0

a proximal sufficient cause of depression

Báo cáo khoa học: Growth hormone/JAK-STAT axis signal-transduction defect A novel treatable cause of growth failure pdf

Báo cáo khoa học: Growth hormone/JAK-STAT axis signal-transduction defect A novel treatable cause of growth failure pdf

Báo cáo khoa học

... from total RNA was performed using a Reverse Transcription System (Thermoscrip RT, Invitrogen) Human GHR was amplified from cDNA with primers ACACTCAAGAATGGACTCAAG and TGTAAATTGG CTCATCTGAG under ... Takahashi Y, Shirono H, Arisaka O, Takahashi K, Yagi T, Koga J, Kaji H, Okimura Y, Abe H, Tanaka T & Chihara K (1997) Biologically inactive growth hormone caused by an amino acid substitution J Clin ... Human STAT3 was amplified from cDNA with specific primers (STAT3 R: TAGGCGCCTCA GTCGTATCT and STAT3 F: AGCATCGAGCAGCT GACTAC), under the following conditions: denaturation at 95 °C for min, annealing...
  • 13
  • 323
  • 0
Báo cáo y học:

Báo cáo y học: "Background: Mood disorders including depression and bipolar disorders are a major cause of morbidity in childhood and adolescence, and hospitalizations for mood disorders are the leading diagnosis for all hospitalizations in general hospit

Báo cáo khoa học

... strengths of this analysis lie in the large database, the probability based sampling, and the standardized methodology of the tri-annual data As with other administrative measures of disease, hospital ... Page of Methods The Kids’ Inpatient Database (KID) is one in a family of databases and software tools developed as part of the Healthcare Cost and Utilization Project (HCUP), a Federal-State-Industry ... recently available at the time [14] The unit of analysis is a hospitalization, and it is possible that an individual patient contributes more than one hospitalization to the database in any given year...
  • 9
  • 449
  • 0
TUBERCULOSIS PNEUMONIA AS A PRIMARY CAUSE OF RESPIRATORY FAILURE-REPORT OF TWO CASES pdf

TUBERCULOSIS PNEUMONIA AS A PRIMARY CAUSE OF RESPIRATORY FAILURE-REPORT OF TWO CASES pdf

Sức khỏe giới tính

... hospital stay was 111 days DISCUSSION Identification of the primary cause of respiratory distress is vital for the initiation of appropriate therapy Active pulmonary TB is a rare primary cause of ARF ... Identification of the primary cause of respiratory distress is vital for the initiation of appropriate therapy Active pulmonary TB is a rare primary cause of ARF and is associated with very high mortality ... Gradually in weeks he was able to maintain 90% oxygen saturation (SaO2) at room air Anti-tuberculosis therapy was continued and at 12 weeks he was maintaining oxygen saturation (SaO2) of 94% at...
  • 7
  • 352
  • 0
Báo cáo khoa học: Missense mutations as a cause of metachromatic leukodystrophy Degradation of arylsulfatase A in the endoplasmic reticulum potx

Báo cáo khoa học: Missense mutations as a cause of metachromatic leukodystrophy Degradation of arylsulfatase A in the endoplasmic reticulum potx

Báo cáo khoa học

... maturation of epitopes A2 and A5 After 25 of chase, precipitation with mAbs A2 and A5 is almost as efficient as with mAb B1 The location of epitopes suggests that folding of ASA starts within a ... experiments are unrelated to ASA and A5 , and amino acid residues 202–206 by mAb C, respectively For this reason the reduced reactivity of mAbs A2 and A5 with Gly86Asp and Arg84Gln substituted ASA and mAb ... the homogenates with the polyclonal ASA antiserum Precipitated ASA was quantified after SDS ⁄ PAGE with a bio-imaging analyser (Fujifilm) Columns show mean and SD of arbitrary units of quadruple experiments...
  • 10
  • 504
  • 0
Báo cáo Y học: A functional role of the membrane-proximal extracellular domains of the signal transducer gp130 in heterodimerization with the leukemia inhibitory factor receptor pot

Báo cáo Y học: A functional role of the membrane-proximal extracellular domains of the signal transducer gp130 in heterodimerization with the leukemia inhibitory factor receptor pot

