7 33 page2 of project tabset1 running in a browser
Báo cáo y học: " Dietary intake of fish, omega-3, omega-6 polyunsaturated fatty acids and vitamin D and the prevalence of psychotic-like symptoms in a cohort of 33 000 women from the general population" ppt
... summarized the intake of α-linolenic, EPA, DHA and docosapentaenoic acids (DPA) We combined EPA, DHA and DPA to estimate the total intake of marine fatty acids To estimate the total intake of ... total energy intake and dietary intake of vitamin B12, alcohol and dietary intake of other than omega-6 fatty acids g Sum of eicosapentaenoic acid (EPA), docosahexaenoic acid (DHA), docosapentaenoic ... importance A high intake ratio of omega-3:omega-6 fatty acids favor omega-3 fatty acid metabolism For example, high intake of omega-3 fatty acids partly replaces omega-6 fatty acids incorporation into...
- 13
- 334
- 0
Báo cáo y học: "Incidence of asthma and mortality in a cohort of young adults: a 7-year prospective study" ppt
... and individual characteristics with the incidence of asthma Statistical analysis was performed using STATA software [13], release 7. 0 (Stata Corp 19 97 Stata Statistical Software: release 5.0 Stata ... the official mortality data for the same age groups and the same areas (Table 3) Mortality rates were particularly high (Table 4) for people reporting having had at least one attack of asthma (32.2/10000/year), ... rhinitis and asthma has been traditionally interpreted as the progression of a common airway disease associated with atopy [25,26] It has The presence of asthma attacks and/or nocturnal asthma...
- 10
- 377
- 0
project on Application of Disperse & Reactive Dyes In a P-C Blended Fabric of 65-35 In Using Two Bath System
... other and fed into the blending feeder The blending can also be done in the carding stage Similarly the blending can be done at drawing or roving stage A filament yarn blended contains yarns of ... Yarn is raw material for fabric, dyes & chemicals are raw materials for dyed fabric Dyed fabrics are raw material for garments etc In Fakir Apparels Two Types Of Dyes Are Mainly Used: Reactive ... effect Appearance: The attainment of attractive appearance using combination of yarns of different luster, crimp etc which differ in appearance even after dye uniformly to the same color Dyeing...
- 30
- 463
- 0
Applying method of project based teaching in teaching knowledge of electric power production and use for high school students
... capacity and quality of general technical education – as follow: evaluation of teacher, cooperative evaluation, coequal evaluation and self-evaluation Evaluation result is the combination of all ... Making project plan; Phase Implementing the project; Phase Reporting and introducing products; Phase Evaluating; Summarizing/Reviewing the project 1.3.6 Making plan of teaching by project method: In ... power, in particular, as well as in teaching of Physics, in general, including the concept, characteristics, classification of teaching by project method, process of teaching by project method in...
- 27
- 408
- 1
Báo cáo y học: "Utility of routine chest radiographs in a medical–surgical intensive care unit: a quality assurance survey"
... Post-partum complications 10 Cardiovascular (congestive heart failure, cardiac arrest) Gastrointestinal complications* Other Sepsis Cardiovascular Gastrointestinal Gastrointestinal bleeding Liver ... Gray et al found that clinicians were fairly accurate in determining the placement of subclavian or internal jugular (IJ) vein pulmonary artery (PA) catheter introducer sheaths, but the clinicians ... changes of 16 days Thirty (23.6%) of the 1 27 CXRs changed management There were 29 management changes in 26 routine CXRs (12 changes in position of a medical device, and 17 changes in clinical management)...
- 5
- 506
- 0
Báo cáo y học: "Replacement of cisplatin with nedaplatin in a definitive 5-fluorouracil/ cisplatin-based chemoradiotherapy in Japanese patients with esophageal squamous cell carcinoma"
... H, Takeda Y, et al Evaluation of combined nedaplatin and docetaxel therapy for human head and neck cancer in vivo Anticancer Res 2006; 26: 989-94 Yamashita H, Nakagawa K, Tago M, et al Radiation ... 4 97- 503 Kato H, Fukuchi M, Manda R, et al Efficacy and toxicity of nedaplatin and 5-FU with radiation treatment for advanced esophageal carcinomas Anticancer Res 2003; 23: 3493-8 Yamada H, Maki ... Sakaeda T, Yamamori M, Kuwahara A, et al Pharmacokinetics and pharmacogenomics in esophageal cancer chemoradiotherapy Adv Drug Deliv Rev 2009; 61: 388-01 Miki I, Tamura T, Nakamura T, et al Circadian...
