a biopsychosocial understanding of gastrointestinal illness and disease
Báo cáo khoa học: " A comparative study of gastrointestinal parasites between ranched and free ranging Burchell''''s zebra (Equus burchelli antiquorum) in Isiolo district, Kenya" ppsx
... Spiruridae, Setariidae, and Ascaridae One cestode family was recovered, Anoplocephalidae, and larvae of the fly Gasterophilus from the family Gasterophilidae The genera Habronema and Gasterophilus ... A computer statistical software application was used for the statistical analysis Gastrointestinal parasites in Burchell’s zebra Results Parasites recovered Ten genera of gastrointestinal parasites ... 32oE and 37oE and latitudes 0o10' and 0o17'N The area is dry and hot for most of the year Rainfal1 is unreliable and scarce; however the two main rainfal1 seasons are the long rains between March...
- 6
- 453
- 0
Báo cáo y học: " A validity-driven approach to the understanding of the personal and societal burden of low back pain: development of a conceptual and measurement model" doc
... interpretations and applications that are validated To maximize the likelihood of producing valid data in relation to a range of possible interpretations and applications of a tool, there are development ... Association., American Educational Research Association., National Council on Measurement in Education., American Psychological Association Standards for educational & psychological tests Standards ... Hillsdale: Lawrence Erlbaum Associates; 1991 29 American Educational Research Association., American Psychological Association., Joint Committee on Standards for Educational and Psychological Testing...
- 39
- 387
- 0
A grounded understanding of challenges and responses of social work supervisors with managerial and clinical roles
... ‘demographical variable (for example, age, sex and geographical location), status variable (e.g social, educational, economic) and affiliations (formal and informal), as well as ethnographic variable ... division of tasks and responsibilities between a supervisor and any line manager Similarly, the American Association for Marital and Family Therapists (AAMFT) does not deem supervision for marital and ... managerial and clinical roles and b) a curiosity concerning the ethics of dual-roles supervisory practice Taking a critical approach to understand social work supervisors with managerial and clinical...
- 380
- 316
- 0
A study of bloating symptomatology, the role of gastrointestinal transit and the response to treatment with the 5 HT4 receptor agonist in patients with bloating predominant irritable bowel syndrome
... care-seeking behaviors that are related to gastrointestinal and non -gastrointestinal complaints The annual economic consequences of IBS are substantial It was estimated that IBS accounts for approximately ... potential elements In acute diarrhea conditions and in some cases of postprandial bloating, increased volume of intraluminal liquid content may become an important cause of bloating Accumulation of ... than on disease cure The treatment strategy includes non-pharmacological and pharmacological approach 1.1.5.1 Non-pharmacological therapies Dietary therapy Most IBS patients believe that certain...
- 144
- 356
- 0
A comparative study of discourse structures and some major linguistic features of international declarations and international conventions on human rights part 2
... 14 a, Use of Grammar 14 a1 Modality 14 a2 Use of Active / Passive voices 14 a3 Sentence order 15 a4 Length of sentences 15 a5 Kinds of sentences 16 b Use of vocabulary 17 b1 Archaic words and ... Purposes and typical legal characteristics of the International 10 Declaration on Human Rights 3.2.1 Purposes 10 3.2.2 Typical legal characteristics 10 3.3 A study of the discourse structure and some ... Convention and its realization 23 4.3.2.2 Remarks 26 a, Use of Grammar 26 a1 Modality 26 a2 Use of Active/ Passive voices 27 a3 Sentence order 27 a4 Length of sentences 27 a5 Kinds of sentences...
- 6
- 634
- 0
A comparative study of discourse structures and some major linguistic features of international declarations and international conventions on human rights part 3
... language learning, and is therefore of great importance to language teachers Traditionally, language teaching has concentrated on pronunciation, grammar, and vocabulary, and while these remain ... Modality A modal form is a provision of syntax that indicates the predication of an action, attitude, condition, or state other than that of a simple declaration of fact The modality of a grammatical ... shall be prohibited in all their forms (Article of Universal Declaration of Human Rights) b Use of vocabulary b1 Archaic words and phrases Few archaic words and phrases are found in Declarations...
