Báo cáo khoa học: A chloroplast RNA binding protein from stromal thylakoid membranes specifically binds to the 5¢ untranslated region of the psbA mRNA potx

A chloroplast RNA binding protein from stromal thylakoid membranes specifically binds to the 5¢ untranslated region of the psbA mRNA Friedrich Ossenbu¨hl*, Kristina Hartmann and Jo¨ rg Nickelsen Lehrstuhl fu ¨ r Allgemeine und Molekulare Botanik, Ruhr-Universita ¨ t Bochum, Bochum, Germany The intrachloroplastic localization of post-transcriptional gene expression steps represents one key determinant for the regulation of chloroplast development. We have character- ized an RNA binding protein of 63 kDa (RBP63) from Chlamydomonas reinhardtii chloroplasts, which cofraction- ates with stromal thylakoid membranes. Solubility proper- ties suggest that RBP63 is a peripheral membrane protein. Among RNA probes from different 5¢ untranslated regions of chloroplast transcripts, RBP63 preferentially binds to the psbA leader. This binding is dependent on a region com- prising seven consecutive A residues, which is required for D1 protein synthesis. A possible role for this newly discov- ered RNA binding protein in membrane targeting of psbA gene expression is discussed. Keywords: chloroplast gene expression; D1 synthesis; mem- brane targeting; RNA binding; thylakoid. Chloroplast gene expression within plant or algal cells has been shown to be dependent upon nuclear gene products, which are translated in the cytoplasm and, subsequently, are imported by the organelle. Herein, they fulfil their function by interacting with distinct elements and/or factors associ- ated with the chloroplast gene expression machinery [1,2]. While the molecular mechanisms of regulatory interaction during these processes are being pieced together, relatively little is known about the intrachloroplast localization of different steps of gene expression. For instance, the chloroplast DNA is organized in nucleoids. In developing higher plants, these are associated with the inner plastid envelope through the PEND protein. Upon full chloroplast maturation, the cpDNA is localized to thylakoid membranes by an undetermined mechanism [3]. This suggests that the plastid transcription machinery is distributed in a similar way. Further evidence for subcom- partmentalization of chloroplast gene expression has been obtained by the recent cloning of genetically defined loci, which are required for distinct post-transcriptional steps of chloroplast gene expression. These factors could be detected in the stromal compartment like Crp1 and Crs2 in maize [4,5], or Maa3, Mbb1 and Nac2 in Chlamydomonas reinhardtii [6,7,8], which are involved in processing/splicing or stabilization of specific chloroplast transcripts, respec- tively. Conversely, association with the inner plastid enve- lope and/or the so-called low density membranes (LDM), which resemble the inner envelope membrane with regard to their lipid composition [9], has been observed for the translation termination factor RF4 from spinach and the RNA splicing factor Maa2 from C. reinhardtii [10,11]. By application of in vitro run-on translation systems, a cotranslational insertion of thylakoid membrane proteins has been reported [12]. This is consistent with the finding that chloroplast psbA and psbD transcripts are associated with thylakoids [13,14]. Further evidence for an essential role of the thylakoid membrane for chloroplast gene expression was deduced from the analysis of a maize mutant lacking the chloroplast SecY homologue of the thylakoid protein translocation machinery. In this mutant, chloroplast translation is defective [15]. Moreover, in vitro assays revealed a still growing number of various RNA binding proteins (RBPs), which have been implicated in the control of post-transcriptional gene expression steps. Some of these RBPs appear to mediate their function via distinct cis-acting elements within the 5¢ untranslated regions (UTRs) of plastid mRNAs, which are essential for mRNA maturation/stabilization and/or trans- lation initiation [16–20]. Whereas some of these RNA binding activities are localized to the chloroplast stroma [18,21], recent work suggests that many other RBPs are associated with the abovementioned LDM system [9]. In C. reinhardtii,the5¢ UTR of the psbA mRNA encoding the D1 protein of the photosystem (PS) II reaction centre was shown to interact with RB47, a member of the polyA-binding protein family, which forms a complex with major proteins of 38, 55 and 60 kDa [22]. RB60 represents a protein disulfide isomerase that exhibits no RNA binding activity, but is involved in the light and/or redox regulation of D1 synthesis. RB47 was localized to the LDM system [9] and, in addition, RB60 was shown to be partitioned between the stroma and the membrane phase following chloroplast fractionation experiments [23]. We have previously reported on a set of chloroplast RBPs, which interact with the 5¢ UTR of the psbD mRNA encoding the D2 protein of PS II of C. reinhardtii. Amongst those, a protein of 63 kDa (RBP63) cofractionated with thylakoid membranes during separation of chloroplast lysates by sucrose step gradient centrifugation [18]. In this Correspondence to J. Nickelsen, Lehrstuhl fu ¨ r Allgemeine und Mole- kulare Botanik, Ruhr-Universita ¨ t Bochum, 44780 Bochum, Germany. Fax: + 49 2343214184, Tel.: + 49 2343225539, E-mail: joerg.nickelsen@ruhr-uni-bochum.de Abbreviations: LDM, low density membranes; RBP, RNA binding protein; UTR, untranslated region; PS, photosystem. *Present address: Department fu ¨ r Biologie I, Ludwig-Maximilians Universita ¨ t, Menzinger Str. 67, 80638 Mu ¨ nchen, Germany. (Received 13 March 2002, revised 7 June 2002, accepted 19 June 2002) Eur. J. Biochem. 