- 7
- 531
- 0
Quantification of Microcystin-degrading Bacteria in a Biofilm from a Practical Biological Treatment Facility by Real-time PCR
... and Water Quality., 13, 61 -72 Park H D., Sasaki Y., Maruyama T., Yanagisawa E., Hiraishi A and Kato K (2001) Degradation of the cyanobacterial hepatotoxin microcystin by a new bacterium isolated ... (Probe) agacgcacgctcacctcaa gagcagttcacgaaatcc atacgctcttactgtttccggccgcc in this study BACT1369F PROK1492R TM1389BACT2 (Probe) cggtgaatacgttcycgg ggwtaccttgttacgactt cttgtacacaccgcccgtc Suzuki et al., ... abundance ratio of the microcystin-degrading bacteria increased to approximately 0.005% of the total bacteria The number of cells increased in fall, and the number of microcystin-degrading bacteria increased...
- 9
- 522
- 0
Formation of Aerobic Granular Sludge in a Continuous-Flow Reactor – Control Strategy for the Selection of Well-Settling Granular Sludge
... surface loading and aeration rates Formation of Aerobic Granular Sludge by Controlling Surface Loading and Aeration Rates Surface loading and aeration rates were initially set at 1.2 m3/m2/d and ... The value of SVI gradually decreased due to aerobic granulation, as shown in Figs and As sludge settling ability increased, surface loading and aeration rates were gradually increased, and finally ... reactor Both surface loading and aeration rates affect the selection of well-settling sludge and the formation of aerobic granular sludge By setting and controlling adequate surface loading and...
- 8
- 481
- 0
Seasonal Changes of Shallow Aquatic Ecosystems in a Bird Sanctuary Pond
... REFERENCES APHA, AWWA and WEF (1998) Standard Methods for the examination of water and wastewater, 20th edition, APHA, Washington Akiyama M (ed) (1996) Algae in Lakes Shinjiko and Nakaumi, Research ... Cormorants (Phalacrocorax carbo), Japanese Journal of Limnology, 71 (1), 19-26 (in Japanese) Ogawa H., Kobayashi S., Nakayama K., Jin K., Igarashi S., Mikami H., Sakata K and Tsuzuki T (19 97) Uric acid ... decreased rapidly and was less than 400 kg in April 2000, which was term A again Seasonal Changes in Water Quality The seasonal changes in water quality are shown in Fig TN concentration of 3.0...
- 9
- 430
- 0
Optimum feeding rate of solid hazardous waste in a cement kiln burner
... types of chemical and hazardous wastes vary greatly, it is difficult to specify a typical analysis and generalize about the impacts of burning of chemical and hazardous waste Some researchers have ... Hammer International (Pvt) Ltd, Sri Lanka (2006) and Linea Intimo (Pvt) Ltd, Sri Lanka (2003) She has also worked at Department of Chemical and Process Engineering at UOM as teaching assistant (2005) ... The particle size was analyzed by mechanical sieving using a Retsch AS200 instrument Additional chemical analyses of the fuels were available from the plant laboratory ISSN 2 076 -2895 (Print),...
- 10
- 496
- 1
A computational study to investigate the effects of insulation and EGR in a diesel engine
... [29] Arash Nemati, Shahram Khalilarya, Samad Jafarmadar, Hassan Khatamnejhad, Vahid Fathi Numerical parametric investigation of a gasoline fuelled partially-premixed compression-ignition engine International ... worked as a Professor and Head of department in the Department of Mechanical Engineering, Vidya Vikas Institute of Technology, Andhra Pradesh, India He has 14 years of teaching and research experience ... Engines from Osmania University, Hyderabad, India in January 2009 He is presently working as a faculty in the department of Mechanical Engineering at Jubail University, Jubail, Saudi Arabia He also...
- 20
- 643
- 0
Hegel’s Phenomenology of Spirit - post-Kantianism in a newv ein
... eventful and particularly traumatic He was unable to land a salaried position; the Napoleonic wars in Germany led to a rapid in ation in prices that diminished almost daily the worth of what was left ... normatively in play in the kind of giving and asking for reasons in modern social practice Hegel’s invocation of a “Christian” way of life in that regard was done quite purposely, since it raised ... giving and asking for reasons, therefore, was an ongoing series of social negotiations against a background of taken-forgranted meanings, with everything in the negotiations being up for grabs...
- 29
- 500
- 0
Tài liệu Organic matter distribution of the root zone in a constructed subsuface flow wetland pptx
... matter (OM) is the organic fraction of soil, including wastewater pollutants, plant roots, animal and plant residues, and microbial biomass OM influences the chemical and physical properties of ... Materials and methods Sand sampling was done during January 20 07 in the experimental constructed subsurface flow wetland (CSFW) located at Campus I of Can Tho University (Figure 1) The main part of ... 20 07 Chiang Mai, Thailand ================================================================================ In analysis, data were compared graphically and by an ANOVA analysis at the significant...
