870 pld realizations of a 74x194 like universal shift register with synchronous clear
Tài liệu Báo cáo khoa học: Crystal structure of a subtilisin-like serine proteinase from a psychrotrophic Vibrio species reveals structural aspects of cold adaptation docx
... hydrogen bonds Main chain–main chain Main chain–side chain Side chain–side chain Total ˚ Exposed surface areab (A2 ) ˚ Apolarc (A2 ) ˚ Buried surface areab (A2 ) ˚ Apolarc (A2 ) a 1IC6 1THM 38 24 ⁄ ... Structural aspects of cold adaptation surface with their hydrophilic nature may enhance favourable electrostatic interaction with water at low temperature and, at the same time, result in an anionic ... cut-off distance of 3.5 A showed that 85–93% of the Ca-atoms lie at common positions and ˚ gave a root mean square deviation of 0.84–1.21 A (Table 2, Fig 2) The structural resemblance with Table...
- 14
- 597
- 0
Báo cáo khoa học: Evolutionary changes to transthyretin: structure and function of a transthyretin-like ancestral protein doc
... Pf5 ATCC BAA-477 Actinobacteria, Actinobacteria Proteobacteria, Alphaproteobacteria Proteobacteria, Alphaproteobacteria Proteobacteria, Alphaproteobacteria Proteobacteria, Alphaproteobacteria Proteobacteria, ... Proteobacteria, Alphaproteobacteria Proteobacteria, Betaproteobacteria Proteobacteria, Betaproteobacteria Proteobacteria, Gammaproteobacteria Proteobacteria, Gammaproteobacteria Proteobacteria, Gammaproteobacteria ... TLPs are indicated above the alignment: motifs A –C’ are indicated with straight lines and are labelled; b-strands are indicated with arrows and are labelled A H A single a- helix is indicated with...
- 13
- 390
- 0
Báo cáo khoa học: Activation of Stat5 and induction of a pregnancy-like mammary gland differentiation by eicosapentaenoic and docosapentaenoic omega-3 fatty acids docx
... 5¢-TTCTTAACCC CACCGTCCAA-3¢; reverse primer: 5¢-GAAAATAACCT GGAAATCCTCTTAGACA-3¢; probe: 5¢-TCCCTGCCA CTCCACAACATTCCG-3¢ Statistical analysis Stat5 knockout mice Mice homozygous for the Stat5atm1Mam ... differentiation effect of pregnancy Table Analyses of fatty acid ratio and relative contents of n-3 PUFAs EPA, DPA, and DHA in mammary glands Whole inguinal mammary fat pads were isolated and contents ... ratio change in favor of n-3 PUFA and particularly an n-3 DPA and EPA An increase in n-3 DPA and EPA, and perhaps other n-3 PUFAs, stimulates Jak2 and Stat5 activation, and induces b-casein expression...
- 12
- 421
- 0
Báo cáo khoa học: Cleavage site analysis of a serralysin-like protease, PrtA, from an insect pathogen Photorhabdus luminescens and development of a highly sensitive and specific substrate pdf
... Pa1 Pa2 Pa3 Pa4 Pa5 Pa6 Pa7 Pa8 Pa9 Pa10 Pa11 Pa12 Ac-EVYLVE-NH2 Ac-EVYLLE-NH2 Ac-EVYLAE-NH2 Ac-EVYAVE-NH2 Ac-EVYALE-NH2 Ac-EVYAAE-NH2 Ac-ELYLVE-NH2 Ac-ELYAVE-NH2 Ac-ELYLLE-NH2 Ac-ELYLAE-NH2 Ac-ELYALE-NH2 ... 1269–1272 Tanaka H, Yamamoto T, Shibuya Y, Nishino N, Tanase S, Miyauchi Y & Kambara T (1992) Activation of human plasma prekallikrein by Pseudomonas aeruginosa elastase II Kinetic analysis and identification ... metallo-endoprotease of Serratia marcescens (serralysin), are the alkaline proteinase of Pseudomonas aeruginosa, the ZapA metalloprotease of Proteus mirabilis and proetases A, B, C, G and W of...