- 41
- 839
- 3
A comparative study of discourse structures and some major linguistic features of international declarations and international conventions on human rights part 4
... spiritual and moral well-being and physical and mental health To this end, States Parties shall: (a) Encourage the mass media to disseminate information and material of social and cultural benefit ... financial assistance in case of need; (c) Make higher education accessible to all on the basis of capacity by every appropriate means; (d) Make educational and vocational information and guidance ... performances and materials Article 35 States Parties shall take all appropriate national, bilateral and multilateral measures to prevent the abduction of, the sale of or traffic in children for any...
- 28
- 611
- 0
A CFD analysis of transport phenomena and electrochemical reactions in a tubular-shaped PEM fuel cell
... is change for planar shape, where under the land areas a noticeable decrease takes place It can be seen that for a planar shape, a high fraction of the current is generated at the catalyst layer ... might lead to the onset of pore plugging, which has a detrimental effect of the fuel cell performance This model is used to analyse and evaluate the performance of a planar and a tubular-shaped ... Computational domain The full computational domains for the planar and tubular-shaped PEM fuel cell consist of cathode and anode gas flow fields, and the MEA are shown in Figure 2.2 Model equations...
- 26
- 609
- 0
A contrastive analysis of metaphorical lexis and collocation in english and vietnamese economics discourse
... activate suitable metaphors at the conceptual level a failure to assimilate the new to the already existing Many of todays standard meaning of words and expressions began as metaphors, and their ... Chilton and Lakoff (1989), an enormous amount of our conceptual life is metaphorical, and metaphor may even be necessary for understanding world politics and formulating policy Metaphor is a means of ... that actually generated war in the Gulf rather than avoidance of war and a continuation of sanctions In economics, Ormerod (1994) has put forward a similar view of the mechanistic metaphors that...
- 33
- 1,109
- 3
Tài liệu A Short View of the Frauds and Abuses Committed by Apothecaries, by Christopher Merrett pptx
... the said Act Now this Charter so much declaimed against, prayed only a supply of this defect, and also better and more necessary ways and means, without which, such and all other offenders against ... them have been taken, making an Apothecaries Shop in the Patients House, planting the Cupboards and Windows with Glasses and GallyPots, and not a quarter of the whole made use of He prescribes a ... freedom as Citizens, or their Charter as Apothecaries; and that our Charter was compiled by some, and perused and approved by others the most eminent Lawyers in England for Worth and Place; and yet...
- 206
- 405
- 0
Báo cáo " A brief comparison of Vietnamese intonation and English intonation and its implications for teaching English intonation to Vietnamese EFL learners " pptx
... investigation and choice of dialects are presented Part II provides an overview of the tones and intonation of the Vietnamese language This lays the basis for comparing aspects of Vietnamese intonation ... used as the native language and English as the target language The Vietnamese word structure and the Vietnamese tones, intonation Generally, there are two aspects in Vietnamese that make the language ... English and Vietnamese are addressed, and implications for teaching English intonation to Vietnamese learners are made Vietnamese words are primarily monosyllabic In the Vietnamese language, the...
- 10
- 1,968
- 17
Báo cáo khoa học: "Creative Language Retrieval: A Robust Hybrid of Information Retrieval and Linguistic Creativity" pot
... Expressing Attitude with Idiom Savant Our retrieval goals in IR are often affective in nature: we want to find a way of speaking about a topic that expresses a particular sentiment and carries a certain ... statistical corpus analysis is an obvious area of overlap for IR and FLP Distributional analyses of large corpora have been shown to produce nuanced models of lexical similarity (e.g Weeds and ... how an IR system can itself provide a degree of creative anticipation, acting as a mediator between the lit- 279 eral specification of a meaning and the retrieval of creative articulations of...
- 10
- 384
- 0
Pain: Current Understanding of Assessment, Management, and Treatments potx
... Care Policy and Research is now the Agency for Healthcare Research and Quality b These JCAHO standards first appeared in the 2000-2001 JCAHO standards manual and apply to ambulatory care, behavioral ... back and neck pain, myofascial pain/fibromyalgia, headache, arthritis pain, and neuropathic pain are the most common types of CNCP.105 Low back pain, arthritis, and migraine headache alone account ... its cause may perpetuate it.98 Environmental and affective factors also can exacerbate and perpetuate chronic pain, leading to disability and maladaptive behavior Cancer Pain Pain associated...
