sentence disambiguation by a shiftreduce parsing technique

Tài liệu Báo cáo khoa học: "Sentence Disambiguation by a Shift-Reduce Parsing Technique" pot

Tài liệu Báo cáo khoa học: "Sentence Disambiguation by a Shift-Reduce Parsing Technique" pot

... mentioned above is generated automatically from a context-free grammar by the standard al- gorithm [Aho and Johnson, 1974]. The parsing alogrithm differs, however, from the standard LALR(1) parsing ... Sentence Disambiguation by a Shift-Reduce Parsing Technique* Stuart M. Shieber Abstract Artificial Intelligence Center SRI International 333 Ravenswood Avenue Menlo Park, CA 94025 Native speakers ... The woman wanted the dresm on that rock. has low attachment of the PP, whereas The tnoman positioned the dreu on that rack. has high attachment. Garden-Path Sentences Grammatical sentences...

Ngày tải lên: 21/02/2014, 20:20

6 396 0
Báo cáo khoa học: "Coordinate Noun Phrase Disambiguation in a Generative Parsing Model" doc

Báo cáo khoa học: "Coordinate Noun Phrase Disambiguation in a Generative Parsing Model" doc

... Language Technology, Dublin City University, Ireland. As with PP attachment, most previous attempts at tackling coordination as a subproblem of parsing have treated it as a separate task to parsing ... outlined above can be detected automatically by simple pat- tern matching. Automatically eliminating such ex- amples is a simple method of cleaning the data. 7 Experimental Evaluation We use a parsing ... separate coordination dis- ambiguation from the overall parsing task, our ap- proach resembles the efforts to improve coordi- nation disambiguation in (Kurohashi, 1994; Rat- naparkhi, 1994; Charniak...

Ngày tải lên: 31/03/2014, 01:20

8 361 0
Báo cáo khoa học: Ternary complex formation of pVHL, elongin B and elongin C visualized in living cells by a fluorescence resonance energy transfer–fluorescence lifetime imaging microscopy technique docx

Báo cáo khoa học: Ternary complex formation of pVHL, elongin B and elongin C visualized in living cells by a fluorescence resonance energy transfer–fluorescence lifetime imaging microscopy technique docx

... 5¢-CTAGACCA CCATGGAGGAACAGAAGCTGATCAGTGAGGAAG ACCTGGATATCCCGGGTTAACT-3¢ and 5¢-CTAGAG TTAACCCGGGATATCCAGGTCTTCCTC ACTGATCA GCTTCTGTTCCTCCATGGTGGT-3¢, and 5¢-CTAGAC CACCATGGACTACAAAGACGATGACGATAAAGAT ATCCCGGGTTAACT-3¢ ... C was changed to GGA by using primers 5¢-CCCAAGC TTATGGATGGAGGAGGAGAAAAC-3¢ and 5¢-ACGT ACCGGTCCACAATCTAGGAAGTTTGCAGC-3¢. After digestion of the PCR fragment by EcoRI and AgeI, the fragment was ... pcerulean-N1. pBOS-HA was constructed by insertion of the annealed fragment of the synthesized oligonucleotides, 5¢-CTAGAC CACCATGTACCCCTACGACGTGCCCGACTACGCCG ATATCCCGGGTTAACT-3¢ and 5¢-CTAGAGTTAACC CGGGATATCGGCGTAGTCGGGCACGTCGTAGGGG TACATGGTGGT-3¢,...

Ngày tải lên: 16/03/2014, 05:20

9 421 0
Báo cáo hóa học: " Nanostructured Hypoeutectic Fe-B Alloy Prepared by a Self-propagating High Temperature Synthesis Combining a Rapid Cooling Technique" ppt

Báo cáo hóa học: " Nanostructured Hypoeutectic Fe-B Alloy Prepared by a Self-propagating High Temperature Synthesis Combining a Rapid Cooling Technique" ppt

... Then combustion wave of the reaction propagates from top to bottom of the reactant compact, and the reactants transform to the Fe-B alloy and Al 2 O 3 where the combustion wave has passed. The adiabatic ... shear bands typical for plastic deformation behavior: (a) fracture surface; (b) zone I high magnification; (c) and (d) depicting the shear bands origination or propagation from dendrite Nanoscale ... igniter was started when the reactor reached 260 °C, which results in an instantaneous release of a large amount of heat that ignites the aluminothermic reaction and the synthesis reaction was subsequently...

Ngày tải lên: 22/06/2014, 01:20

6 260 0
Báo cáo y học: "Spontaneous Hemoperitoneum Caused By a Diverticulum of the Sigmoid Colon"

Báo cáo y học: "Spontaneous Hemoperitoneum Caused By a Diverticulum of the Sigmoid Colon"

... of a monolayer of inner circular muscle, which makes its wall weak, as com- pared to the small intestine that is formed of the inner circular and outer longitudinal muscle layers. The vasa ... invagination of diverticu- lum has an advantage over diverticulectomy in that it minimizes bowel leakage [15]. Moreover, invagina- tion of diverticulum can be easily performed using laparoscopy ... preparation. The bleeding was controlled by #3-0 Vycryl intracorporeal suture, and the invagination of the diverticulum was performed laparoscopically. The recovery was une- ventful, and the...