269, 3912–3919 (2002) Ó FEBS 2002 doi:10.1046/j.1432-1033.2002.03057.x report, this particular protein is characterized further. We were able to show that RBP63 is a stromal thylakoid membrane protein. It preferentially binds to the 5¢ UTR of the psbA message determined by an A-rich region eight nucleotides upstream of the AUG start codon. To the best of our knowledge, this is the first RNA binding activity found exclusively within thylakoid membranes. MATERIALS AND METHODS Algal strains, preparation of protein fractions and western analysis The C. reinhardtii strain used harboured the cw15 mutation, which facilitates chloroplast isolation. It was maintained on Tris/acetate/phosphate medium [24] at 25 °C and cultures weregrowntoadensityof2· 10 6 cells Æ mL )1 in this medium containing 1% sorbitol. Cells were harvested by centrifugation and chloroplasts and chloroplast subfrac- tions were prepared exactly as described previously [18]. For the separation of stroma and grana thylakoids, isolated unstacked thylakoid membranes were resuspended at 0.4 mgÆmL )1 chlorophyll in buffer B (15 m M tricine/ KOH pH 7.9, 0.1 M sorbitol, 10 m M NaCl, 5 m M MgCl 2 , 10 m M NaF) and incubated for 30 min at 4 °C to allow for restacking [25]. Subsequent fractionation was carried out as described previously [26]. In brief, restacked thylakoid membranes were incubated with 0.4% digitonin in buffer B for 2 min at room temperature. The incubation was stopped by adding 10 vol. buffer B. The suspension was centrifuged four times at 4 °C. Each supernatant was used for the next centrifugation step. The relative acceleration rates were 1000 g for10min,10000g for30min,40000g for 30 min and 150 000 g for 1 h. The different pellets corresponding to thylakoid membranes (P 1000g ), grana thylakoids (P 10000g ), intermediate membranes (P 40000g ) and stroma thylakoids (P 150000g ) were resuspended in 2 · lysis buffer, diluted with 75% glycerol and stored at )20 °C [18]. Western analyses were carried out as described previously [18]. Protein and chlorophyll concentrations were deter- mined as described previously [27,28]. Membrane solubilization analysis For membrane solubilization analysis, isolated thylakoid membranes corresponding to 1 mg chlorophyll were incu- bated as indicated in Fig. 2 at 4 °C for 30 min and centrifuged at 100 000 g for 1 h. The pellets were resus- pended in 2 · lysis buffer. NaCl in the supernatants of the salt washes was removed by centrifugation through ultrafree centrifugal filter (Millipore Corporation). All fractions were diluted with 75% glycerol and stored at )20 °C. Equal amounts of the soluble and the membrane fractions corresponding to 1 lg chlorophyll of untreated thylakoid membranes were analysed by UV cross-linking assay. Sedimentation analysis For sedimentation analysis of RBP63 activity, isolated chloroplasts were hypotonically lysed in buffer containing 5m M 6-amino hexanoic acid, 25 lgÆmL )1 pepstatin A, 10 lgÆmL )1 leupeptin, 1 m M benzamidine HCl and 1 m M phenylmethanesulfonyl fluoride. After centrifugation for 1 h at 100 000 g the sedimented membranes were solubi- lized in the same buffer containing 0.5% Triton X-100, loaded on a 15–80% linear glycerol gradient and centrifuged for 18 h at 180 000 g. The gradient was fractionated into 22 fractions of 500 lL; 10 lL of these fractions were used for UV cross-linking experiments. In vitro synthesis of RNA and UV cross-linking of RNA with proteins Templates for the in vitro synthesis of psbD leader RNA probes, KS-RNA, and psbC-RNA were generated as described [9,18]. A PCR fragment comprising positions +1041 to +1157 relative to the AUG of the psbA mRNA (corresponding to the coding region of the C-terminal amino acids of D1 and the 3¢ UTR of the psbA mRNA) was amplified with the oligonucleotides psbA3/1 (5¢-CTCTAGC TCAAACAACT-3¢)andpsbA3/2 (5¢-GCCTATGGTAGC TATTA)3¢) and cloned into the pBluescriptII KS + vector. The resulting clone, p41.a9, was sequenced (MWG-Biotech AG, Ebersberg, Germany). For in vitro synthesis of the psbA 3¢ UTR RNA (psbA3¢ RNA), p41.a9 was digested with EcoRI. Other templates for in vitro synthesis of the different 5¢ UTR RNAs were generated by PCR with the following oligonucleotides: psbA RNA (wild-type sequence of the psbA mRNA corresponding to positions )91 to +13 relative to the AUG); T7-psbA5¢ (5¢-GTAATACGACTCA CTATAGGGTACCATGCTTTTAATAGAAG-3¢)and 2054 (5¢-GATCCATGGTCATATGTTAATTTTTTTAA AG-3¢); )36-RNA (wild-type sequence of the psbA mRNA corresponding to positions )36 to +13 relative to the AUG); T7–36ntA5¢ (5¢-GTAATACGACTCACTATAGG GTTTACGGAGAAATTAAAAC-3¢) and 2054; M1- RNA (sequence of the psbA mRNA corresponding to positions )36 to +13 relative to the AUG with an exchange at positions )27 to )19 to C residues); psbA-T7mut1 (5¢-GT AATACGACTCACTATAGGGTTTACGGAGCCCCC CCCCC-3¢)andpsbA3¢mut1 (5¢-GATCCATGGTCATAT GTTAATTTTTTTAAAGGGGGGGGGGC-3¢); M2- RNA (sequence of the psbA mRNA corresponding to positions )36 to +13 relative to the AUG with an exchange at positions )14 to )4 to C residues): T7-36ntA5¢ and psbA3¢mut2 (5¢-GATCCATGGTCATATGGGGGGGG GGGGAAAGTTTTAATTTC-3¢); M2a-RNA (sequence of the psbA mRNA corresponding to positions )36 to +13 relative to the AUG with an exchange at positions )17 to )12 to C residues); T7-36ntA5¢ and psbA3¢mut2a (5¢-GATCCATGGTCATATGTTAATTTTGGGGGGG TTTTAATTTC-3¢); M2b-RNA (sequence of the psbA mRNA corresponding to positions )36 to +13 relative to the AUG with an exchange at positions )11 to )8toC residues); T7-36ntA5¢ and psbA3¢mut2b (5¢-GAT CCATGGTCATATGTTAAGGGGTTTAAAGTTTTA ATTTC-3¢); M2c-RNA (sequence of the psbA mRNA corresponding to positions )36 to +13 relative to the AUG with an exchange at positions )7to)4 to C residues); T7-36ntA5¢ and psbA3¢mut2c (5¢-GATCCATGGTCATA TGGGGGTTTT TTTAAAGTTTTAATTTC-3¢); M2d- RNA (sequence of the psbA mRNA corresponding to positions )36 to +13 relative to the AUG with an exchange at positions )17 to )15 to C residues); T7-36ntA5¢ and psbA3¢mut3 (5¢-GA TCCATGGTCATATGTTAATTTT TTTGGGGTTTTAATTTC-3¢); psbB-RNA (wild-type Ó FEBS 2002 Protein binding to the psbA 5¢ UTR (Eur. J. Biochem. 