a directly connected pressure diffuser for increasing capacity and saving energy in overloaded digester systems
Báo cáo lâm nghiệp: "Multifunctional forestry practices as a land use strategy to meet increasing private and public demands in modern societies" ppt
... meeting local, national, and increasingly international environmental demands, securing the long-term availability of raw materials and energy, and providing specific combinations of goods and services ... leisure and relaxation Inhabitants of mountain regions see it as protection against natural dangers and as a tourist attraction Forest owners, farmers, and industry see it primarily as a source ... political relevance, and transparency in negotiations and decision making are the necessary ingredients in managing renewable natural resources in a sustainable way In this context one has to...
- 9
- 391
- 0
Báo cáo y học: "A new clinical rating scale for work absence and productivity: validation in patients with major depressive disorder" pot
... functioning in patients with MDD Competing interests RWL has received honoraria for consulting/speaking from: Advanced Neuromodulation Systems Inc., AstraZeneca, Biovail, Canadian Network for Mood and ... The HPQ has been validated against objective measures of absence and performance in a number of blue-collar and white-collar occupations [17,18] and can be considered the "gold standard" productivity ... Canadian Network for Mood and Anxiety Treatments, GlaxoSmithKline, Janssen, Pfizer, Ranbaxy, and Scherring Plough He has received research grants from: AstraZeneca, Bristol Myers Squibb, Canadian Institutes...
- 7
- 305
- 0
báo cáo khoa học: " A set of EST-SNPs for map saturation and cultivar identification in melon" doc
... F, Blanca JM: EST2uni: an open, parallel tool for automated EST analysis and database creation, with a data mining web interface and microarray expression data integration BMC Bioinformatics ... from the Near-East region such as elongated (chate and flexuosus) and Asiatic ananas and chandalak types; group 3, modern cantalupensis cultivars; group 4, mainly traditional varieties and wild ... performed the variability analysis, coordinated the SNP mapping and participated in the drafting of the manuscript MBP prepared DNAs for the melon accessions and participated in the genotyping for...
- 9
- 341
- 0
Flavor enhancement as a tool for increasing pleasantness and intakeof a snack product among the elderly
... Preliminary data analysis revealed no significant main effects and only one significant interaction of day and aroma on the pleasantness ratings of the young, implicating an increase in pleasantness ... investigation, since there are ambiguous results and evidence for and against on that matter Acknowledgements The authors thank practical trainees Linda van Mierlo and Pascalle Weijzen from Wageningen ... bitter and more intense in currant flavor and in overall flavor, and stronger in after-taste than the sample with a regular aroma concentration The heightened aroma concentration caused a slight...
- 10
- 599
- 1
Tài liệu GIVING CREDIT WHERE CREDIT IS DUE: CREATING A COMPETENCY-BASED QUALIFICATIONS FRAMEWORK FOR POSTSECONDARY EDUCATION AND TRAINING pdf
... competency-based framework within which states and institutions can award educational credit for academic-equivalent competencies mastered through formal and informal occupational education and training ... procedures for taking a certification away from an individual It is a testing model The American National Standard that looks at education/training certificates is ASTM 2659 – Standard Practice for ... metrics and processes for assuring quality across the postsecondary education and training landscape are essential in order to validate the quality of prior learning assessment and credentials and...
- 46
- 477
- 0
Tài liệu Báo cáo khoa học: "A Unified Syntactic Model for Parsing Fluent and Disfluent Speech∗" ppt
... reparanda and alterations A hybrid system using the right corner transform and keeping information about how a repair started may be able to improve EDIT-F accuracy over this system Table 1: Baseline ... reparandum 108 Conclusion This paper has described a novel method for parsing speech that contains speech repairs This system achieves high accuracy in both parsing and detecting reparanda in ... 33– 39, Barcelona, Spain Mark Johnson 199 8a Finite state approximation of constraint-based grammars using left-corner grammar transforms In Proceedings of COLING/ACL, pages 619–623 Mark Johnson...
- 4
- 581
- 0
Tài liệu Báo cáo khoa học: "DiMLex: A lexicon of discourse markers for text generation and understanding" docx
... "Discourse particles and routine formulas in spoken language translation." In: Proceedings of the ACL/ELSNET Workshop on Spoken Language Translation, Madrid, 1997 K Vander Linden, J Martin "Expressing ... good start, but geared towards the English language (we are investigating German as well), and furthermore it catches only items relating clauses; in Despite the heavy rain, we went for a walk it ... between marker choice and other realization decisions And finally, markers that are still equivalent after evaluating these constraints are subject to a choice process that can utilize preferential...