Báo cáo khoa học

... C46 6A( sense) 5¢-GATAAA GCACCCGCTATCACAGACTGG-3¢; C46 6A( antisense) 5¢-CCAGTCTGTGATAGCGGGTGCTTTATCTG-3¢; C49 1A( sense) 5¢-GCAGAGAGCAAAGCCTATTTGAT AACAG-3¢ and C491(antisense) 5¢-TGTTATCAAATAG GCTTTGCTCTCTG-3¢ ... AGACTGGACACATGG-3¢ and 5¢-TCGGGCCATGGC ATGCCCGGGGGTCAGAGCTGGG-3¢ for amplification of D4 of GCSFR and 5¢-TACTCTCAAGAAATG CCCGGGTCCCATGCCCCAGAG-3¢ and 5¢-GCCCAG GATGATGTGTAGCTCCCCGGGCTCTGGGGTCAA GGT-3¢ for D6 of ... PCR reactions were: pSVL(sense) 5¢-GTGTTACTT CTGCTCT-3¢; pSVL(antisense) 5¢-TCTAGTTGTGGTT TGT-3¢; C45 8A( sense) 5¢-ATACTTGAGTGGGCTGTG TTATCAG-3¢; C45 8A( antisense) 5¢-ATCTGATAACAC AGCCCACTCAAGTAT-3¢;...
  • 11
  • 583
  • 0
Arthritis A leading cause of disability in the United States docx

Arthritis A leading cause of disability in the United States docx

Sức khỏe người cao tuổi

... AGE SOURCE: National Academy on an Aging Society analysis of data from the 1992 Health and Retirement Study and the 1993 study of Asset and Health Dynamics Among the Oldest Old A N A G I N G S ... 61 70+ AGE SOURCE: National Academy on an Aging Society analysis of data from the 1992 Health and Retirement Study and the 1993 study of Asset and Health Dynamics Among the Oldest Old s A lower ... conditions later in life The National Academy on an Aging Society is a Washingtonbased nonpartisan policy institute of The Gerontological Society of America The Academy studies the impact of demographic...
  • 6
  • 528
  • 0
báo cáo hóa học:

báo cáo hóa học:" Rupture of the ilio-psoas tendon after a total hip arthroplasty: an unusual cause of radio-lucency of the lesser trochanter simulating a malignancy" pot

Hóa học - Dầu khí

... neuropathies after total hip arthroplasty Acta Orthop Scand 1980, 51:531-4 19 Wooten SL, McLaughlin RE: Iliacus hematoma and subsequent femoral nerve palsy after penetration of the medical acetabular wall ... pelvis, and low demand of our patient, he was treated by physiotherapy and gait training At four years follow-up and almost 10 years after his THA, he still uses a cane for outdoor ambulation Otherwise ... Hamzaoglu A: Femoral nerve palsy due to iliacus hematoma occurred after primary total hip arthroplasty Arch Orthop Trauma Surg 2008, 128:657-60 18 Solheim LF, Hagen R: Femoral and sciatic neuropathies...
  • 5
  • 265
  • 0
báo cáo hóa học:

báo cáo hóa học:" Diagnostic challenge: bilateral infected lumbar facet cysts - a rare cause of acute lumbar spinal stenosis and back pain" pptx

Hóa học - Dầu khí

... this article as: Freedman et al.: Diagnostic challenge: bilateral infected lumbar facet cysts - a rare cause of acute lumbar spinal stenosis and back pain Journal of Orthopaedic Surgery and Research ... 95-100% of patients will have low back pain, as well [1,2,9] Facet sagittal orientation (> 45 degrees) and facet arthrosis are present in over 77% of patients with symptomatic lumbar facet cysts ... outcome Acta Neurochir (Wien) 2006, 148:47-54 10 Fujiwara A, Tamai K, An HS, Lim TH, Yoshida H, Kurihashi A, Saotome K: Orientation and osteoarthritis of the lumbar facet joint Clin Orthop Relat Res...
  • 5
  • 326
  • 0
Báo cáo y học:

Báo cáo y học: "Standards of evidence in chronobiology: critical review of a report that restoration of Bmal1 expression in the dorsomedial hypothalamus is sufficient to restore circadian food anticipatory rhythms in Bmal1-/- mice" pot

