a shiftreduce parsing technique

... mentioned above is generated automatically from a context-free grammar by the standard al- gorithm [Aho and Johnson, 1974]. The parsing alogrithm differs, however, from the standard LALR(1) parsing ... Disambiguation by a Shift-Reduce Parsing Technique* Stuart M. Shieber Abstract Artificial Intelligence Center SRI International 333 Ravenswood Avenue Menlo Park, CA 94025 Native speakers ... The woman wanted the dresm on that rock. has low attachment of the PP, whereas The tnoman positioned the dreu on that rack. has high attachment. Garden-Path Sentences Grammatical sentences...

Ngày tải lên: 21/02/2014, 20:20

Ngày tải lên: 06/07/2014, 15:21

Ngày tải lên: 06/07/2014, 15:23

... Primary outcome measure was percent change in facet-related pain as measured by Visual Analog Scale (VAS) score at final follow-up visit. Secondary outcome was change in OSWESTRY disability index ... of fol- low-up was at least 3 years with a maximum of 6 years. Location of facet pain was cervical in 45, tho- racic in 15, and lumbar in 114 patients. Surgical times varied based on the number ... dorsal nerve medial branch, Staender et al. 17 reported a mean VAS pain score re- duction of 3.3 at six months follow-up; 40% of patients had relief for at least 12 months, and mean duration...

Ngày tải lên: 26/10/2012, 09:32

Ngày tải lên: 11/12/2013, 23:53

Ngày tải lên: 11/12/2013, 23:53

Ngày tải lên: 14/12/2013, 16:45

... within-stratum population variance. Although practical, such allocation of sampling units is clearly tentative and possibly far from being optimal (Manly 2004). Alternatively, a two- phase approach ensures a more adequate ... investigating mortality and diseases of carnivores, and explain clearly how researchers and managers without background in pathology can still collect samples and data allowing the most up-to-date analyses. Chapter ... to capture other animals (or the same animals) in the future. Kerry Foresman has handled a wide diversity of carnivores and teaches a course on making the most of having an animal in hand. Mark and...

Ngày tải lên: 17/02/2014, 17:20

... design, and (4) rigorous application of appropriate field and analytical techniques. Rapid advances in technical and analytical capabilities cannot substitute for sound research planning. In fact, advanced ... the arctic, and including densely populated urban areas. Although we often associate carnivores with wilderness and remote areas, many have adapted to human-made habitats. Some stone martens (Martes ... investigating mortality and diseases of carnivores, and explain clearly how researchers and managers without background in pathology can still collect samples and data allowing the most up-to-date analyses. Chapter...

Ngày tải lên: 06/03/2014, 18:20

... P his (5¢-CCTCG AGCCATCATCATCATCATCATTAGGGCCGCATCAT GTAATTAGTTATGT-3¢) and P MluI (5¢-GTACACGCG TCTGATCAG-3¢) were inserted into the 3¢-end of the pYES2–VPP plasmid to generate the V-PPase–(His) 6 tail. The ... Today 16, 85–90. 32 Takasu A, Nakanishi Y, Yamauchi T & Maeshima M (1997) Analysis of the substrate binding site and car- boxyl terminal region of vacuolar H + -pyrophosphatase of mung bean ... imaging. AFM AFM was performed in the contact mode using a Nano- scope IIIa Multimode atomic force microscope equipped with an E-type scanner (Digital Instruments, Santa Bar- bara, CA, USA) and...

Ngày tải lên: 16/03/2014, 02:20

... school on a spacious standard. In the last ten years the school has being maintained traditional “teaching well and learning well", and got achievements also awarded from many certificates ... CHAPTER 2: DATA COLECTIONS AND ANALYSIS This chapter aims at showing the attitudes and the expectations of Cam Cam Son Secondary students in Quang Ninh towards teaching English speaking ... interactive, and  Non-interactive. Interactive speaking situations include face-to-face conversations and telephone calls, in which we are alternately listening and speaking, and in which we have a...