269) 3913 sequence of the psbB mRNA corresponding to positions )147 to +24 relative to the AUG): T7-psbB5¢ (5¢-GTAATACGACTCACTATAGGGTAAATTAATT TAATTTAAAATC-3¢)andpsbB3¢ (5¢-TACACGATA CCAAGGTAAACC-3¢). Each template contained the pro- motor of the T7 RNA polymerase fused to the 5¢ end of the described fragments. In vitro transcription of RNA, UV cross-linking of RNAs with proteins and quantification of binding signals was carried out as described [18]. For competition experiments radiolabelled RNA and non- labelled competitors were mixed prior to the addition of proteins. Quantification of competitor RNA amounts was performed by measuring the incorporation of low levels of radioactivity into transcripts [18]. Signal intensities in com- petition binding experiments were quantified densitometri- cally by using an ICU-1 unit and the IMAGE DOC / EASY WIN 2 software from Herolab. RESULTS RBP63 cofractionates with stromal thylakoids Previously, we have analysed interactions of chloroplast proteins with the 5¢ UTR of the psbD mRNA in C. rein- hardtii [18]. Chloroplast lysates were fractionated by centrifugation through a 1.0 M sucrose cushion in the absence of MgCl 2 . Under these experimental conditions, neither stroma nor LDMs entered the cushion [9,18], and could be collected together in one fraction, which contained the majority of RBPs (Fig. 1A, lane 3). By using the UV cross-linking technique, RNA binding activities of 40, 63 and 90 kDa were detected in cT fractions representing crude thylakoid membranes, which sedimented through the sucrose cushion (Fig. 1A, lane 4). After further purification of these membranes by flotation in a second sucrose step gradient (1.3 M /1.8 M sucrose) and subsequent washing by sedimentation [18], only the 63 kDa (RBP63) and trace amounts of the 90 kDa species were detectable (Fig. 1A, lane 5). This suggests that RBP63 is associated with thylakoid membranes, while RBP40 and RBP90 represent stromal contamination of the cT fraction, which still contained substantial amounts of the stromal Rubisco enzyme (Fig. 1C). However, a signal in the range of 63 kDa was also detected in the stromal fraction (Fig. 1A, lane 3). To test, whether this activity represents stroma-localized RBP63, high resolution SDS/PAGE was performed. As shown in Fig. 1B, the stromal component is approximately 61 kDa (RBP61) in size and, thus, distinctly different from RBP63. Further evidence supporting this finding was obtained from sedimentation analyses, which demonstrated that RBP61 and RBP63 are part of two different high molecular weight complexes of  450 kDa and  700 kDa, respectively (Fig. 1E, fractions 5 and 9–15, respectively). From these data, it can be concluded that active RBP63 is associated exclusively with the thylakoid membrane and is not partitioned between the stroma and the thylakoids. Thylakoid membranes can be divided into stroma lamellae and stacked grana regions. To test whether RBP63 shows any selective accumulation within these thylakoid membrane subfractions, appressed grana and unappressed intermediate and stroma thylakoids were separated by differential centrifugation following digitonin treatment as described earlier [26]. As shown in Fig. 1D, RBP63 activity was found to be significantly enriched in the stromal thylakoid membrane fraction together with the CF1 subunit of the chloroplast ATPase and the PsaD subunit of PS I, which serve as marker molecules for stromal thylak- oids [29]. Low amounts of RBP63 were detectable in the intermediate fraction, whereas PS I and ATPase already showed a significant enrichment. In view of actual models of the domain structure of the photosynthetic membrane it Fig. 1. Fractionation pattern of RBP63. Chloroplast lysate (A) and -subfractions (C) were analysed by UV cross-linking to the psbD 5¢ UTR-RNA. (B) The stromal (S) and the crude thylakoid membrane fraction (cT) were analysed as in (A), but proteins were separated on an 8% instead of a 10% acrylamide/SDS gel. The sizes of marker proteins are indicated in kDa. P, Protein-free control; T, thylakoid membrane fraction. (C) Chloroplast fractionation was controlled by Western analysis with antibodies against Rubisco (RbcL), PS I (PsaD) and ATP-synthase (CF1). (D) Floated thylakoid membranes (T) were isolated and separated into grana (GT), intermediate (IT), and stroma (ST) thylakoids. Identical amounts of chlorophyll were either analysed by UV cross-linking using the psbD-RNA (2 lg chlorophyll) or by Western analysis (20 lg chlorophyll) with antibodies against PS I (PsaD) and ATP-synthase (CF1). (E) Chloroplast lysates were centrifuged on a linear 15–80% glycerol gradient. Given fractions were analysed by UV cross-linking with the psbD RNA. Sedimentation of marker proteins (in kDa) is indicated at the top. The arrows point to RBP63, and RBP61 is marked by asterisks. 