- 5
- 528
- 0
Tài liệu Analysing different technology pathways for the pulp and paper industry in a European energy systems perspective doc
... Increased thermal efficiency in Scandinavian integrated TMP and paper mills Analysing the potential for steam savings using the Heat Load Model for Pulp and Paper Chemical Engineering Transactions ... potential for steam savings and temperature levels of excess heat are identified for four Scandinavian thermo-mechanical (TMP) pulp and paper mills using the Heat Load Model for Pulp and Paper ... characteristics and external, geographical and infrastructural, factors influence the potential for large-scale implementation of the pathways? In what way these characteristics and factors influence...
- 124
- 648
- 0
Báo cáo khoa học: Identification of a preferred substrate peptide for transglutaminase 3 and detection of in situ activity in skin and hair follicles pdf
... Q-x-P-WD-P to TGase and Q-x-x-W-x-W-P to Factor XIII (x and W are any amino acid and hydrophobic amino acid residues, respectively) We applied a similar approach to obtain information regarding the preferred ... Gottingen, Germany) For hematoxylin and eosin staining, ¨ the tissue section was fixed, then stained using standard methods and analyzed with a microscope, BZ-8100 (Keyence, Osaka, Japan) Acknowledgements ... greatly appreciate Dr Masatoshi Maki and Dr Hideki Shibata in our laboratory for providing valuable suggestions This work was supported by a Grant-inAid for Scientific Research on Innovative Areas...
- 11
- 645
- 0
Báo cáo hóa học: " Biofeedback for training balance and mobility tasks in older populations: a systematic review" ppt
... technology, and (7) subject’s experience and motivation during training Information on adherence to the biofeedback-based training program was collected by extracting participation rates and information ... Nottingham Balance Platform: force plate system with display Sway and weightdistribution during standing RMA, Nottingham ADL scale Zijlstra et al Journal of NeuroEngineering and Rehabilitation ... external validity and 89% in assessing internal and statistical validity This resulted in a total Cohen’s Kappa score of 0.73, which is substantial (.61.80) according to Landis and Koch’s benchmarks...
- 15
- 515
- 0
báo cáo hóa học:" Factors associated with "Ikigai" among members of a public temporary employment agency for seniors (Silver Human Resources Centre) in Japan; gender differences" ppt
... of data, analysis and interpretation of data, and drafting of the manuscript Hiroyasu Iso participated in analysis and interpretation of data, and the help for drafting of the manuscript, and ... provided statistical expertise Hideki Fukuda participated in the study concept and design, acquisition of data, analysis of data and interpretation of data, and the help for drafting of the manuscript ... to have "Ikigai" or not was evaluated by self-anchoring scale [31] with a range from to (0 = lowest rate of having "Ikigai": meaning having no "Ikigai", and = highest rate of having "Ikigai")...
- 6
- 354
- 0
Báo cáo hóa học: " Research Article A New Strong Convergence Theorem for Equilibrium Problems and Fixed Point Problems in Banach Spaces" pptx
... Fixed Point Theory and Applications Using this functional, Matsushita and Takahashi 2, studied and investigated the following mappings in Banach spaces A mapping S : C → E is relatively nonexpansive ... Takahashi, “Weak and strong convergence theorems for relatively nonexpansive mappings in Banach spaces,” Fixed Point Theory and Applications, no 1, pp 37–47, 2004 S.-Y Matsushita and W Takahashi, ... problems and fixed point problems in Banach spaces,” Journal of Computational and Applied Mathematics, vol 225, no 1, pp 20–30, 2009 15 A Tada and W Takahashi, “Weak and strong convergence theorems for...
- 14
- 393
- 0
báo cáo hóa học:" Research Article A Reinforcement Learning Based Framework for Prediction of Near Likely Nodes in Data-Centric Mobile Wireless Networks" pdf
... data transfer and data retrieval and our adaptive accuracy adjustment using reinforcement learning under the PARIS framework in Section We present the experimental evaluation of our approach in ... main logical components in PARIS are on-demand data transfer, runtime update of near likely node (for efficient data retrieval), and adaptive adjustment through reinforcement learning By on-demand ... Expanding and shRinking) algorithm, which can perform adaptive adjustment during runtime and improve the prediction accuracy by using the reinforcement learning technique In addition, a probability-based...
- 17
- 362
- 0
HOW TO GET A JOB Reveals 57 Tactics For Career Planning and Job Hunting Success Your Springboard doc
... excitement, feeling grateful that your mind is racing and alert and be thankful that you feel edgy It means you are alert, that you care about what you are about to do, that you want to win and have the ... can earn you thousands more by leap-frogging your experience and knowledge forward many years Information is power And ProFile Career Dynamics aims to be a portal for your career informational ... management job at British Steel They were also scouting for a Demand Analyst – a trial post to determine demand levels from customers and to translate that pattern into a material supply strategy...
