a mechanism for knowledge interface
Báo cáo y học: "Differential expression, function and response to inflammatory stimuli of 11β-hydroxysteroid dehydrogenase type 1 in human fibroblasts: a mechanism for tissue-specific regulation of inflammation" pps
... Probes and primer sequences used Gene Primers and probes 11β-HSD1 Forward primer: AGGAAAGCTCATGGGAGGACTAG Reverse primer: ATGGTGAATATCATCATGAAAAAGATTC Probe: CATGCTCATTCTCAACCACATCACCAACA H6PDH Forward ... H6PDH Forward primer: CAGGTGTCCTAGTGCACATTGAC Reverse primer: GTAGCCCACTCTCTCGTCCAA Probe: AAGGCACGCCCTCCCAGCG GRα Forward primer: GCGATGGTCTCAGAAACCAAAC Reverse primer: GAGATTACAGAGGAAGTTATCCTCTGC ... Probe: TGCAGTGAAGGTTGCTGAGGCTCTGA GRβ Forward primer: AAC TGG CAG CGG TTT TAT CAA CT Reverse primer: AACTCTTGGATTCTATGCATGAAAATGTTA TGTGGTTA Probe: TGT GTG AGA TGT GCT TTC TGG TT C/EBPα Forward primer:...
- 10
- 438
- 0
Báo cáo y học: "Decreased metalloproteinase production as a response to mechanical pressure in human cartilage: a mechanism for homeostatic regulatio" pps
... cartilage Ratio II collagen in OF and OA cartilage of aggrecan to type II collagen in the cartilage matrix of OA and OF femoral heads and comparison between areas (SP and IP) Aggrecan and type ... proteoglycan extraction and was quantified by Bradford method Separated maximum (SP) and minimum (IP) mechanical load areas were obtained from each femoral head The horizontal bar indicates the median, ... protein analysis The cartilage used for RNA quantification was diced and incubated with RNAlater (Qiagen Inc., Valencia, CA, USA) overnight at 4°C prior to storage Available online http://arthritis-research.com/content/8/5/R149...
- 11
- 520
- 0
Knowledge Management as a Catalyst for Innovation within Organizations: A Qualitative Study
... the organizational boundaries, leading to increased innovative partnerships and alliances (Nonaka and Takeuchi, 1995) If organizations are to systematically disseminate new knowledge to achieve ... driven) and organizations are forced to have `ceaseless innovation' (Demerest, 1997) Innovation is not a `one act drama but an ongoing process' (Nonaka and Takeuchi, 1995) Innovative organizational ... `The tacit knowledge is the in¯uential knowledge that will make dynamic organizations.' Figure Research methodolgy Knowledge Management as a Catalyst for Innovation Such a view is similar to that...
- 9
- 498
- 2
Tài liệu INDIGENOUS KNOWLEDGE FOR DEVELOPMENT: A FRAMEWORK FOR ACTION pptx
... IK Application: Transfer of the Washambaa agricultural system to Rwanda adaptation and re-transfer The Washambaa of the Usambara Mountains in Tanzania had developed a land use system emulating ... lessons for the development process: Application: Transfer of the Washambaa agricultural system to Rwanda, adaptation, and re-transfer The Washambaa of the Usambara Mountains in Tanzania had developed ... participatory approaches are available for manual and computer use prepared by IIRR and CIKARD § case studies are available but could be packaged in a more user-friendly form § limited availability...
- 49
- 492
- 0
Tài liệu Báo cáo khoa học: Metabolic control of mitochondrial properties by adenine nucleotide translocator determines palmitoyl-CoA effects Implications for a mechanism linking obesity and type 2 diabetes pdf
... experimentally, as we used P1,P5-di(adenosine-5¢)-pentaphosphate (Ap 5A) as inhibitor of adenylate kinase to prevent depletion of available ATP and ADP and to maintain steady-state respiration Instead, ... the ATPtotal ⁄ ADPtotal ratio reflect changes in the ATPout ⁄ ADPout ratio Palmitoyl-CoA caused a significant concentration-dependent decrease in the ATPtotal ⁄ ADPtotal ratio and increase in [AMP]total, ... (Supplementary material, Table S2) and steady-state fluxes (Table and [16] for glutamate plus malate and succinate, respectively) Values are mean ± SEM from three (succinate) or four (glutamate plus malate)...