3914 F. Ossenbu ¨ hl et al. (Eur. J. Biochem. 269) Ó FEBS 2002 appears likely that the intermediate fraction might be enriched in thylakoid margin regions which constitute a distinct subdomain and contain amounts of PS I and ATPase similar to stromal thylakoids [29]. However, the data clearly indicate that RBP63 does not cofractionate with the grana thylakoid membranes. To test the nature of the association between RBP63 and thylakoids, membranes were washed with high salt (0.1– 2.0 M NaCl) or with buffer containing 0.1–2.0% of either detergent Brij 35 or Triton X-100. Salt treatment did not induce any release of RBP63 into the soluble phase, although some activity was lost in the membrane phase, probably due to degradative processes during extensive washing of membranes which was required to completely remove NaCl (Fig. 2A). In contrast, complete release was observed with high concentrations (2.0%) of Brij 35. This nonionic detergent preferentially dissolves peripheral/ex- trinsic membrane proteins because of its high hydrophilic- lipophile balance number [30,31]. Under these conditions, chlorophyll could not be measured in the supernatants (Fig. 2B) demonstrating that intrinsic membrane proteins are not dissolved [32]. By using Triton X-100, both chlorophyll and RBP63 were readily detected in the supernatant fraction. Complete release of chlorophyll was achieved with high concentrations (1.0%) of Triton X-100, whereas only low concentrations (0.1%) were required to release all RBP63 activity (Fig. 2C). Taken together, these results indicate that RBP63 is a membrane protein of thylakoids. It might be peripherally associated with the membrane via a hydrophobic polypeptide anchor, as has been suggested for thylakoid phosphatases from C. reinhardtii [33]. RBP63 preferentially binds to the psbA 5¢ UTR Initially, RBP63 was detected by using a radiolabelled RNA probe containing the psbD 5¢ UTR. However, other tested radiolabelled 5¢ UTR-probes from the psbA mRNA (Fig. 3A) or psbB, psbC, rbcL and rps4 mRNAs (data not shown) were also able to generate a similar RBP63 signal under noncompetitive and, hence, unphysiological condi- tions. To distinguish between different affinities of RBP63 to the various RNAs, comparative competition experi- ments were performed. These used radiolabelled psbD- RNA and an excess of unlabeled 5¢ UTR RNA probes from other chloroplast mRNAs encoding subunits of the PS II core, including psbA, psbB,andpsbC.ThepsbB, psbC and even the psbD RNA exhibited only moderate and nearly the same competition effects. However, surprisingly, a very strong reduction of the RBP63 signal was obtained when the psbA RNA was used as a competitor (Fig. 3B), thus suggesting a high affinity of RBP63 for the psbA 5¢ UTR RNA. Consequently, competition experiments similar to those described in Fig. 3B were performed, except that psbA 5¢ UTR was used in place of psbD as the radiolabelled probe. Again, the homologous psbA RNA led to the most significant competition effect, whereas the addition of an excess of psbB, psbC,andpsbD RNAs resulted in only minor competition (Fig. 3C). Additional RNAs were tested and included the 5¢ UTRs of rbcL and rps4 mRNAs as well as an unrelated in vitro transcript comprising the polylinker region of the pBluescript KS + vector, which competed at low levels in the same range (data not shown). Similar to several other chloroplast RNA binding proteins, RBP63 exhibited a high affinity for the ribohomopolymers polyA and polyU, whereas polyG and polyC were not recog- nized (data not shown). Also the addition of a 500-fold excess of dsDNA from the psbA 5¢ region had no effect on RBP63-binding (data not shown). In conclusion, these data confirm the high affinity of RBP63 for the psbA leader. Analysis of the cis -acting determinants for RBP63-binding Within chloroplasts of C. reinhardtii, two forms of the psbA mRNA exist: a larger form with a 5¢ UTR of 91 nucleotides (which had been used in the binding assays shown in Fig. 3C) and the predominant, shorter form with a leader of 36 nucleotides (Fig. 5A) [34,35]. It has been hypothesized that the larger form represents the precursor to the shorter mRNA which is generated by a 5¢ processing event [36]. Similar to the situation found for psbD and psbB gene expression [37,38], a tight molecular connection between processes of 5¢ RNA maturation and translation initiation had been postulated for the psbA gene [36]. In order to distinguish whether RBP63 also binds to the shorter psbA message, further comparative competition experiments were carried out by using the two different psbA 5¢ UTR forms as unlabeled competitors. The two RNAs reduced the RBP63 signal with almost the same efficiency indicating that RBP63 recognizes the psbA mRNA via an element located between position )36 and +1 of its leader (Fig. 4). In contrast, an RNA probe covering the psbA 3¢ UTR competed only to a low level (Fig. 4). Fig. 2. Association of RBP63 with thylakoid membranes. Thylakoid membranes were incubated with NaCl (A), Brij35 (B) and Triton X-100 (C) as indicated. The soluble (S) and the membrane phases (M) were separated and analysed by UV cross-linking assays with the psbD RNA. The relative amounts of chlorophyll released into the soluble phases during the treatments are indicated (Chl). Ó FEBS 2002 Protein binding to the psbA 5¢ UTR (Eur. J. Biochem. 