... % The family G2conn we have constructed is a family of 2-connected graphs that achieve equality in the bound of Theorem We remark, however, that every vertex in a graph that belongs to the family ... of Theorem One such family can be constructed as follows: Let k ≥ be an integer and let G2conn be the family of all graphs that can be obtained from a 2-connected graph H of order 2k that contains ... [8] K Kawarabayashi, M D Plummer, and A Saito, Domination in a graph with a 2-factor J Graph Theory 52 (2006), 1–6 [9] A V Kostochka and B Y Stodolsky, On domination in connected cubic graphs Discrete...
... radiograph was obtained after a median of year, the second after a median of years and the third after a median of 14 years after disease onset The total Ratingen score refers to the last radiograph ... duration at the time thatthe radiograph was taken DNA isolation Blood samples containing EDTA as anti-coagulant were obtained from patients and controls Genomic DNA was extracted from peripheral ... range [IQR] 4) The latest radiograph was chosen if more than one radiograph was available per patient The other sample contained one radiograph per patient after 15 or more years after disease...
... solving the steady-state Navier-Stokes equations, i.e the continuity equation, the mass conservation equation for each phase yields the volume fraction (r ) and along with the momentum equations the ... near the cathode side area The maximum stress appears in the cathode side surface of the membrane, implying that major heat generation takes place near this region It can be seen also thatthe ... membrane hydration and avoidance of water flooding in the cathode catalyst layer and/or gas diffusion layer [2] Water management is related with air supply to the cathode and is one of the crucial...
... predominantly classical ones We can find the explanation for this behaviour in the fact that these indicators are much easier to measure In addition, conventional methods have the advantage of being ... evaluation settings Their major drawback of evaluation is that they focus onthe estimation of cash flows and accounting criteria (Kim, Suh and Hwang, 2003) Nevertheless, traditional performance ... 2000; Kaplan and Norton, 1992) They not link the non-financial metrics to financial numbers (e.g Kaplan and Norton, 1992) Traditionally financial and non-financial measures have been seen as opposed,...
... interco-operation, social transformation, universal character, education The mission and corporate values summarize the corporation and the culture of all the firms belonging to it: customer satisfaction, ... knowledge and information: that is, an interaction between actions and behaviors The action of CASE STUDY creation does not consist of the processing of information or data, since the obtaining of tacit ... external relations, education and training, working teams and committees and the assembly system for decisions All of these are based on participation in the process Although the new information...
... Pakistan and Bangladesh have lower education and occupational qualifications than whites, on average, those from India, Africa and China have higher average qualifications (Modood 2003) Although ... and health incorporation onthe patterns observed among the total population—in social institutions such as the educational and health care systems, and on markers of health and social inequality ... associated with health Onthe one hand, positive health selectivity among natives and a lack of systematic health-related attrition among the foreign-born suggests thatthe immigrant health advantage...
... data allowing one to compare historical bond market developments across countries His data appear to indicate that as early as 1850 the U.S corporate bond market was as large or larger than that ... high These institutional considerations rest on personal observation rather than on statistical evidence 19 Whatever the explanation, this (as an aside) is the finding that so impressed Michael ... What the rating agencies to earn their keep? The traditional answer to this question is thatthe agencies gather and analyze all sorts of pertinent financial and other information, and the n...
... morning that only the Reichstag and the Kaiser wanted the War; that Russia began it, so Deutschland mussen; that Deutschland couldn't win against Russia, France, England, Belgium, and Japan; and that ... realise that it has all been done on purpose, and that none of them are accidents or surgical diseases And they seem all to take it as a matter of course; the bad ones who are conscious don't speak, ... for the troops at the theatre at The Padres and a Union Jack and the Allies' Flags; and a piano onthe stage; officers and sisters in the stalls; and the rest packed tight with men: they were very...
... in se and mala prohibita The prohibition against intoxication in public was classified as mala in se, inspired by the biblical story of Noah,52 and also as mala prohibita.53 The main reason behind ... Roman law dictated that ignorance of the law is not an excuse to break the law (ignorantia juris non excusat).71 The reason for that ruling in Roman law was that, while the facts may be complicated ... conditional clauses4: valid and invalid A valid conditional clause refers to a real occurrence; an invalid conditional clause relates to a hypothetical situation that has not, will never, or can never...
