a balance in reproducibility sensitivity and specificity of genes differentially expressed according to microarray studies
Báo cáo y học: "Dynamic evolution of selenocysteine utilization in bacteria: a balance between selenoprotein loss and evolution of selenocysteine from redox active cysteine residues" docx
... Other bacteria and archaea Other bacteria and archaea Organization and phylogenetic analysis of components of the archaeal four-gene and bacterial five-gene operons Figure Organization and phylogenetic ... observations revealed a dynamic and delicate balance between Sec acquisition and selenoprotein loss, and may partially explain the discrepancy between catalytic advantages offered by Sec and its ... was available in distant organisms Additional data files The following additional data files are available with the online version of this paper Additional data file contains seven supplemental...
- 17
- 362
- 0
Sputum smear negative pulmonary tuberculosis: sensitivity and specificity of diagnostic algorithm docx
... assisting in sample size calculation and data analysis Author details Department of Internal Medicine Muhimbili National Hospital, Dar-essalaam, +255 Tanzania 2Department of Internal Medicine Muhimbili ... Murugavel Gangatharan Kailapuri, Hanas Settu, Cecelia Jebaraj Anitha, Solomon Suniti, Kumarasamy Nagalingeswaran: Value of single acid-fast bacilli sputum smears in the diagnosis of tuberculosis in ... University of Health and Allied Sciences Dar-es-salaam, +255 Tanzania Department of Psychiatry Muhimbili National Hospital Dar-es-salaam, +255 Tanzania Authors’ contributions FM participated in the...
- 6
- 559
- 0
Báo cáo hóa học: " Do quality of life, participation and environment of older adults differ according to level of activity?" pdf
... contextual factors that include both personal and environmental factors While activity is defined as an individual's ability to perform a task or action, participation is defined as involvement in a ... Functioning, Disability and Health WHO: Geneva, Switzerland; 2001 Asakawa T, Koyano W, Ando T, Shibata H: Effects of functional decline on quality of life among the Japanese elderly Int J Aging Hum ... and drafted the manuscript JD and DST participated in the design and helped to draft the manuscript All authors read and approved the final manuscript 20 21 WHO: International Classification of...
- 11
- 408
- 0
báo cáo khoa học: " Identification of genes differentially expressed during interaction of resistant and susceptible apple cultivars (Malus × domestica) with Erwinia amylovora" pdf
... ATP binding/kinase/protein serine/threonine kinase [Arabidopsis thaliana 936 29 26 29 936 142_G41_48I flag-tagged protein kinase domain of putative mitogen-activated protein kinase kinase 654 37 ... blight, in species belonging to the subfamily Maloideae of the family Rosaceae, including apple (Malus × domestica), pear (Pyrus communis L.) and ornamentals such as cotoneaster and pyracantha Fire ... previously during the Malus -E.amylovora interaction, with SSH ESTs activated in A thaliana during a compatible interaction, with SSH ESTs activated in At during an incompatible interaction, with...
- 10
- 359
- 0
Development of a Regional Risk Management Framework for APEC Economies for use in the Control and Prevention of Introduced Marine Pests
... Priorities and hazards for Economies Variable levels of activity and management capability Ships’ ballast water and hull fouling are the most important vectors International shipping, aquaculture ... and biodiversity are most threatened values Amount of commercial shipping and number of trading partners affecting pathway strength A limited number of IMP have been identified in APEC Management ... Need to develop awareness of the problem in APEC Economies Need appropriate information systems and tools Need to develop and adapt current institutional structures in individual Economies AND...
- 10
- 583
- 0
Tài liệu The Role of BCG Vaccine in the Prevention and Control of Tuberculosis in the United States: A Joint Statement by the Advisory Council for the Elimination of Tuberculosis and the Advisory Committee on Immunization Practices docx
... strains resistant to isoniazid and, in most cases, rifampin; several strains also were resistant to other drugs (e.g., ethambutol, streptomycin, ethionamide, kanamycin, and rifabutin) In addition, ... persons, and implementation and surveillance of BCG vaccination BCG VACCINES BCG vaccines are live vaccines derived from a strain of Mycobacterium bovis that was attenuated by Calmette and Guérin at ... Connaught Laboratories, Inc., for licensure in the United States This vaccine was transferred from a strain that was maintained at the University of Montreal (Montreal, Canada) Vaccine Efficacy...
- 27
- 1,309
- 3
Báo cáo khoa học: A single EF-hand isolated from STIM1 forms dimer in the absence and presence of Ca2+ ppt
... cooperativity of Ca2+ binding to EF-hand protein domains Our laboratory has developed a grafting approach to probe the site-specific Ca2+-binding affinities and metal-binding properties of CaM [14] and other ... forms a globular domain to allow for cooperative Ca2+ binding, responding to a narrow range of free Ca2+ concentration change To examine the key determinants for Ca2+ binding and Ca2+-induced ... results of calmodulin EF-hand III and the canonical EF-hand motif in STIM and its mutant The sequence from S64 to L96 in STIM1 was grafted into CD2.D1 A mutant containing Asp to Ala substitutions at...