269) 3915 For further examination of the cis-acting determinants, which are essential for RBP63 binding, we generated several mutant versions of the shorter psbA 5¢ UTR.Basedonthe observation that RBP63 exhibits high affinity to stretches of A and U residues, the two A-rich regions at position )27 to )19 (A-tract 1) and position )14 to )4(A-tract2)relative to the AUG start codon of the psbA leader were changed into C-tracts, resulting in the mutant RNAs M1 and M2, respectively (Fig. 5A). When these mutant RNAs were used as competitor RNAs in competition experiments, M1-RNA still reduced the RBP63 signal as efficiently as did )36-RNA (Fig. 5B) suggesting that A-tract 1 is not essential for RBP63 binding. In contrast, a significantly weaker compe- tition effect was observed with M2 RNA, indicating that crucial cis-acting determinants for RBP63-binding activity are located within A-tract 2. To analyse these in more detail, four additional leader mutants of A-tract 2 were generated, which contained C-tracts localized at positions )17 to )12 (M2a RNA), )11 to )8(M2bRNA),)7to)4(M2cRNA)and)17 to )15 (M2d RNA) (Fig. 5A). These new mutant RNAs were used as competitor RNAs as described above. As shown in Fig. 5C, both M2c RNA and M2d RNA were able to reducetheRBP63signaltothesamedegreeaswild-type )36-RNA. Addition of either M2a RNA or M2b RNA, however, caused only weak competition effects in the range of those obtained with M2 RNA. This indicated that RBP63 binding to the psbA leader is determined mainly by the tract of seven A residues located between position )14 and )8 relative to the AUG start codon. DISCUSSION In this study, we report on the identification and character- ization of the chloroplast RNA binding protein RBP63, which is part of a high molecular weight complex of  700 kDa. RBP63 exhibits a high affinity for the 5¢ UTR of the psbA message when compared to various different 5¢ UTRs of chloroplast genes. Moreover, its binding activity in vitro is dependent on a tract of seven consecutive A-residues located 14–8 nucleotides upstream of the psbA AUG start codon. Based on the fact that chloroplast mRNAs often contain long stretches of A residues, it appears unlikely that Fig. 3. RBP63 binds with high affinity to the psbA 5¢ UTR. (A) Floated thylakoid membranes were analysed by UV cross-linking assays with radiolabelled 5¢ UTR probes of either the psbD or the psbA mRNA (psbD-andpsbA-RNA, respectively). (B) cT-fractions were incubated with radiolabelled psbD-RNA and a 5-, 50-, or 500-fold molar excess of the indicated competitor RNAs representing the 5¢ UTR RNAs of the psbA, psbB, psbC and psbD mRNA.(C)Asin(B)exceptthatpsbA RNA instead of psbD RNA was radiolabelled. Each diagram displays the intensities of RBP63 signals in relation to the RBP63 signal without competitor from one representative experiment, in which the exposure time was the same for all lanes. Fig. 4. RBP63 binds to the short psbA leader form. Competition experiments similar to those described in Fig. 3C were performed by using the larger (psbA) and the shorter ()36) psbA 5¢ UTR (Fig. 5A) as well as the psbA 3¢ UTR. 3916 F. Ossenbu ¨ hl et al. (Eur. J. Biochem. 269) Ó FEBS 2002 thisA-stretchonitsownisalreadysufficienttomediatehigh affinity binding of RBP63. Rather, additional cis-acting determinants, such as the secondary structure of the leader, for example, might facilitate site-specific RNA recognition by RBP63, similar to RNA–protein complex formation in other systems [20,39]. Nevertheless, the A-rich region had previously been shown to be required for D1 synthesis in C. reinhardtii. In the chloroplast transformant RBS11, deletion of the sequence between position )26 and )11 led to the elimination of psbA mRNA translation in vivo, whereas the stability and 5¢ maturation of the message were unaffected (Fig. 5A) [36]. As the deletion in the translational RBS11 mutant covers four of the seven A residues of the psbA leader that are essential for RBP63-binding, a corre- lation between RNA binding activity in vitro and transla- tional activity in vivo becomes obvious. Thus, we speculate that RBP63 might be involved in the translational control of psbA gene expression in C. reinhardtii. This resembles the situation found for the regulation of translation initiation of the psbD gene in chloroplasts of C. reinhardtii. In the case of the psbD 5¢ UTR, a U-rich element located 25 to 14 nucleotides upstream of its AUG start codon was shown to be required for translation but not for RNA stabilization or 5¢ maturation [38]. This region is recognized by a stromally localized 40 kDa protein (RBP40), which has been postu- latedtobeinvolvedinD2synthesis[18]. In spinach, the ribosomal protein S1 has been shown to interact with A- or U-rich sequence elements within the psbA 5¢ UTR [40]. In contrast, detailed competition binding experiments revealed that several other chloroplast RNA probes are also bound by S1 with the same affinity [41]. In C. reinhardtii, similar to Escherichia coli, the chloroplast S1 protein has a size in the range of 60 kDa [18], thus resembling RBP63. However, when thylakoid membrane proteins were analysed with a polyclonal antiserum against the E. coli S1 protein, no immunoreactive material was detected (data not shown). These data, as well as the fact that RBP63 binds with high affinity solely to the psbA leader strongly support the idea that these two factors are distinct, though, formally, we cannot exclude that RBP63 represents a membrane-bound version of the S1 protein. However, one of the most intriguing features of RBP63 is its association with stromal thylakoid membranes. To our knowledge, this represents the first example