- 15
- 546
- 0
Tài liệu Báo cáo khoa học: A role for the intersubunit disulfides of seminal RNase in the mechanism of its antitumor action docx
... proteins extracted from plasma membranes and membrane pellets were then analyzed by SDS/PAGE and autoradiography Figure shows that after incubation with labelled MSSAE, membranes contained radioactive ... Fig Autoradiography of SDS/PAGE runs of the labelled monomeric derivative of BS-RNase 125I-labelled MSSAE incubated with plasma membranes (PM) from SVT2 cells Lane 1, plasma membranes treated for ... dellUniversita e della Ricerca (Progetti di Rilevante Interesse Nazionale 2001) and Consorzio Interuniversitario Biotecnologie Aurora Bracale was supported by a fellowship from Fondazione Italiana per la...
- 8
- 604
- 0
Tài liệu Báo cáo khoa học: "A COMPUTATIONAL MECHANISM FOR PRONOMINAL REFERENCE" pot
... Scha and Stallard (1988)) The structural semantics stage operates on the parse tree to produce an expression of a language called "EFL" (for English-oriented Formal Language) This language is a ... cases Roughly speaking, these are examples similar to backwards pronominalization cases such as (18) (repeated here as (2 7a) ), in which the potential antecedent is a quantifier or a trace of a ... those that are internal to the current minimal domain and those that are external As each node is processed, a subroutine is called that dispatches on the category of the node and performs any actions...
- 10
- 513
- 0
Tài liệu Báo cáo khoa học: "A text-based search interface for Multimedia Dialectics" ppt
... cross-lingual information resources for automatically expanding and generalising the data (semantic relations) one can mine from the corpus Figure 1: The COSMOROE cross-media relations For annotating a ... offsets Also, the user may watch the video clips of the modalities that participate in the relation (e.g a particular gesture) and/or a static image (keyframe) of a participating image region (e.g a ... Further details on the hit, i.e information an advanced user would get, are available following the advanceinformation link The use of semantic relations in multimedia data, in this case, is hidden...
- 4
- 294
- 0
A Survey on Network Security and Attack Defense Mechanism For Wireless Sensor Networks pdf
... steam or the creation of a false stream in a WSN Mote-class versus laptop-class attacks: In moteclass (sensor-class) attacks, an adversary attacks a WSN by using a few nodes with similar capabilities ... ways The inside attacker may have partial key material and the trust of other sensor nodes Inside attacks are much harder to detect External attacks may cause passive eavesdropping on data transmissions, ... antenna and hence they can affect much more than an attacker with only ordinary sensor nodes A single laptop-class attacker might be able to eavesdrop on an entire network Availability is an assurance...
- 9
- 676
- 0
Báo cáo khoa học: The benzophenanthridine alkaloid sanguinarine perturbs microtubule assembly dynamics through tubulin binding A possible mechanism for its antiproliferative activity Manu Lopus and Dulal Panda docx
... (13-methyl-[1,3]-benzodioxolo[5,6-c]1,3-dioxolo-[4,5-i]-phenanthridinium chloride) (Fig 1), a benzophenanthridine alkaloid derived from the plant Sanguinaria canadensis, has been shown to have antimicrobial, anti-inflammatory, antioxidant, and anticancer ... sanguinarine in immortalized human HaCaT keratinocytes Clin Cancer Res 9, 3176–3182 Adhami VM, Aziz MH, Reagan-Shaw SR, Nihal M, Mukhtar H & Ahmad N (2004) Sanguinarine causes cell cycle blockade and ... cells via bimodal cell death Biochem Pharmacol 63, 1415–1421 Adhami VM, Aziz MH, Mukhtar H & Ahmad N (2003) Activation of prodeath Bcl-2 family proteins and mitochondrial apoptosis pathway by sanguinarine...