- 9
- 465
- 0
Báo cáo khoa học: A role for serglycin proteoglycan in granular retention and processing of mast cell secretory granule components ppt
... purified; Vector Laboratories, Burlingame, CA) was used as secondary antibody (1 : 100 dilution in NaCl ⁄ Pi) Staining was performed with a standard protocol using the biotin–avidin-based Vectastain Elite ... maximal storage seen after 26 days of culture mMCP-6 storage showed similar kinetics as for mMCP-5 In contrast, CPA protein was detected as early as after days of culture, and a maximal plateau ... acetate (pH 4.0) at a flow rate of 0.5 mLÆmin)1 Fractions (0.5 mL) were collected and analyzed for 35S radioactivity As an internal standard, 200 lL of a mixture of unlabeled heparin (4 mgÆmL)1) and...
- 12
- 438
- 0
Case Study in Financial Modeling and Simulation of a Forestry Investment potx
... watering Maintenance:- weed control, fertilizing, pruning and thinning, fire and pest protection Inflows:wood; commercial thinning, final harvest non-wood; flora gathering, recreation, land ... usage and fashion changes Sovereign risk: regulatory changes, taxation changes, uncertain harvest rights Predicting Cash Flows The key growth indicator is the Mean Annual Increment 20 Years of ... Evaluation Criteria The Land Expectation Value(LEV) model is applied in preference to the NPV model Key Parameters in Forestry Models Establishment:- land, land preparation, plant stock, planting,...
- 18
- 785
- 4
Báo cáo khoa học: A steady-state competition model describes the modulating effects of thrombomodulin on thrombin inhibition by plasminogen activator inhibitor-1 in the absence and presence of vitronectin ppt
... the interaction between type plasminogen activator inhibitor and vitronectin and evidence that the bovine inhibitor binds to a thrombin-derived amino-terminal fragment of bovine vitronectin Biochim ... vessel wall, where all these proteins and cofactors are present [17], including TM on vascular SMC [14] Both thrombin and PAI-1 can substantially in uence migration and proliferation of vascular SMC, ... two faces First, PAI-1 is able to inhibit the mitogenic potential of thrombin On the other hand, cleavage and inactivation of PAI-1 by thrombin controls the urokinase-type plasminogen activator...
- 10
- 483
- 0
Báo cáo khoa học: Poneratoxin, a neurotoxin from ant venom Structure and expression in insect cells and construction of a bio-insecticide pot
... the N-terminal fragment of the poneratoxin gene Two others: forward 5¢-GCC GCCCGTGATACAGGCGATCCACGATGCGCAGA GGTAGTAATGAG-3¢ and reverse 5¢-AATTCTCATTA CTACCTCTGCGCATCGTGGATCGCCTGTATCAC GGG-3¢ ... gene and 3¢ end of a signal peptide: 5¢-CAGAAGCGGAA GAAAGCATGCAAAGGCAGA-3¢ (number 2), were used In the second PCR the plasmid pFastBacPx was used as a template with upstream and downstream primers ... poneratoxin to other animals, birds or mammals, especially when released in nature Predators will ingest the almost-dead larvae containing the expressed toxin Poneratoxin appears to be soluble in acidic...
- 10
- 696
- 0
Báo cáo khoa học: In vitro selection and characterization of a stable subdomain of phosphoribosylanthranilate isomerase potx
... plasmon resonance (SPR) On acquiring SPR data for FLAG-PRAI and trPRAI binding to mAb M2, it became apparent that the latter displayed increased binding at any given concentration (Fig 6) Affinities ... ancestor as commonly assumed Instead, the existence of part barrels such as trPRAI seems to support an alternative scenario in which (re)combinatorial mixing and matching of minigene encoded, autonomously ... insertion of the FLAG epitope without significantly perturbing the folding of the underlying (ba)8-barrel This was investigated by comparing the far-UV and near-UV CD spectra of PRAI and FLAG-PRAI in a...
- 14
- 382
- 0
Báo cáo sinh học: " Role of CD151, A tetraspanin, in porcine reproductive and respiratory syndrome virus infection" pdf
... expressing CD 151 as a β-galactosidase fusion protein The cell lysates were immunoprecipitated with anti-CD151 MAb (A1 ) and anti-β-galactosidase MAb (A2 ) In A1 , lane1, MARC-145 cytoplasmic protein ... 1):61-70 Hasegawa H, Nomura T, Kishimoto K, Yanagisawa K, Fujita S: SFA1/PETA-3 (CD151), a member of the transmembrane superfamily, associates preferentially with alpha beta integrin and regulates adhesion ... twice in staining solution (0.1% bovine serum albumin [BSA] in PBS) and blocked in 3% BSA in staining solution on ice for 10 min, and then incubated with polyclonal goat anti-CD151 Ab (Santa Cruz...