of a chloroplast RNA binding protein within thylakoids. While analyses of such proteins were initiated mainly from the soluble stromal phase, more recently a partitioning of various RBPs between the soluble and the membrane fraction was reported following the use of a radiolabelled RNA probe of the psbC 5¢ UTR in UV cross-linking experiments [9]. Further fractionation of the membrane phase revealed that the bulk of RBPs is specifically enriched (over 100-fold) within the above mentioned LDM, which can easily be separated from thylakoids by sucrose density centrifugation in the absence of MgCl 2 [9]. During the course of this work, stroma and LDM phase were not separated and, except for RBP63, all RBPs were detected in the stroma/LDM fraction by using either a psbD or a psbC 5¢ UTR probe (Fig. 1A; data not shown), indicating that the floated thylakoid membranes were not contaminated by LDM membranes (Fig. 1A, lane 5). It has been hypothesized that LDMs, which resemble the inner envelope with regard to their lipid composition, represent the sites of thylakoid membrane protein synthesis and that de novo formed photosynthetic complexes are transported via vesicles from the inner envelope to the thylakoids [42,43]. This appears to be consistent with the finding that many RBPs, which are likely to be involved in post-trancriptional gene expression steps in the chloroplast, cofractionate with LDMs. On the other hand, the repair mechanism of PS II in mature chloroplasts mainly involves the exchange of photo-damaged D1 protein by a newly Fig. 5. cis-acting determinants of RBP63 binding to the short psbA leader. (A) Sequence alignment of the larger (psbA) and the shorter ()36) psbA 5¢ UTRs from the wild-type and different mutated 5¢ UTR versions. Asterisks represent conserved residues. Positions rela- tive to the initiation codon and the 5¢ pro- cessing site (vertical arrow) are marked above the sequence. The region that has previously been deleted in the chloroplast mutant RBS11 [34] is boxed. (B and C) Competition experi- ments were carried out similar to those described in Fig. 3C by using the indicated RNAs. Each diagram displays the intensities ofRBP63signalsinrelationtotheRBP63 signal without competitor from one represen- tative experiment, in which the exposure time was the same for all lanes. Competition with M2d-RNA was performed independently and, thus, RBP63 signals were quantified in rela- tion to the 0x value given in the respective M2d-RNA lane. Ó FEBS 2002 Protein binding to the psbA 5¢ UTR (Eur. J. Biochem. 269) 3917 synthesized one and has been localized to the stroma lamellae of thylakoid membranes. Subsequently, intact PS II is moving to its functional localization in the grana regions [44]. Assuming a cotranslational insertion of D1 [45], it appears likely that gene expression for this repair mechanism is restricted to the subfraction of the stromal thylakoid membranes, especially, as the tightly stacked grana regions would not allow access of the RNA polymerase, ribosomes or other soluble complexes involved in chloroplast gene expression to the membrane. In conjunction with data obtained from yeast mitochondria [46], this leads to the model of a molecular tether, which localizes chloroplast transcripts encoding integral mem- brane proteins to stromal thylakoids [47,48]. RBP63 appears to be a good candidate for a molecular tether of chloroplast mRNAs. It combines properties, which have to be postulated for such a factor, namely, it is associated with stromal thylakoids and binds to RNA. In particular, the fact that RBP63 binds with high affinity to the psbA 5¢ UTR and might thereby target the mRNA at stromal thylakoid membranes is striking, as most translational activity in mature chloroplasts is restricted to D1 synthesis due to constraintsofPSIIrepair[44]. In conclusion, two different processes of PS II generation have to be considered, which might overlap in time: the de novo assembly in premature developing chloroplasts and the mechanisms, which are involved in PS II maintenance in mature chloroplasts [49]. Based on available data and actual hypotheses, we hence propose the following scenario for the control of psbA gene expression in C. reinhardtii. In devel- oping chloroplasts, psbA mRNA translation is regulated via its 5¢ UTR in a light and/or redox-controlled manner by the previously described complex of RB47, RB60, RB38 and RB55. This process may take place at the LDM system, since it has been shown immunologically that RB47 is localized to this chloroplast subfraction [9]. Furthermore, RB60 has also been demonstrated to be partitioned between the soluble and membrane phase during chloroplast fractionation experi- ments, although no distinction between LDMs and thylak- oid membranes has been made during this analysis [23]. As RB60 exhibits no RNA binding activity in UV cross-linking experiments, it is clearly distinct from RBP63 which is described here [16]. If new D1 protein is required for the repair of PS II in mature chloroplasts, then psbA translation is targeted at the stromal thylakoid region by RBP63, which might interact with or replace the RB47/RB60 complex and promote the first assembly of ribosomes on the 5¢ UTR. In contrast with RB47 [22], the RNA binding activity of RBP63 is not significantly altered by the energy and/or redox status of the chloroplast (data not shown). However, the originat- ing nascent polypeptide chain compounded with ribosomes (the so-called ribosome nascent chain complexes) has then to be targeted at the D1 