... Molnes et al 250 A H5 CRII (β8) H17 H6 Dihedral angles (Δϕ + Δ Δψ) 200 V 455 150 R447 L 451 100 50 K 458 ** D2 05 50 –100 *N204 and D2 05 E216 – 150 180 190 200 H6 Residue number B C Fig (A) Torsion angle ... (nmolÆmg)1Æs)1) kcat (s)1) [S]0.5a (mM) kcat ⁄ [S]0 .5 (mM)1Æs)1) n Ha Wild-type W99F W167F W 257 F 7 95 616 229 55 4 60.4 46.8 17.4 42.1 8.4 6.2 55 .2 11.4 7.2 7 .5 0.3 3.7 1.71 1. 75 1.12 1.66 a ± ± ± ± 12 ... [27–29] Two of these (Y214C and Y215A) are localized in helix and three (V 455 M, A 456 V and A460R) in helix 17, and some of these missense mutations (e.g Y215A and V 455 M) perturb the hydrophobic...
Ngày tải lên: 30/03/2014, 04:20
... numbers NC_0090 25, EU436 455 , EU436 456 , EU436423, NC_004807, AY 053 3 75, AY 053 374, AY 053 372, AF486072, AY 053 367, AY 053 370, AY 053 366, AY 053 368, AF486073, AY 053 371 and NC_00 254 8) (A2) The corresponding ... represent the region of the putative protein that is subject to the strongest amino acid constraints The MLOGD statistics, on the other hand, indicate that the positive coding signature in the +1 ... panels 8-11) Due to the overall high conservation, the absolute MLOGD scores tend to be low within the ORFX region (since there are fewer substitutions with which to discrimate the null or non-coding...
Ngày tải lên: 12/08/2014, 04:20
Học tiếng anh qua hội thoại Friends 2 the one after the super bowl
... tiệc tùng 45: 05 - He s moved on That s the way it goes, right? = Nó quên tớ Đời thế, phải không 45: 10 - Oh, 45: 12 my - 45: 18 Looks - Left 45: 25 - 45: 36 - Or 45: 39 - Until 45: 44 - And 45: 53 all - ... 17 :50 - I saw you today, kissing in the doctor s lounge = Tôi nhìn thấy hôm người hôn phòng nghỉ bác sỹ 17 :55 - It s not what you think = Không phải em nghĩ đâu 17 :56 - You told me I was the ... tonight 23:27 - In the jungle The mighty jungle = In the jungle The mighty jungle 23:30 - 24:03 The - lion Excuse sleeps me, tonight this = is The a = lion Xin sleeps lỗi, tonight 24: 05 - Closed set...
Ngày tải lên: 11/04/2015, 21:32
Unit 3: A trip to the countryside (5 tiet)
... banyan tree is at the entrance to the village They saw the shrine of Vietnamese hero on the mountain They had a picnic on the river bank Liz took a lot of photo to show the trip to her parents ... photos to show the trip to her parents ) T - Read the text again and answer the questions *Answer key It is 60 kilometers to the north of Ha Noi Ba and his family got to the village by bus The ... listen to a passage which describes the way from Ba,s house to his home village - Ask Ss to predict the names and the places in the map - Write their predictions on the board - Turn on the tape...
Ngày tải lên: 05/09/2013, 06:10
Tài liệu The complete guide to the TOEFL iBT test part 5 doc
Ngày tải lên: 13/12/2013, 21:15
Tài liệu The Complete Guide to the TOEFL iBTI Listening part 5 doc
Ngày tải lên: 23/12/2013, 12:17
Tài liệu The complete guide to the toefl ibt writing part 5 ppt
Ngày tải lên: 23/12/2013, 12:17
Tài liệu The official guide to the new toefl ibt part 5 pptx
Ngày tải lên: 24/12/2013, 01:18
Tài liệu The Go Big Now Guide - 5 Steps to Make the Law of Attraction Key Work for You docx
... not for them Here’s the truth… The Law of Attraction is always working, whether you want to admit it or not The question isn’t IF the Law of Attraction is working The REAL question is if the Law ... tempted to focus on what you don’t want Then I’ll give you the tools to get the NEW message to your subconscious mind so that it knows you have changed your order So let’s recap… The first step is to ... what they desire, but they can’t figure out what their blocks are They can’t figure out what they really believe and focus on all day long Because the thing about the thoughts you think most of the...
Ngày tải lên: 24/12/2013, 13:15
Tài liệu A Guide to the Project Management Body of Knowledge Part 5 ppt
... of the important factors, instead of changing the factors one at a time The analysis of the experimental data should provide the optimal conditions for the product or process, highlighting the ... regardless of the unit’s title, may be provided to the project team, the management of the performing organization, the customer or sponsor, as well as other stakeholders not actively involved in the work ... parties, defined as the sender and the receiver The key components of the model include: • Encode To translate thoughts or ideas into a language that is understood by others • Message The output of...
