the data as a gel image, electrophorogram or in a tabular data format will allow comparison of patterns among different laboratories or within databanks (Savelkoul et al., 1999) FAFLP appears quite ... Fluoroquinolones and gyrA Gene Mutation in the Salmonella enterica Serovar Typhi and Paratyphi A Isolated in Katmandu, Nepal, 348 Salmonella – A Dangerous Foodborne Pathogen in 2003 Diagnostic Microbiology and...
  • 25
  • 310
  • 2
Salmonella A Dangerous Foodborne Pathogen Part 17 doc

Salmonella A Dangerous Foodborne Pathogen Part 17 doc

Điện - Điện tử

... TCA GAC CAA AAG TGA CCA Malorny CFU/ml TC et al., 2004 3: CAC CGA CGG CGA GAC CGA CTT T 1: ATA AAT CCG GCG GCC TGA TG fimC ice cream without 103 2: TGG TAT CGA CGC CTT TAT CTG CFU/ml AGA 3: TTA ... CCA CGT TCG GGC AA 2: TCA TCG CAC CGT CAA AGG AAC Hein et al., CGT AA 2006 3: TTA TTG GCG ATA GCC TGG CGG TGG GTT TTG TTG 1: AAC GTG TTT CCG TGC GTA AT 41°C-24h 0,04 2: TCC ATC AAA TTA GCG GAG ... I) 1: CATTGATGCCATGGGTGACART McCarthy et al., 2009 2: CGTGACGATAATCCGTGTAC 3: TACACGAGTCACTAAATCCTTCAGT (Set II) Table Detection of Salmonella using real-time PCR.increase of the released dye...
  • 25
  • 159
  • 0
Salmonella A Dangerous Foodborne Pathogen Part 18 ppt

Salmonella A Dangerous Foodborne Pathogen Part 18 ppt

Điện - Điện tử

... AGGCAACCAGTTGTTGAT GAATCCTCAGTTTTTCAAC Forward GTTTC invA Reverse TAGCCGTAACAACCAATAC AAATG AATTTAACAGCTAAAGAGT Forward TTGGT femA Reverse TTCATTAAAGAAAAAGTGT ACGAG GATAGACTTTTCGACCCAA Forward CAAAG ... ACT GAA TAT C CGA AAG AGC GTG GTA ATT AAC CGA TGA CTG ACT ATA CAA GrUrA rCrGC TGG CGA TAT TGG TGT TTA TG CTA GTA CAT GAA GCT rArArA rGAC CGC AGG AAA CGT TGA A FAM-CGT TCT ACA TTrG rArCrA rGrAA ... Forward Salmonella spp Reverse Size (bp) GAA TCC TCA GTT TTT CAA CGT TTC CCA GAC GAA AGA GCG TGG TAA GAA GCC CGA ACG TGG CGA GTA TGC CCG GTA AAC AGA TGA GT AAA GGA ACC GTA AAG CTG GCT GGG TCA TCC...
  • 25
  • 317
  • 0
báo cáo khoa học:

báo cáo khoa học: "Littoral cell angioma of the spleen in a patient with previous pulmonary sarcoidosis: a TNF-α related pathogenesis?" pot

Báo cáo khoa học

... Littoral cell angioma as a rare cause of splenomegaly Ann Hematol 2001, 80:45 Oliver-Goldaracena JM, Blanco A, Miralles M, Martin-Gonzalez MA: Littoral cell angioma of the spleen: US and MR imaging ... infections, we had to exclude fungal disease, septic emboli and granulomatous diseases such as sarcoidosis and tuberculosis Associated adenopathic, pulmonary and mediastinal diseases suspecting sarcoidosis ... Mycobacterium avium-intracellulare complex, Pneumocystic carinii and disseminated Kaposi sarcoma may also cause splenic masses but are typically seen in immunocompromised individuals After elaborating...
  • 4
  • 619
  • 0

Xem thêm