insertion point within the stromal thylakoids, a process which appears to be mediated by the chloroplast homologue of the 54 kDa signal recognition particle protein [50]. Although this model has still to be considered speculative, it is based on data that show for the first time that putative trans-acting regulatory factors of psbA mRNA translation initiation are localized in different membrane subcompart- ments of the chloroplast. Furthermore, it takes into account that two different pathways for D1 synthesis might exist strongly depending on the developmental stage of the chloroplast. ACKNOWLEDGEMENTS We thank T. Stratmann and T. Arndt for excellent technical assistance and U. Ku ¨ ck for providing laboratory space. Antisera against the Rubisco holoenzyme, the CF1 subunit of the chloroplast ATPase and PsaD were kindly provided by G. Wildner, R. Berzborn and J D. Rochaix, respectively. Plasmid pDH245 was a generous gift of W. Zerges. This work was supported by a grant from the Deutsche Forschungsgemeinschaft (SFB 480-TP B8). REFERENCES 1. Leon, P., Arroyo, A. & Mackenzie, S. (1998) Nuclear control of plastid and mitochondrial development in higher plants. Ann. Rev. Plant Physiol. Plant Mol. Biol. 49, 453–480. 2. Goldschmidt-Clermont, M. (1998) Coordination of nuclear and chloroplast gene expression in plant cells. Internat. Rev. Cytol. 177, 115–180. 3. Sato, N., Rolland, N., Block, M.A. & Joyard, J. (1999) Do plastid envelope membranes play a role in the expression of the plastid genome? Biochimie 81, 619–629. 4. Fisk,D.G.,Walker,M.B.&Barkan,A.(1999)Molecularcloning of the maize gene crp1 reveals similarity between regulators of mitochondrial and chloroplast gene expression. EMBO J. 18, 2621–2630. 5. Jenkins, B.D. & Barkan, A. (2001) Recruitment of a peptidyl- tRNA hydrolase as a facilitator of group II intron splicing in chloroplasts. EMBO J. 20, 872–879. 6. Rivier, C., Goldschmidt-Clermont, M. & Rochaix, J D. (2001) Identification of an RNA-protein complex involved in chloroplast group II intron trans-splicing in Chlamydomonas reinhardtii. EMBO J. 20, 1765–1773. 7. Vaistij, F.E., Boudreau, E., Lemaire, S.D., Goldschmidt-Cler- mont, M. & Rochaix, J.D. (2000) Characterization of Mbb1, a nucleus-encoded tetratricopeptide repeat-like protein required for expression of the chloroplast psbB/psbT/psbH gene cluster in Chlamydomonas reinhardtii. Proc. Natl Acad. Sci. USA 97, 14813– 14818. 8. Boudreau, E., Nickelsen, J., Lemaire, S.D., Ossenbu ¨ hl,F.& Rochaix, J.D. (2000) The Nac2 gene of Chlamydomonas reinhardtii encodes a chloroplast TPR-like protein involved in psbD mRNA stability. EMBO J. 19, 3366–3376. 9. Zerges, W. & Rochaix, J.D. (1998) Low density membranes are associated with RNA-binding proteins and thylakoids in the chloroplast of Chlamydomonas reinhardtii. J. Cell Biol. 140, 101–110. 10. Rolland, N., Janosi, L., Block, M.A., Shuda, M., Teyssier, E., Miege, C., Cheniclet, C., Carde, J.P., Kaji, A. & Joyard, J. (1999) Plant ribosome recycling factor homologue is a chloroplastic protein and is bactericidal in Escherichia coli carrying temperature- sensitive ribosome recycling factor. Proc. Natl Acad. Sci. USA 96, 5464–5469. 11. Perron, K., Goldschmidt-Clermont, M. & Rochaix, J.D. (1999) A factor related to pseudouridine synthases is required for chlor- oplast group II intron trans-splicing in Chlamydomonas reinhardtii. EMBO J. 18, 6481–6490. 12. Wollman, F.A., Minai, L. & Nechushtai, R. (1999) The biogenesis and assembly of photosynthetic proteins in thylakoid membranes. Biochim. Biophys. Acta 1411, 21–85. 13. Breidenbach, E., Jenni, E. & Boschetti, A. (1988) Synthesis of two proteins in chloroplasts and mRNA distribution between thyla- koids and stroma during the cell cycle of Chlamydomonas reinhardtii. Eur. J. Biochem. 177, 225–232. 3918 F. Ossenbu ¨ hl et al. (Eur. J. Biochem. 269) Ó FEBS 2002 14. Herrin, D. & Michaels, A. (1985) The chloroplast 32 kDa protein is synthesized on thylakoid-bound ribosomes in Chlamydomonas reinhardtii. FEBS Lett. 184, 90–95. 15. Roy, L.M. & Barkan, A. (1998) A SecY homologue is required for the elaboration of the chloroplast thylakoid membrane and for normal chloroplast gene expression. J. Cell Biol. 141, 385–395. 16. Danon, A. & Mayfield, S.P. (1991) Light-regulated translational activators: identification of chloroplast gene specific mRNA- binding proteins. EMBO J. 10, 3993–4001. 17. Zerges, W. & Rochaix, J D. (1994) The 5¢ leader of a chloroplast mRNA mediates the translational requirements for two nucleus- encoded functions in Chlamydomonas reinhardtii. Mol. Cell. Biol. 14, 5268–5277. 18. Ossenbu ¨ hl, F. & Nickelsen, J. (2000) Cis-andtrans-acting determinants for translation of psbD mRNA in Chlamydomonas reinhardtii. Mol. Cell. Biol. 20, 8134–8142. 19. McCormac, D.J., Litz, H., Wang, J., Gollnick, P.D. & Berry, J.O. (2001) Light-associated and processing-dependent protein binding to 5¢ regions of rbcL mRNA in the chloroplasts of a C4 plant. J. Biol. Chem. 276, 3476–3483. 20. Fargo, D.C., Boynton, J.E. & Gillham, N.W. (2001) Chloroplast ribosomal protein S7 of Chlamydomonas binds to chloroplast mRNA leader sequences and may be involved in translation initiation. Plant Cell 13, 207–218. 21. Nakamura, T., Ohta, M., Sugiura, M. & Sugita, M. (2001) Chloroplast ribonucleoproteins function as a stabilizing factor of ribosome-free mRNAs in the stroma. J. Biol. Chem. 276, 147–152. 22. Bruick, R.K. & Mayfield, S.P. (1999) Light-activated translation of chloroplast mRNAs. Trends Plant Sci. 4, 190–195. 23. Trebitsh,T.,Meiri,E.,Ostersetzer,O.,Adam,Z.