a promising nanomodification technique

Báo cáo y học: "Endoscopic Facet Debridement for the treatment of facet arthritic pain – a novel new technique

Báo cáo y học: "Endoscopic Facet Debridement for the treatment of facet arthritic pain – a novel new technique

... Primary outcome measure was percent change in facet-related pain as measured by Visual Analog Scale (VAS) score at final follow-up visit. Secondary outcome was change in OSWESTRY disability index ... of fol- low-up was at least 3 years with a maximum of 6 years. Location of facet pain was cervical in 45, tho- racic in 15, and lumbar in 114 patients. Surgical times varied based on the number ... dorsal nerve medial branch, Staender et al. 17 reported a mean VAS pain score re- duction of 3.3 at six months follow-up; 40% of patients had relief for at least 12 months, and mean duration...

Ngày tải lên: 26/10/2012, 09:32

4 600 0
Tài liệu Lesson 30-A promising year of shipbuilding pdf

Tài liệu Lesson 30-A promising year of shipbuilding pdf

... Nam. Vinashin expects this figure to reach 60 per cent by 2010. Contract signing ceremony between Vinashin and Aalborg Denmark Vinashin also has plans to upgrade the Ha Long, Bach Dang, Ben ... Vinashin has maximised its limited State budget allocation to cut down on imports. Now, approximately 30-40 per cent of the equipment and materials used in the shipyards are made in Viet Nam. ... strategy to develop its techniques and technology by acquiring the latest software from advanced ship building countries like Poland, Japan and the Republic of Korea. In addition, the company...

Ngày tải lên: 13/12/2013, 21:15

3 632 0
Tài liệu Báo cáo khoa học: a-enolase: a promising therapeutic and diagnostic tumor target ppt

Tài liệu Báo cáo khoa học: a-enolase: a promising therapeutic and diagnostic tumor target ppt

... Zhao J, Chang AC, Li C, Shedden KA, Thomas DG, Misek DE, Manoharan AP, Giordano TJ, Beer DG & Lubman DM (2007) Comparative proteomics analysis of Barrett metaplasia and esophageal adenocarcinoma using ... strategici su tematiche di interesse regionale o sovra regionale (IMMONC), Ricerca Sanitaria Finalizzata, Ricerca Sanitaria Applicata; Ribovax Biotechnologies (Geneva, Switzerland) and Fondazione Italiana ... Miyazaki A, Nabeta Y, Hiroh- ashi Y, Kanaseki T, Yamaguchi A, Yamada N, Hiray- ama K, Suzuki M et al. (2002) Natural antigenic peptides from squamous cell carcinoma recognized by autologous HLA-DR8-restricted...

Ngày tải lên: 14/02/2014, 19:20

11 722 0
Tài liệu Carnivore Ecology and Conservation A Handbook of Techniques pptx

Tài liệu Carnivore Ecology and Conservation A Handbook of Techniques pptx

... within-stratum population variance. Although practical, such allocation of sampling units is clearly tentative and possibly far from being optimal (Manly 2004). Alternatively, a two- phase approach ensures a more adequate ... investigating mortality and diseases of carnivores, and explain clearly how researchers and managers without background in pathology can still collect samples and data allowing the most up-to-date analyses. Chapter ... to capture other animals (or the same animals) in the future. Kerry Foresman has handled a wide diversity of carnivores and teaches a course on making the most of having an animal in hand. Mark and...

Ngày tải lên: 17/02/2014, 17:20

508 585 1
Tài liệu BÁO CÁO " LIPID PRODUCTION FROM MICROALGAE AS A PROMISING CANDIDATE FOR BIODIESEL PRODUCTION " ppt

Tài liệu BÁO CÁO " LIPID PRODUCTION FROM MICROALGAE AS A PROMISING CANDIDATE FOR BIODIESEL PRODUCTION " ppt

... growth NITZS54 Nitzschia Bacillariop hyceae 8 1003 ASU3004 Amphora Bacillariop hyceae 9 593 FRAGI2 Fragilaria Bacillariop hyceae 6 304 AMPHO27 Amphora Bacillariop hyceae 38 235 ... studies are required for microalgae than, for example, tree farming. Also, microalgae grow much faster than higher plants and require much less land areas. However, the utilization of microalgae ... MAKARA, TEKNOLOGI, VOL. 13, NO. 1, APRIL 2009: 47-51 48 energy crops [6-7]. Microalgae systems also use far less water than traditional oilseed crops. For these reasons, microalgae are capable...