Ngày tải lên: 25/10/2012, 10:51

3 532 0
Báo cáo y học: "Endoscopic Facet Debridement for the treatment of facet arthritic pain – a novel new technique

Báo cáo y học: "Endoscopic Facet Debridement for the treatment of facet arthritic pain – a novel new technique

... Primary outcome measure was percent change in facet-related pain as measured by Visual Analog Scale (VAS) score at final follow-up visit. Secondary outcome was change in OSWESTRY disability index ... of fol- low-up was at least 3 years with a maximum of 6 years. Location of facet pain was cervical in 45, tho- racic in 15, and lumbar in 114 patients. Surgical times varied based on the number ... dorsal nerve medial branch, Staender et al. 17 reported a mean VAS pain score re- duction of 3.3 at six months follow-up; 40% of patients had relief for at least 12 months, and mean duration...

Ngày tải lên: 26/10/2012, 09:32

4 600 0
Báo cáo y học: "Cell Cycle Arrest by a Natural Product via G2/M Checkpoint"

Báo cáo y học: "Cell Cycle Arrest by a Natural Product via G2/M Checkpoint"

... 35.4 Events Events Events Events Events Events Events Events Events PI-Area (control) PI-Area (control) PI-Area (control) PI-Area (5%) PI-Area (5%) PI-Area (10%) PI-Area (10%) PI-Area (10%) PI-Area (15%) 10 0 10 1 10 2 10 3 PI-Area (15%) 0 512 Events PI-Area ... Cignetti A, Rovera G, Foa R. Retroviral vector-mediated transfer of the tumour necrosis factor alpha gene into human cancer cells restores an apoptotic cell death program and induces a bystander-killing ... Introduction Pharmaceutical research of traditional Chinese medicines on cancer prevention and treatment has attracted much attention. There are a number of herbs that have shown to have the abilities...

Ngày tải lên: 02/11/2012, 11:12

6 319 0
Divided by a Common Language

Divided by a Common Language

Ngày tải lên: 08/12/2013, 11:59

261 278 1
Tài liệu Central bank governance and financial stability: A report by a Study Group doc

Tài liệu Central bank governance and financial stability: A report by a Study Group doc

... three analytical toolkits (macroeconomic, macronancial and micronancial), recent central banking history suggests that macroprudential analysis is not automatically “natural” to those engaged ... achievable have been shaped more by objectives than by an appraisal of what is realistically achievable given the instruments available. 10 Harsh ex post accountability creates a threat to future ... functioning) and “nancial system” (eg nancial institutions, markets and infrastructure) are allowed for. 8 Bank Negara Malaysia created a Financial Stability Executive Committee in 2009, and the Bank...

Ngày tải lên: 16/02/2014, 10:20

91 725 0
Tài liệu Carnivore Ecology and Conservation A Handbook of Techniques pptx

Tài liệu Carnivore Ecology and Conservation A Handbook of Techniques pptx

... variability, caused by temporal fluctuations and spatial hetero- geneity in a given population attribute, and system variability , caused by a combi- nation of among-unit variation (if not all sampling ... within-stratum population variance. Although practical, such allocation of sampling units is clearly tentative and possibly far from being optimal (Manly 2004). Alternatively, a two- phase approach ensures a more adequate ... investigating mortality and diseases of carnivores, and explain clearly how researchers and managers without background in pathology can still collect samples and data allowing the most up-to-date analyses. Chapter...

Ngày tải lên: 17/02/2014, 17:20

508 585 1
Tài liệu Báo cáo khoa học: Efficient killing of SW480 colon carcinoma cells by a signal transducer and activator of transcription (STAT) 3 hairpin decoy oligodeoxynucleotide – interference with interferon-c-STAT1-mediated killing pdf

Tài liệu Báo cáo khoa học: Efficient killing of SW480 colon carcinoma cells by a signal transducer and activator of transcription (STAT) 3 hairpin decoy oligodeoxynucleotide – interference with interferon-c-STAT1-mediated killing pdf

... kinases participates in growth regulation of human breast carcinoma cells. Oncogene 20, 2499–2513. 9 Kanda N, Seno H, Konda Y, Marusawa H, Kanai M, Nakajima T, Kawashima T, Nanakin A, Sawabu ... (2006) Stattic: a small-molecule inhibitor of STAT3 activation and dimerization. Chem Biol 13, 1235–1242. 30 Laguillier C, Hbibi AT, Baran-Marszak F, Metelev V, Cao A, Cymbalista F, Bogdanov A Jr & Fagard ... 1183–1191. 20 Tomita T, Takano H, Tomita N, Morishita R, Kaneko M, Shi K, Takahi K, Nakase T, Kaneda Y, Yoshikawa H et al. (2000) Transcription factor decoy for NFkappaB inhibits cytokine and adhesion...

Ngày tải lên: 18/02/2014, 08:20

11 558 0

Bạn có muốn tìm thêm với từ khóa:

w