Báo cáo khoa học

... "Differential rescue of light- and food-entrainable circadian rhythms" Science 2008, 322:675 Moriya T, Aida R, Kudo T, Akiyama M, Doi M, Hayasaka N, Nakahata N, Mistlberger RE, Okamura H, Shibata S: ... that they have no competing interests Acknowledgements The authors wish to thank Drs Julie Pendergast, Shin Yamazaki, Wataru Nakamura and Takahiro Moriya for sharing unpublished data, and many ... before eating again Errors of these types are not mutually exclusive (e.g., some waveforms appear misaligned, and others exhibit characteristics of activity data rather than temperature data) These...
  • 13
  • 349
  • 0
Báo cáo y học:

Báo cáo y học: "A rare cause of forearm pain: anterior branch of the medial antebrachial cutaneous nerve injury: a case report" pdf

Báo cáo khoa học

... was detected which may cause MACN neuropathy As well as NSAI drug treatment, physical therapy of 15 days (TENS, ultrasound, ROM exercises) was applied to the patient The complaint of pain was ... in one of their cases was not isolated, but was assosiated with lesion of the median nerve, and that the reason for a second case with isolated MACN neuropathy was repeated minor trauma [8] In ... MACN which has developed due to repeated minor trauma Case presentation A 37-year-old woman patient who is a homemaker was accepted to our hospital with the complaint of a 10-day pain in her right...
  • 4
  • 349
  • 0
báo cáo khoa học:

báo cáo khoa học: " Implementing collaborative care for depression treatment in primary care: A cluster randomized evaluation of a quality improvement practice redesign" ppsx

Báo cáo khoa học

... which a PHQ-9 was administered Data analysis Randomized evaluation We weighted all analyses to control for potential enrollment bias based on age and gender using administrative data on the approached ... Healthcare System, Los Angeles, California, USA 3RAND Health Program, Santa Monica, California, USA 4David Geffen School of Medicine and School of Public Health, University of California Los Angeles, ... training and engagement approaches on a national basis [56] As it improved, the TIDES program became one of the bases for the Veterans Health Administration (VHA) Primary Care-Mental Health Integration(PCMHI)...
  • 15
  • 366
  • 0
báo cáo khoa học:

báo cáo khoa học: "Epidural varicosis as a possible cause of radicular pain: a case report" docx

Báo cáo khoa học

... embolism was found to be caused by hypoplasia of her inferior vena cava, with a bilateral occlusion of her vena iliaca communis A diagnostic evaluation showed that a collateral pathway with ectatic ... diagnosis of radicular complaints A review of the recent literature and the case of our patient shows that the presence of epidural varicosis, without also being aware of a vascular abnormality, ... spine simulating prolapse of an intervertebral disc A report of six cases Spine 2003, 1:E5-E12 Gümbel U, Pia HW, Vogelsang H: Lumbosacral vascular anomalies: cause of sciatica Acta Neurochir...
  • 3
  • 279
  • 0
báo cáo khoa học:

báo cáo khoa học: "Necrotizing sialometaplasia as a cause of a nonulcerated nodule in the hard palate: a case report" pot

Báo cáo khoa học

... Our patient was a dentist and had a history of palatal swelling that had appeared three weeks earlier and presented with stabbing pain in the absence of clinical alterations of the mucosa These ... affected area is rare [2-4] Necrotizing sialometaplasia mainly affects white men, with a male-to-female ratio of two to one The average age at diagnosis is 46 years [2,3], although the case of a two-year-old ... retromolar pad, lower lip, tongue, oral mucosa, mucobuccal fold, tonsillar fossa, nasal cavity, incisive canal, larynx, and trachea Involvement of the major salivary glands has been reported mainly after...
  • 3
  • 372
  • 0
báo cáo khoa học:

báo cáo khoa học: "Bacillus Calmette-Guérin-related cold thigh abscess as an unusual cause of thigh swelling in infants following BCG vaccine administration: a case series" doc

Báo cáo khoa học

... Ghattaura A, Eley KA, Molenaar E, Smith G: A case of ulcerating vasculitis following a BCG vaccination J Plas Reconstr Aesthet Surg 2007, 62(8): e286-289 Morita M, Nakamura H, Kitano T: Comparison ... Pediatrics, King Abdulaziz Medical City, King Saud bin Abdulaziz University for Health Sciences, Riyadh, Saudi Arabia Authors’ contributions OO and JA analyzed and interpreted the patient data SJ, SC, ... B vaccine and the vitamin K in a different room and at an another time Since that policy was implemented approximately three years ago, we have not had any similar cases The BCG vaccine is administered...
  • 4
  • 221
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "An unusual cause of chyluria after radiofrequency ablation of a renal cell carcinoma: a case report" docx