- 11
- 424
- 0
báo cáo hóa học:" Ovarian cancer plasticity and epigenomics in the acquisition of a stem-like phenotype" pptx
... Pathology of ovarian cancer precursors J Cell Biochem Suppl 1995, 23:208-218 Sawada K, Mitra AK, Radjabi AR, Bhaskar V, Kistner EO, Tretiakova M, Jagadeeswaran S, Montag A, Becker A, Kenny HA, ... [33] Early EOC may therefore already possess genetic abnormalities that are further propagated in advanced disease states Normal OSE, early EOC, and advanced disease are easily classified based ... Mulligan J: Monitoring gene expression profile changes in ovarian carcinomas using cDNA microarray Gene 1999, 229:101-108 Ono K, Tanaka T, Tsunoda T, Kitahara O, Kihara C, Okamoto A, Ochiai K, Takagi...
- 11
- 555
- 0
Ecological performance of a generalized irreversible Carnot heat engine with complex heat transfer law
... The total heat transfer surface area ( F ) of the two heat exchangers is assumed to be a constant: F = F1 + F2 (3) There exists a constant rate of bypass heat leakage ( q ) from the heat source ... heat transfer coefficient and F1 is the heat-transfer surface area of the hightemperature-side heat exchanger , β is the overall heat transfer coefficient and F2 is the heat-transfer surface area ... irreversible Carnot engine with heat resistance and heat leakage losses [59, 60] Figure The model of a generalized irreversible Carnot heat engine Generalized optimal characteristics The second law of thermodynamics...
- 14
- 534
- 0
Chronicles of a Dallas Cowboys Fan: Growing Up With America''''s Team in the 1960''''s by John Eisenberg pptx
... diversion was a Texas League baseball team that played at Burnett Field in South Dallas Later on, there was another Texas League team, the Dallas-Fort Worth Spurs, who played at Turnpike Stadium in Arlington ... Arlington A minor league hockey team, the Blackhawks, played at the State Fair Coliseum to small crowds of displaced hockey nuts The Chaparrals, of the American Basketball Association, came to town ... League also began playing that year Owned by Lamar Hunt, the son of oilman H L Hunt, the AFL team was called the Texans and also played at the Cotton Bowl Competing for fans with each other as well...
- 18
- 466
- 0
Báo cáo khoa học: Characterization of a-synuclein aggregation and synergistic toxicity with protein tau in yeast potx
... Hasegawa T, Matsuzaki M, Takeda A, Kikuchi A, Akita H, Perry G, Smith MA & Itoyama Y (2004) Accelerated alpha-synuclein aggregation after differentiation of SH-SY5Y neuroblastoma cells Brain Res 1013, ... 1013, 51–59 1400 P Zabrocki et al 57 Matsuzaki M, Hasegawa T, Takeda A, Kikuchi A, Furukawa K, Kato Y & Itoyama Y (2004) Histochemical features of stress-induced aggregates in alpha-synuclein overexpressing ... the plasma membrane and may also occur on intracellular membranes or, alternatively, that the cells attempt to remove the aggregates formed at, and bound to, the plasma membrane via transport...
- 15
- 364
- 0
Combustion and emission characteristics of a natural gas fueled diesel engine with EGR
... estimate the repeatability of measure- _ m air stoic Accuracy of measurements and uncertainty analysis stoic where (AFR ) and (AFR ) are the stoichiometric air–fuel ratios NG D ment and the accuracy ... natural gas diesel engine Energy 2010;35:1129–38 [11] Wannatong K, Akarapanyavit N, Siengsanorh S, Chanchaona S Combustion and knock characteristics of natural gas diesel dual fuel engine SAE paper ... Pirouzpanah V, Khoshbakhti Saray R, Sohrabi A, Niaei A Comparison of thermal and radical effects of EGR gases on combustion process in dual fuel engines at part loads Energy Convers Manage 2007;48:1909–18...