- 12
- 458
- 0
Báo cáo sinh học: " Involvement of PKR and RNase L in translational control and induction of apoptosis after Hepatitis C polyprotein expression from a Vaccinia virus recombinant" doc
... Demkowicz WE, Maa JS, Esteban M: Identification and characterization of vaccinia virus genes encoding proteins that are highly antigenic in animals and are immunodominant in vaccinated humans J Virol ... directed against DNA and histones to estimate the amount of cytoplasmic histoneassociated DNA fragments Total RNA isolation Total RNA from uninfected or infected cells was isolated using Ultraspect-II ... the alpha subunit of eukaryotic translation initiation factor and NF-kappaB Mol Cell Biol 1999, 19:4653-4663 Naganuma A, Nozaki A, Tanaka T, Sugiyama K, Takagi H, Mori M, Shimotohno K, Kato N: Activation...
- 19
- 373
- 0
báo cáo hóa học:" Involvement of PKR and RNase L in translational control and induction of apoptosis after Hepatitis C polyprotein expression from a Vaccinia virus recombinant" docx
... Demkowicz WE, Maa JS, Esteban M: Identification and characterization of vaccinia virus genes encoding proteins that are highly antigenic in animals and are immunodominant in vaccinated humans J Virol ... directed against DNA and histones to estimate the amount of cytoplasmic histoneassociated DNA fragments Total RNA isolation Total RNA from uninfected or infected cells was isolated using Ultraspect-II ... the alpha subunit of eukaryotic translation initiation factor and NF-kappaB Mol Cell Biol 1999, 19:4653-4663 Naganuma A, Nozaki A, Tanaka T, Sugiyama K, Takagi H, Mori M, Shimotohno K, Kato N: Activation...
- 19
- 389
- 0
Báo cáo toán học: " Influence of different flow conditions on the occurrence and behavior of potentially hazardous organic xenobiotics in the influent and effluent of a municipal sewage treatment plant in Germany: an effect-directed approach" pot
... matrix effects and methodological losses of analytes For the quantitation of the analytes, a 5-point (PAHs) and a 7-point (pharmaceuticals) internal standard calibration was used The limit of ... standards (≥98.00%) of diclofenac, carbamazepine, and PAH-Mix 25 (containing 16 Environmental Protection Agency [EPA] PAHs) as well as the isotopically labeled compounds used as surrogate standards ... classes of analytes [39,40] Quantitative analysis of the investigated pharmaceuticals and PAHs were therefore carried out using appropriate isotopically labeled surrogate standards to compensate...
- 13
- 589
- 0
báo cáo hóa học:" Influence of different flow conditions on the occurrence and behavior of potentially hazardous organic xenobiotics in the influent and effluent of a municipal sewage " pdf
... matrix effects and methodological losses of analytes For the quantitation of the analytes, a 5-point (PAHs) and a 7-point (pharmaceuticals) internal standard calibration was used The limit of ... standards (≥98.00%) of diclofenac, carbamazepine, and PAH-Mix 25 (containing 16 Environmental Protection Agency [EPA] PAHs) as well as the isotopically labeled compounds used as surrogate standards ... classes of analytes [39,40] Quantitative analysis of the investigated pharmaceuticals and PAHs were therefore carried out using appropriate isotopically labeled surrogate standards to compensate...
- 13
- 475
- 0
Báo cáo lâm nghiệp: "A change in structural diversity and regeneration processes of the spruce virgin forest in Nefcerka NNR (TANAP) in relation to altitude" docx
... regeneration processes of the spruce natural forest in Nefcerka NNR 546 in Tatra National Park on the basis of 27 research plots of ares in size that were established in various stages of the natural ... virgin forest in Nefcerka NNR assessed according to the Clark & Evans index confirmed that trees, regardless of the altitude, had a random spatial distribution In the case of developmental stage, ... developmental stage of the virgin forest, we can state that the highest values were found out in the growth stage and according to the scale outlined by the authors it is evaluated as a stand with...
- 9
- 390
- 0
Báo cáo lâm nghiệp: "Variation in the composition and content of ellagitannins in the heartwood of European oaks (Quercus robur and Q petraea). A comparison of two French forests and variation with heartwood age" ppt
... was calculated in relation to total soluble ellagitan- nins A nested analysis of variance was carried out on arcsine-transformed percentage data A nonparametric comparison of the two sites was ... can calculate average heartwood age assuming constant annual growth equal to the mean ring widths for each forest (see table V) Using this estimate of mean heartwood age as a and the mean total ... vescalagin and castalagin may transform directly or indirectly to dimers The rapid decline in vescalagin corresponds with an increase in concentrations of these dimers Roburin D (vescalagincastalagin)...
- 14
- 384
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008