Ngày tải lên: 21/02/2014, 10:20

5 396 1
Tài liệu BÁO CÁO " LIPID PRODUCTION FROM MICROALGAE AS A PROMISING CANDIDATE FOR BIODIESEL PRODUCTION " docx

Tài liệu BÁO CÁO " LIPID PRODUCTION FROM MICROALGAE AS A PROMISING CANDIDATE FOR BIODIESEL PRODUCTION " docx

... NITZS54 Nitzschia Bacillariop hyceae 8 1003 ASU3004 Amphora Bacillariop hyceae 9 593 FRAGI2 Fragilaria Bacillariop hyceae 6 304 AMPHO27 Amphora Bacillariop hyceae 38 235 MAKARA, TEKNOLOGI, ... filter paper (Advantec filter paper, no. 1, Japan) in which two pieces of filter papers were applied twice to provide complete separation. The solvent phase was evaporated in a rotary evaporator ... increase from about 5 to 6.4 and constant around this value which was the same pH range as that using lower CO 2 flow rate. As the growth recovered at the same time during the gradual increase...

Ngày tải lên: 21/02/2014, 10:20

5 345 0
Carnivore Ecology and Conservation: A Handbook of Techniques pptx

Carnivore Ecology and Conservation: A Handbook of Techniques pptx

... design, and (4) rigorous application of appropriate field and analytical techniques. Rapid advances in technical and analytical capabilities cannot substitute for sound research planning. In fact, advanced ... the arctic, and including densely populated urban areas. Although we often associate carnivores with wilderness and remote areas, many have adapted to human-made habitats. Some stone martens (Martes ... investigating mortality and diseases of carnivores, and explain clearly how researchers and managers without background in pathology can still collect samples and data allowing the most up-to-date analyses. Chapter...

Ngày tải lên: 06/03/2014, 18:20

508 461 0
Báo cáo khoa học: Kinetic characterization of methionine c-lyases from the enteric protozoan parasite Entamoeba histolytica against physiological substrates and trifluoromethionine, a promising lead compound against amoebiasis ppt

Báo cáo khoa học: Kinetic characterization of methionine c-lyases from the enteric protozoan parasite Entamoeba histolytica against physiological substrates and trifluoromethionine, a promising lead compound against amoebiasis ppt

... Nakayama T, Esaki N, Tanaka H & Soda K (1988) Chemical modification of cyseine residues of L-methio- nine c-lyase. Agric Biol Chem 52, 177–183. 38 Nakayama T, Esaki N, Tanaka H & Soda ... [10], and Porphyromonas gingivalis [11], parasitic protozoa such as Trichomonas vaginalis [12] and Entamoeba histolytica [13], and the plant Arabidopsis thaliana [14]. MGL has been implicated ... 953–960. 5 Tanaka H, Esaki N & Soda K (1985) A versatile bacte- rial enzyme: L-methionine c-lyase. Enzyme Microb Technol 7, 530–537. 6 Nakayama T, Esaki N, Sugie K, Beresov TT, Tanaka H & Soda...

Ngày tải lên: 07/03/2014, 05:20

13 406 0
Báo cáo khoa học: The proximity between C-termini of dimeric vacuolar H+-pyrophosphatase determined using atomic force microscopy and a gold nanoparticle technique ppt

Báo cáo khoa học: The proximity between C-termini of dimeric vacuolar H+-pyrophosphatase determined using atomic force microscopy and a gold nanoparticle technique ppt

... P his (5¢-CCTCG AGCCATCATCATCATCATCATTAGGGCCGCATCAT GTAATTAGTTATGT-3¢) and P MluI (5¢-GTACACGCG TCTGATCAG-3¢) were inserted into the 3¢-end of the pYES2–VPP plasmid to generate the V-PPase–(His) 6 tail. The ... Today 16, 85–90. 32 Takasu A, Nakanishi Y, Yamauchi T & Maeshima M (1997) Analysis of the substrate binding site and car- boxyl terminal region of vacuolar H + -pyrophosphatase of mung bean ... imaging. AFM AFM was performed in the contact mode using a Nano- scope IIIa Multimode atomic force microscope equipped with an E-type scanner (Digital Instruments, Santa Bar- bara, CA, USA) and...