- 101
- 545
- 0
On a Fundamental Reorganisation of the Landesbanks and Savings Banks Sector in Germany ppt
... interconnectedness of savings banks and Landesbanks It is a matter of public record that key segments of the German Landesbanks lack a stable and self-sustaining business model and have neither a sustainable, ... current situation, the savings banks and Landesbank sector will initially operate as a regional savings finance group, as it were, and later as a supra-regional SFinanzgruppe [S-financial group] ... structures at DekaBank and transfer DekaBank to the sole ownership of the savings banks DekaBank and other banks of the S-Finanzgruppe [savings banks financial group] that are owned by the savings banks...
- 26
- 499
- 0
Medical and Psychosocial Aspects of Chronic Illness and Disability pptx
... International classification of impairments, disabilities, and handicaps: A manual of classification relating to the consequences of disease Geneva, Switzerland: Author Schmaling, K B., Afari, N., ... illness and disability impact all areas of individual’s and their family’s lives Only by understanding an individual’s total experience with chronic illness and disability and how all areas of their ... and abilities Participation in family, social, and work activities assumes interaction and the capacity to perform a variety of activities As interactions or capacities change, or as The impact...
- 598
- 419
- 0
Báo cáo khoa học: The twin-arginine translocation (Tat) systems from Bacillus subtilis display a conserved mode of complex organization and similar substrate recognition requirements doc
... GTGAGTCGCAAAGGTTTGGTAAAAACG) and RKDmsAR (CGTTTTTACCAAACCTTTGCGACTCACCTC AGCAGC) for RK mutation; and KRtoKKDmsAF (GCTGAGGTGAGTAAAAAGGGTTTGGTAAAAACG ACAGCG) and KRtoKKDmsAR (CGCTGTCGTTT TTACCAAACCCTTTTTACTCACCTCAGC) ... GAATTCACCATTATGAGCACTTTTA) and PCR_AmiA_EcoRI_rev (GGCCGAATTCGCTGTGTCCGTTGCTG GTT) for AmiA, and PCR_MdoD_EcoRI_for (GGCCGA ATTCACCATTATGGATCGTAGAC) and PCR_MdoD_EcoRI rev (GGCCCAATTCGTCAAAACGCTGGGTT ... chromosomal DNA with primers RTEAyF (5¢-CGCGTCTCGCATGCCGATCGGTCCTGGAAGCCT TGCTG-3¢) and JJystrep02 (5¢-ATATTCTAGATTATTT TTCAAACTGTGGGTGCGACCAATTCGATTGCCCAG AAGACACGTCCCG-3¢) RTEAyF was designed as...
- 12
- 445
- 0
Báo cáo khoa học: "A Comparative Study of Hypothesis Alignment and its Improvement for Machine Translation System Combination" pot
... human annotation In Proceeding of AMTA T Takezawa, E Sumita, F Sugaya, H Yamamoto, and S Yamamoto 2002 Toward a broad-coverage bilingual corpus for speech translation of travel conversations ... on Empirical Methods in Natural Language Processing and 947 Computational Natural Language Learning (EMNLP-CoNLL’2007), pp 277 – 286, Prague, Czech Republic, June S Jayaraman and A Lavie 2005 ... MT evaluation test set as our development set, and the NIST 2005 test set as our test set Table summarizes the statistics of the training, dev and test data for IWSLT and NIST tasks task data Sent...
- 8
- 546
- 1
a brief history of led zeppeln and its musical impact
... sound dated The music seems similar to music today The lasting impression of their music is obvious, and can be heard in any Rock band of today.Unfortunately, the machine that was Led Zeppelin came ... their official debut, Led Zeppelin were at the top of the bill at the Playhouse Theater in London, and the Pop Proms at the Royal Albert Hall in London On October 17, '69, a year and two days from ... Bonham had turned the wrong way in his sleep, and asphyxiated himself upon his own vomit A statement was released on December 4, 1980, stating that the band could not go on in its present state After...
- 3
- 323
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008