- 12
- 573
- 0
báo cáo hóa học:" Research Article On Homoclinic Solutions of a Semilinear p-Laplacian Difference Equation with Periodic Coefficients" pptx
... papers of Agarwal et al 10 , Cabada et al 11 , a Chen and Fang 12 , Fang and Zhao 13 , Jiang and Zhou 14 , Ma and Guo 15 , Mih˘ ilescu et al 16 , Krist´ ly et al 17 a Along the paper, given ... differential equations,” Journal of Mathematical Analysis and Applications, vol 240, no 1, pp 163–173, 1999 W Omana and M Willem, “Homoclinic orbits for a class of Hamiltonian systems,” Differential and ... such kind of problems can be placed at the interface of certain mathematical fields, such as nonlinear differential equations and numerical analysis On the other hand, they are strongly motivated by...
- 17
- 365
- 0
báo cáo hóa học:" Research Article Note on the Persistent Property of a Discrete Lotka-Volterra Competitive System with Delays and Feedback Controls" pptx
... Gopalsamy, Stability and Oscillations in Delay Differential Equations of Population Dynamics, vol 74 of Mathematics and Its Applications, Kluwer Academic Publishers, Dordrecht, The Netherlands, ... LotkaVolterra competitive system with delays and feedback controls,” Journal of Computational and Applied Mathematics, vol 211, no 1, pp 1–10, 2008 S Ahmad, “On the nonautonomous Volterra-Lotka ... S Ahmad and I M Stamova, “Almost necessary and sufficient conditions for survival of species,” Nonlinear Analysis Real World Applications, vol 5, no 1, pp 219–229, 2004 10 Y.-H Fan and L.-L Wang,...
- 9
- 351
- 0
Báo cáo hóa học: " Research Article Interior Controllability of a 2×2 Reaction-Diffusion System with Cross-Diffusion Matrix" pdf
... mathematicians who live in remote and inhospitable places, far from major research centers in the world, can also understand and enjoy the interior controllability with a minor effort 4 Boundary ... families of bounded linear operator in Z, with {Pj }j≥1 a family of complete orthogonal projection such that Aj P j P j Aj , j ≥ 2.9 Define the following family of linear operators: ∞ T t z eAj ... whose infinitesimal generator A is given by ∞ Az z∈D A Aj Pj z, 2.11 j with ⎧ ⎨ D A ∞ ⎩ j z∈Z: Aj P j z ⎫ ⎬
- 9
- 279
- 0
Báo cáo hóa học: " Analysis of a Combined Antenna Arrays and Reverse-Link Synchronous DS-CDMA System over Multipath Rician Fading Channels" doc
... paper, we consider that the array geometry, which is the parameter of the antenna aperture gain, is a uniform linear array (ULA) of M identical sensors All signals from MS arrive at the BS AA ... , θl(k) , and τl(k) are phase shift, mean angle of l arrival (AOA), and the propagation delay, respectively, of the lth faded path of the kth user Assuming Rayleigh fading, the probability density ... sensor spacing is half the carrier wavelength, and an important parameter that characterizes a Rician fading channel is defined as the ratio of the specular component power to the Rayleigh fading...
- 10
- 236
- 0
Improving the performance of a high power, lead–acid battery with paste additives docx
... sulfate ions Researchers w15,16x have found that after a certain amount of the active material has reacted the remaining material becomes isolated and cannot react The amount of active material ... Table Battery design parameters Parameters Fig Critical volume fraction with material additives conductivity model, to estimate lead–acid battery performance over a wide range of discharge rates ... of nodes that were either discharged or isolated The critical volume fraction is calculated as the ratio of discharged nodes to the initial number of available nodes The model can take into account...
- 8
- 382
- 0
Báo cáo y học: "Induction of a B-cell-dependent chronic arthritis with glucose-6-phosphate isomerase" pptx
... reduced oxidative burst due to a mutation in the Ncf1 gene Proc Natl Acad Sci USA 2004, 101:12646-12651 40 Sakaguchi N, Takahashi T, Hata H, Nomura T, Tagami T, Yamazaki S, Sakihama T, Matsutani T, ... important feature of an animal model of RA because the human disease is already chronic when it becomes diagnosed RA is most likely often preceded by many years of subclinical inflammatory activity ... mouse Each arthritic (red and swollen) toe and knuckle was scored as 1, whereas an affected ankle was scored as (total: 15/paw) [24] Antibody analysis Serum for analysis of antibody levels was taken...