Ngày tải lên: 16/03/2014, 02:20

14 332 0
A study on technique to improve speaking skill for secondary student in Quang Ninh.

A study on technique to improve speaking skill for secondary student in Quang Ninh.

... school on a spacious standard. In the last ten years the school has being maintained traditional “teaching well and learning well", and got achievements also awarded from many certificates ... CHAPTER 2: DATA COLECTIONS AND ANALYSIS This chapter aims at showing the attitudes and the expectations of Cam Cam Son Secondary students in Quang Ninh towards teaching English speaking ... interactive, and  Non-interactive. Interactive speaking situations include face-to-face conversations and telephone calls, in which we are alternately listening and speaking, and in which we have a...

Ngày tải lên: 19/03/2014, 17:07

73 1,7K 15
A study on techniques to learn English idioms and proverbs

A study on techniques to learn English idioms and proverbs

... as a feather / air As loud as thunder As mute as a fish As old as the hills As pretty as a picture As quick as lightning As red as fire / blood / a cherry / a rose As sour as vinegar As ... defeat the strongest army. 34 As different as chalk from cheese As dry as a bone / a stick / dust As dumb as a fish As fierce as a tiger As green as grass As hot as fire As light as ... comparison with the structure “be + as as ”: As black as the Ace of Spades / soot / coal / midnight As bold as brass / a coot / a lion As bright as silver / noonday / day As changeable as...

Ngày tải lên: 21/03/2014, 09:17

105 628 1
Social Impact Bonds - A promising new financing model to accelerate social innovation and improve government performance pot

Social Impact Bonds - A promising new financing model to accelerate social innovation and improve government performance pot

... treatment population • A reliable comparison group or counterfactual • Safeguards against harming treatment populations Let’s take these criteria one at a time and see what implications they have for ... population Most social impact bond applications will nd it easier to evaluate a program’s impact and design a performance contract if the targeted population can be clearly dened in such a way that it ... social impact bond model, traditional appropriations statutes are not a good t. Appropriations laws usually make funds available for only a one- or two-year period, 24 Center for American...

Ngày tải lên: 22/03/2014, 20:20

36 421 0
Báo cáo khoa học: Kinetic hybrid models composed of mechanistic and simplified enzymatic rate laws – a promising method for speeding up the kinetic modelling of complex metabolic networks pptx

Báo cáo khoa học: Kinetic hybrid models composed of mechanistic and simplified enzymatic rate laws – a promising method for speeding up the kinetic modelling of complex metabolic networks pptx

... The load charac- teristics were calculated by varying a load parameter within a preset range of physiologically reasonable values. For each value of the load parameter, the steady state was computed ... increased value of k ATPase as compared to the value k 0 ATPase ¼ 1:6h À1 . At values of k ATPase exceeding seven-fold of its normal value, no stationary states can be found; that is, k max ATPase ¼ ... physiologically feasible ranges: 1 2 k 0 ATPase k ATPase 2k 0 ATPase (small variation of the energetic load) 1 5 k 0 ATPase k ATPase 5k 0 ATPase (large variation of the energetic load) 1 50 k 0 ox ...

Ngày tải lên: 23/03/2014, 06:20

15 456 0
A study on techniques to improve English vocabulary for 3th graders at Quang Trung primary school in Hai Phong

A study on techniques to improve English vocabulary for 3th graders at Quang Trung primary school in Hai Phong

... 2 HAIPHONG PRIVATE UNIVESITY FOREIGN LANGUAGES DEPARTMENT GRADUATION PAFER A STUDY ON TECHNIQUES TO IMPROVE ENGLISH VOCABULARY FOR 3TH GRADERS AT QUANG TRUNG PRIMARY SCHOOL ... GRADERS AT QUANG TRUNG PRIMARY SCHOOL IN HAI PHONG By: ĐỖ THỊ TRANG Class: NA 1202 Supervisor: NGUYỄN THỊ HUYỀN,MA HAI PHONG - 2012 3 BỘ GIÁO DỤC VÀ ĐÀO TẠO ... thiết kế, tính toán. ………………………………………………………………………… … ………………………………………………………………………… … 2. Đ a điểm thực tập tốt nghiệp. ………………………………………………………………………… … ………………………………………………………………………… … 1...

Ngày tải lên: 26/03/2014, 00:16

114 1,1K 2

Bạn có muốn tìm thêm với từ khóa:

w