- 12
- 429
- 0
A Scalable and Explicit Event Delivery Mechanism for UNIX doc
... A scalable and explicit event delivery mechanism for UNIX Gaurav Banga gaurav@netapp.com Network Appliance Inc., 2770 San Tomas Expressway, Santa Clara, CA 95051 Jeffrey C Mogul mogul@pa.dec.com ... the application reads just a portion of this data, and then calls select() again before more data arrives, select() will again report that the descriptor is ready for reading The state-based approach ... indicating which file descriptors are available for I/O A member of the readfds set is available if there is any available input data; a member of writefds is considered writable if the available...
- 14
- 453
- 0
Báo cáo khoa học: Complexes of Thermoactinomyces vulgaris R-47 a-amylase 1 and pullulan model oligossacharides provide new insight into the mechanism for recognizing substrates with a-(1,6) glycosidic linkages docx
... A, Ohtaki A, Kaji A, Tonozuka T & Sakano Y (2002) Crystal structures of Thermoactino˚ myces vulgaris R-47 a- amylase (TVA I) at 1.6 A reso˚ resolution lution and a- amylase (TVA II) at 2.3 A J Mol ... Henrissat B (1991) A classification of glycosyl hydrases based on amino acid sequence similarities Biochem J 280, 309–316 Tonozuka T, Mogi S, Shimura Y, Ibuka A, Sakai H, Matsuzawa H, Sakano Y & Ohta ... Tonozuka T, Matsuzawa H & Sakai H (1998) Conversion of neopullulanase -a- amylase from Thermoactinomyces vulgaris R-47 into an amylopullulanase-type enzyme J Biochem 123, 275–282 Kamitori S, Abe A, ...
- 9
- 342
- 0
A new mechanism for modulation of schottky barrier heights on silicon nanowires
... and drain and the silicon substrate as a back-gate, a transistor configuration can be defined as shown in Fig 5 (a) Transfer characteristics at different temperatures for a constant drain voltage ... surface concentration taking this depth as a reasonable value for substantial tunneling This gives an energy lowering similar to the experimental data as given in Ref [10] Schottky barriers at nanowire ... The values in regime A are found in the range of 0.15 eV, while regime B has a sharp maximum at 0.55 eV and regime C again decreases the activation energy to about 0.25 eV All these values are...
- 5
- 398
- 0
Báo cáo khoa học: Kinetic mechanism for p38 MAP kinase a A partial rapid-equilibrium random-order ternary-complex mechanism for the phosphorylation of a protein substrate potx
... EÆMgATP complex is not a deadend complex with respect to the binding and phos4633 Kinetic mechanism for p38 MAP kinase a A E Szafranska and K N Dalby Fig Preparation of activated p38 MAPKa and ATF2D115 ... proposal of LoGrasso et al was challenged in a report that FEBS Journal 272 (2005) 4631–4645 ª 2005 FEBS A E Szafranska and K N Dalby Kinetic mechanism for p38 MAP kinase a mechanism We also show ... overexpressed, activated and purified In our case a sensitive tryptic analysis indicates that the enzyme was fully activated [27] v Vmax ¼ AB aKA KB þ aKB A þ aKA B þ AB ð1Þ The rapid equilibrium assumption...
- 15
- 554
- 0
Báo cáo khoa học: "Interaction of Knowledge Sources in a Portable Natural Language Interface" docx
... nodes Martin et al [12] define a transportable NL interface as one that can acquire a new domain model by interacting with a human database expert Although DATALOG does not yet have such a capability, ... model to handle more complex databases, and integrating a pragmatic component for handling anaphora and other dialogue-level phenomena into the Cascaded ATN grammar References 10 Bates, M and Bobrow, ... J., "Information Retrieval Using a Transportable Natural Language Interface. " In Research and Development in Information Retrieval: Proc Sixth Annual International ACM SIGIR Conf., Bathesda MD,...