- 36
- 610
- 0
Báo cáo khoa học: "A multiplex real-time PCR for differential detection and quantification of Salmonella spp., Salmonella enterica serovar Typhimurium and Enteritidis in meats" pps
... SsA-F SsA-R SE-Cy5 aggccttcgggttgtaaagt gttagccggtgcttcttctg FAM-aaccgcagcaattgacgttaccc-BHQ 1a tgcagaaaattgatgctgct ttgcccaggttggtaatagc JOE-acctgggtgcggtacagaaccgt-BHQ 1a ggtaaaggggcttcggtatc ... CFU/ml for S Enteritidis) Although the multiplex real-time PCR assay was demonstrated as an applicable assay in artificially inoculated meats, it needs further research for natural meat cases and ... (Figs and 4) Our results indicated that the QIAamp DNA Mini Kit was the most effective in extraction and amplification of bacterial DNA from artificially inoculated meats for the multiplex real-time...
- 9
- 410
- 0
Báo cáo lâm nghiệp: "A comparison of fitting techniques for ponderosa pine height-age models in British Columbia" potx
... intervals to indicate statistical differences Discrepancies are evident at young ages and at old ages, particularly for the high and low sites These are small, however, and therefore the Hann and ... regenerate It is difficult to establish because of drought at critical times in the growing season, competing vegetation, animal damage and predation, seedling quality, and frost heaving [11] Natural ... [20]) This model was fit to the heightbreast height age data using nonlinear least squares estimation and I made the usual assumptions about the random errors [26] All statistical analyses were done...
- 7
- 304
- 0
Báo cáo khoa học: "A new data processing system for root growth and ramification analysis: description of methods" pot
... branch point and of final point of virtual segments; and 5) the rank of branch point a Final data structure: ments resorting root seg- Growth and branching pattern analysis Statistical processing ... tions; 4) each successive observaroot segment is defined the Cartesian coordinates of some characteristic points (e.g., terminal points (initial and final) and branching points where the laterals of ... emergence), spatial data (coordinates of its terminal and branching points) and a set of ’structural’ indexes (Table I): a sequential index specifying the order in which the segment was digitized...
- 5
- 251
- 0
Báo cáo y học: "Generation of a single pulmonary pressure-volume curve does not durably affect oxygenation in patients with acute respiratory distress syndrome" docx
... followed by a change in PEEP level This finding is important because many clinical and experimental studies report early evaluation findings for therapeutic interventions that are initiated just after ... 26:1046-1056 Abraham E, Gallagher TJ, Fink S: Clinical evaluation of a multiparameter intra-arterial blood-gas sensor Intensive Care Med 1996, 22:507-513 Biomedical Sensors: Paratrend Operating Instructions ... minutes after PV measurement and persisting for at least 15 minutes Correlations were analyzed using Pearson product correlation The maximal increase in Pao2 after PV measurement taken using both...
- 5
- 314
- 0
Báo cáo y học: "A tumor cord model for Doxorubicin delivery and dose optimization in solid tumors Steffen Eikenberry" ppsx
... wt [21] for mouse mammary carcinomas, mouse mammary adenocarcinomas, and rat hepatomas Larger tumors typically have less vascular surface area [21], although vascular volume may stay relatively ... Jain [40] measured the capillary filtration coefficient (CFC), i.e LpA where A = vascular surface area, for mouse mammary adenocarcinomas, finding CFC ≈ 2.6 ± ml/ Using vascular surface areas ... to the plasma elimination (γ) phase, intracellular and extracellular concentrations decrease and flatten in space They also remain nearly static in time, decreasing very slowly compared to the...
- 20
- 230
- 0
DNA chip platform a high throughput genotyping technology for genetic diagnosis and pharmacogenetic profiling
... HbE-βthalassaemia – a moderately severe anaemia, in between that of thalassaemia minor and major, afflicts the patient This is termed thalassaemia intermedia Southeast Asia lies in the malaria belt where for ... thousands of years, malaria is the major cause of death and morbidity As thalassaemia disorders confers protection against severe malaria, the evolutionary Darwinian pressure results in a very ... haemoglobin – haemoglobinopathies – are divided into major groups: thalassaemia and structural haemoglobinopathies Thalassaemia results from decreased production of either α- and β-globin chains, causing...
- 204
- 403
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng 9 tr 25