Ngày tải lên: 24/12/2013, 19:15
Tài liệu The Complete Guide to the TOEFL IBT part 5 pptx
... town, right down the river from the factory This town has to spend a lot of its money to clean its water so people can drink it And some people get sick anyway and they have to go to the doctor ... You keep checking the thermometer to keep track of your temperature So then what happens? The alcohol boils and turns to vapor, to gas It goes up the column and then passes into the condenser We ... products from the shelves, put them in carts, and bring them to a check-out area at the front of the store And these days, there are self-service check-out areas where customers even serve as their own...
Ngày tải lên: 25/01/2014, 23:20
Tài liệu The complete guide to the toefl IBT reading part 5 docx
Ngày tải lên: 25/01/2014, 23:20
Tài liệu Delta''''s key to the next generation toefl test part 5 docx
Ngày tải lên: 26/01/2014, 10:20
Seminar: Sumary of the book “5 Steps to Speak A Language” doc
... have the following factors: • the context in which the word or phrase is placed • the content and topic to which the word or phrase is related • the emotion and/or sense of the speaker • the other ... ones that remain in the learners’ mind after they get exposed to a certain amount of the new language The acquiring process is similar to the way kids learn their mother tongue However, not everything ... speaking is not a simple process To express an idea verbally, the speaker has to coordinate various parts of his body from the brain to the tongue, the mouth, the lips, the breath and so on You may...
Ngày tải lên: 09/03/2014, 07:20
Báo cáo khoa học: Super life – how and why ‘cell selection’ leads to the fastest-growing eukaryote doc
... Multiplicity of the amino acid permeases in Saccharomyces cerevisiae FEBS Journal 276 (2009) 254 270 ê 2008 The Authors Journal compilation ê 2008 FEBS P Groeneveld et al 51 52 53 54 55 56 57 58 59 60 61 ... of the of cell metabolism to the same strictly related [32] or to rather diverse [33] extents The enzymes that need to be over-expressed to the same extent belong to a functional unit [34, 35] ... from 0. 05 to 0 .55 h)1 (Fig 3) The specic glucose uptake rates (qglu) ranged from 0.7 to 6.0 mmolặg)1ặh)1 for the lowest to the highest steady-state chemostat dilution rate, respectively In the pH-auxostat,...
Ngày tải lên: 16/03/2014, 04:20
Báo cáo khoa học: Mechanistic studies on bovine cytosolic 5¢-nucleotidase II, an enzyme belonging to the HAD superfamily doc
... 2968 .5 3 253 .6 3 457 .2 350 2.4 4023.6 634.2 654 .7 6 75. 9 1093.0 1433 .5 14 75. 8 155 4.1 1730.6 2 052 .6 2066.9 2178.2 2180.9 2968.1 3 253 .9 3 457 .0 350 1.9 ( 35 39) (52 2 52 6) (30–34) (178–186)CAM (51 6 52 6) (51 0 52 1) ... 634.6 654 .8 6 75. 7 1093 .5 1433.3 14 75. 4 155 4.6 1730.9 1901.0 2 052 .2 2067.0 2178.2 2180.8 2968.3 3 253 .5 3 456 .7 350 2.1 4023.4 7363.4 634.7 654 .9 6 75. 4 1093.2 1433.6 14 75. 4 155 4.7 1731.2 1901.3 2 052 .1 ... ()23–7) (497 52 6) (51 9 54 9)CAM (114–1 45) CAM (114–146)CAM (51 7 54 9)CAM (21 52 )CAM (51 4 54 9)CAM (171–187)CAM + (51 9 54 9)S-S (171–187)CAM + (51 7 54 9)S-S (171–187)CAM + (51 4 54 9)S-S the nature of the oxidized...
Ngày tải lên: 16/03/2014, 18:20
Báo cáo khoa học: A chloroplast RNA binding protein from stromal thylakoid membranes specifically binds to the 5¢ untranslated region of the psbA mRNA potx
... corresponding to positions )36 to +13 relative to the AUG); T7–36ntA5¢ (5 -GTAATACGACTCACTATAGG GTTTACGGAGAAATTAAAAC-3¢) and 2 054 ; M1RNA (sequence of the psbA mRNA corresponding to positions )36 to +13 ... M2dRNA (sequence of the psbA mRNA corresponding to positions )36 to +13 relative to the AUG with an exchange at positions )17 to ) 15 to C residues); T7-36ntA5¢ and psbA3¢mut3 (5 -GA TCCATGGTCATATGTTAATTTT ... and )17 to ) 15 (M2d RNA) (Fig 5A) These new mutant RNAs were used as competitor RNAs as described above As shown in Fig 5C, both M2c RNA and M2d RNA were able to reduce the RBP63 signal to the same...
Ngày tải lên: 17/03/2014, 11:20
Aids to the Examination of the Peripheral Nervous System, 5 docx
Ngày tải lên: 23/03/2014, 01:20