... thus one candidate for an acceptable translation Because the prepositional phrase is a modifier of the main process (indicated by the role feature and the fact thatthe main process and the modifier ... semantic organisation thatthe grammar's semantics requires These categories, and the relationships among them, constitute the upper model The upper model serves to organize the propositional content ... consider all the grammatical constructs and lexical items of English that Nigel has available for realizing this concept In particular,one of the English realizationsmay be the English preposition since,...
... GTCCCCAGCAGCAGCAGTA GAGGTGAGCCGATGGAGATTTA CCTCTCAGGCGCTCAGCTTC TCTCCGGCGAGATGTCCGA GCTCCAGTGAATCCAGGTTG TCTCCGGCGAGATGTCCGA GGCAGCGATCACCAGTAAAC GAAGGGCTCATGACCACAGTCCAT TCATTGTCGTACCAGGAAATGAGCTT ... NRG -a_ rev NRG-5¢_for NRG-Beta_rev GAPDH_for GAPDH_rev TGAAAGACCTTTCAAACCCCTC GTTTTGCAGTAGGCCACCAC GCCAGGGAAGTCAGAACTTC GTTTTGCAGTAGGCCACCAC CCACAGAAGGAGCAAATACTTC GTTTTGCAGTAGGCCACCAC AGGAGGAGGAGTGGTGCTG ... (0.2 lm each) Amplificates were analyzed on 1% agarose gels and GAPDH amplification served as a control for the RT-PCR reaction and PCR conditions Primer sequences and the amplificate length are provided...
... signal strongly varied from preparation to preparation A decrease in specific activity was always accompanied by an increase in signal intensity, suggesting thatthe g ¼ 2.01 signal is an artifact ... artifact As regards the nature of the signal, the lack of a visible negative absorptionshaped peak at higher magnetic fields appears to be, at first glance, indicative of an axial signal However, a closer ... form a common, broad, unresolved peak at that pH value, the broad, negative absorption-shaped resonance was weak, but easily detectable The similarity between the two, pH-differentiated signals...
... a daily paper than average, but still more than a quarter (29%) of U.S persons 18–20 say they read a daily newspaper on an average day About a third, 34%, say they read a paper on an average ... teens say there is an MP3 player in their household that can also play video All said, 28% U.S teens say they watch video on an MP3 player daily As is the case on phones, music videos are the most ... who recall TV ads are 44% more likely to say they liked the ad • Teens play video games, but are as excited about play-along music games and car-racing games as they are about violent ones: Just...
... Myeloma Biology and the Impact of Drugs Marina Ferrarini, Giovanna Mazzoleni, Nathalie Steimberg, Daniela Belloni and Elisabetta Ferrero Additional information is available at the end of the chapter ... monoclonal diseases, the cell starts to synthesize Ig following the variable domain rearrangement Onthe coding DNA strand, the gene segments for the formation of the variable and the constant ... Gammopathies 93 Lucie Rihova, Karthick Raja Muthu Raja, Luiz Arthur Calheiros Leite, Pavla Vsianska and Roman Hajek Chapter Monoclonal Gammopathy of Undetermined Significance 111 Magdalena Patricia...
... response to the changes, and about the process for municipal decisionmaking; discover what provincial and local actions are taking place in response to the changes; have a chance to say what ... to municipalities means that municipalities will either have to dramatically increase their own financial contribution to benefits or reduce the benefits that are provided The provincial government ... Ontario Works (OW) and the Ontario Disability Support Program (ODSP): $20 million as a result of the new overall cap on discretionary health and nonhealth related benefits, to take effect July...
... observations, suggest thatthe aIIb 313–332 region is important, not only for fibrinogen binding but also for platelet activation The rationale of this study was based onthe assumption that peptide ... B.L., Ali, F & Samanen, J (1989) Demonstration of Ac–Arg–Gly–Asp–Ser–NH2 as an antiaggregatory agent in the dog by intracoronary administration Thromb Haemost 61, 183–188 Samanen, J., Ali, F., ... maximal aggregation, achieved within after addition of the agonist, was determined and expressed as a percentage of 100% light transmission calibrated for each specimen (maximal percentage of aggregation)...
... This location would be advantageous to facilitate the amphipathic interaction between the peptide and the membrane surface, as the tryptophan side chain is amphiphilic in nature The tryptophan side ... with both the C-terminal 14 residue truncation and the substitution of the aspartic acid at position 16 by tryptophan, showed antimicrobial activity comparable to that of native GGN4 and less ... showed a strong negative band near 200 nm and a weak and broad band around 222 nm, indicating a predominantly random-coil conformation with a slight helical propensity [17,22,23] Especially, the D16W...