Ngày tải lên: 19/03/2014, 17:07

... as a feather / air As loud as thunder As mute as a fish As old as the hills As pretty as a picture As quick as lightning As red as fire / blood / a cherry / a rose As sour as vinegar As ... defeat the strongest army. 34 As different as chalk from cheese As dry as a bone / a stick / dust As dumb as a fish As fierce as a tiger As green as grass As hot as fire As light as ... comparison with the structure “be + as as ”: As black as the Ace of Spades / soot / coal / midnight As bold as brass / a coot / a lion As bright as silver / noonday / day As changeable as...

Ngày tải lên: 21/03/2014, 09:17

... 2 HAIPHONG PRIVATE UNIVESITY FOREIGN LANGUAGES DEPARTMENT GRADUATION PAFER A STUDY ON TECHNIQUES TO IMPROVE ENGLISH VOCABULARY FOR 3TH GRADERS AT QUANG TRUNG PRIMARY SCHOOL ... GRADERS AT QUANG TRUNG PRIMARY SCHOOL IN HAI PHONG By: ĐỖ THỊ TRANG Class: NA 1202 Supervisor: NGUYỄN THỊ HUYỀN,MA HAI PHONG - 2012 3 BỘ GIÁO DỤC VÀ ĐÀO TẠO ... thiết kế, tính toán. ………………………………………………………………………… … ………………………………………………………………………… … 2. Đ a điểm thực tập tốt nghiệp. ………………………………………………………………………… … ………………………………………………………………………… … 1...

Ngày tải lên: 26/03/2014, 00:16

...

Ngày tải lên: 28/03/2014, 15:20

... Repeated attempts at stain removal should be avoided to prevent tooth damage. 57 puncta of the parotid and zygomatic salivary glands open almost adjacent to the maxillary carnassial (PM4) and molar ... palatal to the maxillary central incisors and should not be mistaken for a tumour. Figure 1.45 The puncta of the mandibular and sub-lingual salivary glands are situated lateral to the lingual frenulum. ... contra-angle polishing attach- ment must be oiled on a regular basis for optimum function. The small flange at the base of the snap-on button may accumulate material, including hair. This material...

Ngày tải lên: 29/03/2014, 11:20

... Language Technology, Dublin City University, Ireland. As with PP attachment, most previous attempts at tackling coordination as a subproblem of parsing have treated it as a separate task to parsing ... outlined above can be detected automatically by simple pat- tern matching. Automatically eliminating such ex- amples is a simple method of cleaning the data. 7 Experimental Evaluation We use a parsing ... non-terminal labels and head word part-of- speech tags for levels 0, 1 and 2. Learning a bias toward parallelism in conjuncts should improve the parsing model’s ability to correctly attach a coordi- nation...

Ngày tải lên: 31/03/2014, 01:20

...

Ngày tải lên: 08/04/2014, 11:19

... has substantial physical, emotional and social costs [2]. Appropriate treatment of spasticity would therefore have many benefits. Since spasticity is manifested as a mechanical abnormality, to evaluate ... the manuscript. DC referred the patients and participated in interpreting data, and WZR participated in interpreting data and writing the manuscript. All authors read and approved the final manu- script. Acknowledgements We ... that the actions of the agent are mediated, at least in part, at interneuronal sites [21,22], and not just at motoneuron synapses. Tizanidine actions are believed to be mediated via the restoration...

Ngày tải lên: 19/06/2014, 08:20

... graph presented an abnormal shape (stage C in Figure 6b). Inspecting the bone, a small fracture was observed and the hammering was stopped. Case 3 An oscillating behaviour of the FRF graph was ... fixed and quasi- well fixed femoral stems [20]. This paper presents a series of cases where a per-operative vibration analysis technique was used for the mechanical characterization of the primary ... Multiple critical iterations on the initial manuscript were a joint effort of all authors. All authors read and approved the final man- uscript. Appendix The intra-operatively manufactured prosthesis In...

Ngày tải lên: 20/06/2014, 01:20

Ngày tải lên: 20/06/2014, 04:20