Báo cáo khoa học

... Cite this article as: Wah: An unusual cause of chyluria after radiofrequency ablation of a renal cell carcinoma: a case report Journal of Medical Case Reports 2011 5:307 Submit your next manuscript ... Gervais DA, McGovern FJ, Arellano RS, McDougal WS, Mueller PR: Radiofrequency ablation of renal cell carcinoma: part 1, Indications, results, and role in patient management over a 6-year period and ... around six months later (about two and a half years after the surgery), our patient underwent a CT scan of his abdomen and pelvis at his local hospital at the request of his local urologist A...
  • 3
  • 323
  • 0
Báo cáo y học:

Báo cáo y học: "Treatment of stasis dermatitis using aminaphtone: Blunt trauma as a suspected cause of delayed constrictive pericarditis: a case report." docx

Báo cáo khoa học

... echocardiogram showing dilated intrahepatic vein and inferior vena cava: (a, b) CT axial and coronal views of pericardial and pleural thickening Arrows point to areas of thickened pleura and pericardium ... differential diagnosis of CP The clinical diagnosis of CP relies primarily on appearance of edema and signs of cardiac insufficiency, such as dyspnea, upon physical examination Noninvasive CT scan and ... the diagnosis and management of pericardial diseases Executive summary: The task force on the diagnosis and management of pericardial diseases of the European Society of Cardiology Eur Heart J...
  • 5
  • 470
  • 0
báo cáo khoa học:

báo cáo khoa học: " A rare cause of chronic mesenteric ischemia from fibromuscular dysplasia: a case report" potx

Báo cáo khoa học

... perinuclear anti-neutrophil cytoplasmic antibodies (P-ANCA), cytoplasmic anti-neutrophil cytoplasmic antibodies (C-ANCA), antisaccharomyces antibody (ASCA), antinuclear antibody (ANA), celiac profile, ... infection, was also negative A pan-CT scan with contrast looking for malignancy of the abdomen, pelvis, chest and head were all negative A transvaginal ultrasound and pelvic examination ruled out an occult ... with significant atherosclerosis of the abdominal arteries causing postprandial abdominal pain out of proportion to physical examination [1] The abdominal pain is exacerbated after meals due to...
  • 9
  • 230
  • 0
báo cáo khoa học:

báo cáo khoa học: "Fulminant Leptospirosis (Weil’s disease) in an urban setting as an overlooked cause of multiorgan failure: a case report" pptx

Báo cáo khoa học

... lymphopenia of 2.4%, total bilirubin of 4.3 mg/dL, direct bilirubin of 2.6 mg/dL, alkaline phosphatase (ALP) of 143 U/L, aspartate aminotransferase (AST) of 201 U/L, alanine aminotransferase (ALT) of ... lungs Arterial blood gas on L of oxygen revealed a pH of 7.45, PCO2 (partial pressure of carbon dioxide) of 28, PO2 (partial pressure of oxygen) of 55, oxygen saturation of 90% and bicarbonate of ... phosphatase; ALT: alanine aminotransferase; AST: aspartate aminotransferase; CSF: cerebrospinal fluid; IV: intravenous; MAT: microscopic agglutination test; PCO2: partial pressure of carbon dioxide;...
  • 4
  • 276
  • 0
Báo cáo y học:

Báo cáo y học: "Acquired hemophilia as the cause of lifethreatening hemorrhage in a 94-year-old man: a case report" pot

Báo cáo khoa học

... with a ratio of patient’s plasma to normal plasma of 1:1) (Figure 1) Quantitative assays revealed a reduced level of factor VIII activity (1%) and the presence of factor VIII inhibitor measured at ... infusion of the second dose of intravenous aminocaproic acid Of note, our patient was initially admitted with a heart rate of 80 beats/minute and he had a first-degree AV block and left anterior fascicular ... of acquired hemophilia A remains unclear In approximately half of cases, factor VIII autoantibodies occur in patients without any identifiable cause, while the remaining cases may be associated...
  • 4
  • 496
  • 0

Xem thêm