- 6
- 473
- 0
Tài liệu Báo cáo khoa học: Destabilization of psychrotrophic RNase HI in a localized fashion as revealed by mutational and X-ray crystallographic analyses pdf
... extension: tailor-made genes using the polymerase chain reaction Biotechniques 8, 528–535 34 Kanaya S, Katsuda C, Kimura S, Nakai T, Kitakuni E, Nakamura H, Katayanagi K, Morikawa K & Ikehara M (1991) ... two invariant residues in Escherichia coli ribonuclease HI Protein Eng 9, 8 57 8 67 Haruki M, Tanaka M, Motegi T, Tadokoro T, Koga Y, Takano K & Kanaya S (20 07) Structural and thermodynamic analyses ... (1998) p-Stacking interactions Alive and well in proteins J Biol Chem 273 , 15458–15463 Kashiwagi T, Jeanteur D, Haruki M, Katayanagi M, Kanaya S & Morikawa K (1996) Proposal of new catalytic roles...
- 11
- 648
- 0
Báo cáo khoa học: Prediction of missing enzyme genes in a bacterial metabolic network Reconstruction of the lysine-degradation pathway ofPseudomonas aeruginosa doc
... PA15 87 PA1591 PA1593 PA1585 PA1594 PA1592 PA1589 PA1 579 PA1595 PA0265 PA0266 PA1584 PA15 97 PA1599 PA1582 PA1 578 PA1 576 PA 4330 PA1588 PA1581 PA1 571 PA1 570 PA0456 PA1603 PA1 577 PA1 573 PA1601 PA2013 ... predicting PA0266 as a putative 5-aminovalerate aminotransferase and PA0265 as a putative glutarate semialdehyde dehydrogenase Recently, a report has suggested candidate genes for 5-aminovalerate aminotransferase ... aminotransferase and glutarate semialdehyde dehydrogenase in the lysineA PA0266 2-Oxoglutarate B PA0265 Glutarate semialdehyde 5-Aminovalerate NADP+ Glutamate NADPH Absorbance at 340 nm 0.20 a...
- 12
- 441
- 0
Bell & Howell Information and Learning 300 North Zeeb Road, Ann Arbor, MI 48106-1346 USA 800-521-0600UMI.The Potential of Soil Survey Data in a Quantitative Evaluation of Surficial Geology Mapping in Northern Maine by Rosalia EvansThesis submitted t pptx
... terraces, 1on a kame, and on a kame terrace Glaciolacustrine originating as a blanket formation and a deltaic formation Colluvium originating on a kame terrace Organic swamp originating as a blanket ... gravelly loam Howland gravelly loam Howland very stony loam Howland very stony loam Machias gravelly loam Machias gravelly loam Machias gravelly loam Madawaska fine sandy loam Madawaska fine sandy ... sandy loam Madawaska fine sandy loam Made land Mapleton shaly silt loam Mapleton shaly silt loam Mapleton shaly silt loam Mixed alluvial land Monarda and Burnham silt loams Monarda and Burnham silt...
- 131
- 599
- 0
a study on the impact of cost reduction measures in a chieving the competitive advantages in footwear industry
... considered as a set of practice and body of knowledge that its primary tasks are recording transaction, keeping financial record, reporting and analyzing financial information to managers, and sometimes ... accounting information to unify in a general accounting system It is useful for manager as well as companies 2.1.2 The main functions of accounting Accounting always plays a vital role in organization’s ... fixed assets and increase items of financial investments significantly in the end of 2010 The cause of the changing ratio of fixed assets in total assets was due in 2010 the company has invested in...
- 62
- 489
- 0
research on awareness and implementation of corporate social responsibility in a multinational company in vietnam case study nestle vietnam
... can thereby have an inclusive financial, commercial and social approach, leading to a long term and strategy minimizing risks linked to uncertainly 1.1.3 CSR in multinational companies operating ... implementation, CSR reporting of CSR in a multinational company operating in Vietnam by asking respondents‟ understanding and opinion From conducting research, it can show the understanding and awareness ... activities that have a social impact” The basing of environmental and social accounting had increased the complexity of the traditional view by embracing both external and internal stakeholders, along...
- 73
- 705
- 2
How to attract interests and involvement of the 9th graders in a speaking lessons at Minh Thanh secondary in Quang Ninh
... clear What is about games? “Games are often more attractive than the others because it attracts a lot of participants in a class and makes a class more interesting” a student said Playing games ... or memorization of conversations In fact, speaking activities in a traditional classroom often take place, in the way of one person asking a question and another giving an answer As a result, ... attitude of students and teachers toward English teaching and learning in general and a speaking lesson in particular To get more information about the situation of teaching speaking skill in 9th...
- 119
- 525
- 1
Báo cáo khoa học: "Speakers’ Intention Prediction Using Statistics of Multi-level Features in a Schedule Management Domain" ppt
... (Goddeau, 1996), and a plan-based model (Litman, 19 87) However, a finite-state model has a weak point that dialogue flows should be predefined Although a plan-based model can manage complex dialogue ... of speakers’ intentions; a pair of a current intention and a next intention) that are extracted from a sequence of utterances in a current dialogue • Domain knowledge-level feature: In a goaloriented ... such as clue words, previous intentions, and a current state of a domain frame Statistical prediction of speakers’ intentions 2.1 Generalization of speakers’ intentions In a goal-oriented dialogue,...
- 4
- 307
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008