- 4
- 253
- 0
Báo cáo khoa học: "A TOOL FOR THE AUTOMATIC CREATION, EXTENSION OF LEXICAL KNOWLEDGE" pdf
... dictionaries This way, for example, a virtual EnglishJapanese synonym dictionary can be created from English-English and FJlglish-Japanese base dictionaries In our own approach, all information available ... be applied advantageously in lexicography RELATRD ~ C H The presence of both static information (morpheancs and features) and dynamic information (morphological rules) in LKBs is also advocated ... in Isoda, Also, Kamibayashi and Matsunaga (1986) shows some similarity to our filter concept Virtual dictionaries can be created using base dictionaries (physically existing dictionaries) and user-defined...
- 5
- 467
- 0
Báo cáo khoa học: Investigations of the supercoil-selective DNA binding of wild type p53 suggest a novel mechanism for controlling p53 function doc
... scDNA (B) Ethidium stained agarose gel: lane 1, scDNA only; lane 2, no mAb; lanes 3–6, Bp53-10.1; lanes 7–10, ICA-9 mAb/p53 tetramer molar ratios: lanes and 7, 0.5; lanes and 8, 1.25; lanes and ... supernatants or ascites by means of affinity chromatography using either protein G-Sepharose (Pharmacia) or protein L-Sepharose (Pierce) horseradish peroxidase conjugated anti-rabbit IgG (Sigma) ... lanes and 7, no mAb; lanes and 8, DO-1; lanes and 9, ICA-9; lanes and 10, Bp53-6.1; lanes and 11, Bp53-10.1 Bands denoted as ÔscÕ and ÔocÕ correspond to free monomeric scDNA and open circular...
- 12
- 265
- 0
Báo cáo hóa học: " Research Article A Novel Biologically Inspired Attention Mechanism for a Social Robot" ppt
... nonplanar surfaces Finally, the selection of proto-objects with a high value of saliency guarantees a higher probability of repeatability than nonsalient ones A detailed explanation of this behavior ... significant internal holes and with a high value of saliency In this way, we try to avoid the selection of segmentation artifacts, assuming that a rectangular region has less probability to be a segmentation ... contrast, disparity and skin colour (4) Computation of attractivity maps for each of the computed features (5) Combination of the attractivity maps into a final saliency map (Ec (1)) end EURASIP...
- 10
- 356
- 0
Báo cáo hóa học: "Research Article A Mobility-Aware Link Enhancement Mechanism for Vehicular Ad Hoc Networks" pot
... indicator piggybacked in the data packets to find an alternate path to destination D Thus, new arrived data packets can then be delivered via a new path S -A- E-C-D as shown in Figure 2.3 Particle ... is to provide learning and adapting capability in D C H G Primary path Link Alternate path Figure 6: Alternate path construction the traditional fuzzy modeling approach The target objects to ... returning ACK packet was damaged, the source node rediscovers a path Through counting the data packets and the ACK packets that pass through, the nodes on the transmission path can accordingly...
- 10
- 290
- 0
Báo cáo hóa học: "Research Article A Cross-Layer Routing Design for Multi-Interface Wireless Mesh Networks" pptx
... next hop The data transmission is based on CSMA/CA and the iTolerance value at the radio interface changes dynamically So, we still transmit the data packet by using the lowest transmission power ... Queueing Theory and Network Applications, 2008 [6] S Narayanaswamy, V Kawadia, R S Sreenivas, and P R Kumar, “Power control in ad-hoc networks: theory, architecture, algorithm and implementation of ... traffic loading with data rate Mbits/s and the dark color (blue) bars represent the low traffic loading with data rate 512 Kbits/s We consider the traffic flows in the WMNs randomly start and terminate...
- 8
- 308
- 0
Tìm thêm: xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25