- 9
- 392
- 0
Báo cáo khoa học: "Surgical treatment of a rare primary renal carcinoid tumor with liver metastasis" docx
... with advanced disease Response rate has been variable and may correlate to octreotide scan, but stabilization of disease has been seen in 36 to 70% of patients, with a mean duration of 12 months ... year after her initial surgery, with no evidence of tumor recurrence Case presentation We evaluated a 45 year-old patient who presented initially with abdominal pain Abdominal and pelvic CT scan ... tumor of the ovary; a total abdominal hysterectomy with bilateral salpingo-oophorectomy was performed This was followed by a radical right nephrectomy with lymphadenectomy and a formal left hepatectomy...
- 4
- 329
- 0
Báo cáo khoa học: "The role of adjuvant pelvic radiotherapy in rectal cancer with synchronous liver metastasis: a retrospective study" doc
... locally advanced rectal cancer However, when patients are diagnosed with synchronous liver metastasis, preoperative CCRT is no longer a part of standard care, and many physicians decide against ... chemotherapy and seven patients were managed with conservative care only A univariate analysis was carried out on clinical factors including patients’ age, Duke stage, initial CEA level, lateral resection ... was classified according to Pettavel and Morgenthaler staging [12] Stage I was defined as a solitary or small metastasis, stage II was defined as two or three metastases with a maximum diameter...
- 7
- 328
- 0
báo cáo khoa học: "Collaborative planning approach to inform the implementation of a healthcare manager intervention for hispanics with serious mental illness: a study protocol" pptx
... Germany), a qualitative data management software [58], will be used to manage and analyze all qualitative data Quantitative analysis All tests will be two-sided and performed at significance ... proportion of appropriate services obtained [18] Health and mental health-related quality of life SF-12 [75], a self-report measure available in English and Spanish and validated among adults with ... next steps and future plans Data analysis Quantitative data entry and analysis will utilize SAS version 9.1.3 (SAS Institute, Inc., Cary, NC, USA) ATLAS ti (ATLAS.ti Scientific Software Development...
- 12
- 423
- 0
báo cáo khoa học: " Biological activity of a genetically modified BMP-2 variant with inhibitory activity" potx
... alterations of amino acids at position 34 and 53: alanine was substituted by aspartate and aspartate by alanine, respectively The mutation at position 34 mediates the inhibitoric activity via ... explanted Examination of the implants After explantation the mineralisation of the scaffolds was investigated radiographically in a 2-dimensional manner (Faxitron, 22 kV, 35 s) The radiograms ... formation Area of Area of bone formation Illustration of the mean area (mm2) of newly formed heterothopic bone (error bar: standard deviation) much more bone formation, not only at the margins...
- 5
- 384
- 0
Báo cáo y học: "Distinctive receptor binding properties of the surface glycoprotein of a natural Feline Leukemia Virus isolate with unusual disease spectrum" pps
... 5’ACTAGTGTTGGATCCTAACAACGTTCGGCATGGAGCTAGGTATAGCAGTAGCAAATATGGATGTAAAACTACAGATAG-3’, 2) the mutant designated VRB3aa using primer 5’-GAGGGAGTAATCAGGACAATAGCTGCACAGGAAAATGCAACCCCC-3’, 3) the mutant designated N147S using primer 5’-GGGAGTAGTCAGGACAATAGCTGTGAGGG-3’, ... prototype FeLV -A isolates FeLV -A/ 61E [GenBank:AAA93093], FeLV -A/ 3281 [GenBank:AAA43051] and FeLV -A/ Glasgow [GenBank:AAA43053], from FeLV-945 [GenBank:AAT76450] and from other representatives of the cohort ... 5’-GGGAGTAGTCAGGACAATAGCTGTGAGGG-3’, 4) the mutant designated K128N/S130T using primer 5’GCAACCCCCTAGTCTTACAGTTCACCCAGAAGGGAAGACAAGCCTCTTGG-3’, 5) the mutant designated I156V/K164R using primer 5’-GGAGAAGCTTGGTGGAATCCCACCTCCTCATGG-3’,...
- 17
- 267
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008