&Danon,A. (2001) The protein disulfide isomerase-like RB60 is partitioned between stroma and thylakoids in Chlamydomonas reinhardtii chloroplasts. J. Biol. Chem. 276, 4564–4569. 24. Gorman, D.S. & Levine, R.P. (1965) Cytochrome f and plasto- cyanin: their sequence in the photosynthetic electron transport chain of Chlamydomonas reinhardtii. Proc. Natl Acad. Sci. USA 54, 1665–1669. 25. Ojakian, G.K. & Satir, P. (1974) Particle movements in chlor- oplast membranes: quantitative measurements of membrane fluidity by the freeze-fracture technique. Proc. Natl Acad. Sci. USA 71, 2052–2056. 26.Adir,N.,Shochat,S.&Ohad,I.(1990)Light-dependentD1 protein synthesis and translocation is regulated by reaction center II: reaction center II serves as an acceptor for the D1 precursor. J. Biol. Chem. 265, 12563–12568. 27. Smith, P.K., Krohn, R.I., Hermanson, G.T., Mallia, A.K., Gartner, F.H., Provenzano, M.D., Fujimoto, E.K., Goeke, N.M., Olson, B.J. & Klenk, D.C. (1985) Measurement of protein using bicinchoninic acid. Anal. Biochem. 150, 76–85. 28. Arnon, D.J. (1949) Copper enzymes in isolated chloroplast: polyphenoloxidase in Beta vulgaris. Plant Physiol. 24, 1–15. 29. Albertson, P.A. (2001) A quantitative model of the domain structure of the photosynthetic membrane. Trends Plant Sci. 6, 349–354. 30. Bhairi, S.M. (2001) A Guide to the Properties and Uses of Deter- gents in Biology and Biochemistry. Calbiochem-Novabiochem. Corporation, San Diego, CA, USA. 31. Jagow, G. & Scha ¨ gger, H. (1994) Membrane Protein Purification. Academic Press Inc, London. 32.Thornber,J.P.,Morishige,D.T.,Anandan,S.&Peter,G.F. (1991) Chlorophyll-carotenoid proteins of higher plant thylakoids. In Chlorophylls (Scheer, H., ed.), pp. 549–585. CRC Press, Boca Raton. 33. Matika, A. (1999) Die Regulation der Photosynthese Durch Pro- teinphosphatasen in Chlamydomonas Reinhardtii. Dissertation, Ruhr University, Bochum. 34. Erickson, J.M., Rahire, M. & Rochaix, J D. (1984) Chlamydo- monas reinhardii gene for the 32,000 mol. wt. protein of photo- system II contains four large introns and is located entirely within the chloroplast inverted repeat. EMBO J. 3, 2753–2762. 35. Nickelsen, J., van Dillewijn, J., Rahire, M. & Rochaix, J D. (1994) Determinants for stability of the chloroplast psbD RNA are located within ist short leader region in Chlamydomonas reinhardtii. EMBO J. 13, 3182–3191. 36. Bruick, R.K. & Mayfield, S.P. (1998) Processing of the psbA 5¢ untranslated region in Chlamydomonas reinhardtii depends upon factors mediating ribosome association. J. Cell Biol. 143, 1145– 1153. 37. Vaistij, F.E., Goldschmidt-Clermont, M., Wostrikoff, K. & Rochaix, J D. (2000) Stability determinants in the chloroplast psbB/T/H mRNAs of Chlamydomonas reinhardtii. Plant J. 21, 469–482. 38. Nickelsen, J., Fleischmann, M., Boudreau, E., Rahire, M. & Rochaix, J.D. (1999) Identification of cis-acting RNA leader ele- ments required for chloroplast psbD gene expression in Chlamy- domonas. Plant Cell 11, 957–970. 39. Klaff, P., Mundt, S.M. & Steger, G. (1997) Complex formation of the spinach chloroplast psbA mRNA 5¢ untranslated region with proteins is dependent on the RNA structure. RNA 3, 1468–1479. 40. Alexander, C., Faber, N. & Klaff, P. (1998) Characterization of protein-binding to the spinach chloroplast psbA mRNA 5¢ untranslated region. Nucleic Acids Res. 26, 2265–2272. 41. Shteiman-Kotler, A. & Schuster, G. (2000) RNA-binding char- acteristics of the chloroplast S1-like ribosomal protein CS1. Nucleic Acids Res. 28, 3310–3315. 42. Zerges, W. (2000) Translation in chloroplasts. Biochimie 82, 583–601. 43. Kroll, D., Meierhoff, K., Bechtold, N., Kinoshita, M., Westphal, S., Vothknecht, U.C., Soll, J. & Westhoff, P. (2001) VIPP1, a nuclear gene of Arabidopsis thaliana essential for thylakoid membrane formation. Proc. Natl Acad. Sci. USA 98, 4243–4248. 44. Erickson, J.M. (1998) Assembly of photosystem II. In The Molecular Biology of Chloroplasts and Mitochondria in Chlamydomonas (Rochaix, J.D., Goldschmidt-Clermont, M. & Merchant, S., eds), pp. 255–285. Kluwer Academic Publishers, Dordrecht. 45. Zhang, L., Paakkarinen, V., van Wijk, K.J. & Aro, E.M. (1999) Co-translational assembly of the D1 protein into photosystem II. J. Biol. Chem. 274, 16062–16067. 46. Fox, T.D. (1996) Genetics of Mitochondrial Translation: Transla- tional Control, Monograph Series 30. pp. 733–758. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York. 47. Rochaix, J.D. (1996) Post-transcriptional regulation of chloro- plast gene expression in Chlamydomonas reinhardtii. Plant Mol. Biol. 32, 327–341. 48. Hauser, C.R., Gillham, N.W. & Boynton, J.E. (1998) Regulation of chloroplast translation. In The Molecular Biology of Chloro- plasts and Mitochondria in Chlamydomonas (Rochaix, J.D., Goldschmidt-Clermont, M. & Merchant, S., eds), pp. 197–217. Kluwer Academic Publishers, Dordrecht. 49. Choquet, Y. & Vallon, O. (2000) Synthesis, assembly and degradation of thylakoid membrane proteins. Biochimie 82, 615–634. 50. Nilsson, R., Brunner, J., Hoffman, N.E. & van Wijk, K.J. (1999) Interactions of ribosome nascent chain complexes of the chloro- plast-encoded D1 thylakoid membrane protein with cpSRP54. EMBO J. 18, 733–742. Ó FEBS 2002 Protein binding to the psbA 5¢ UTR (Eur. J. Biochem. 269) 3919 . relative to the AUG): T7-psbB5¢ (5¢- GTAATACGACTCACTATAGGGTAAATTAATT TAATTTAAAATC-3¢)andpsbB3¢ (5¢- TACACGATA CCAAGGTAAACC-3¢). Each template contained the. T7 -psbA5 ¢ (5¢- GTAATACGACTCA CTATAGGGTACCATGCTTTTAATAGAAG-3¢)and 2054 (5¢- GATCCATGGTCATATGTTAATTTTTTTAA AG-3¢); )36 -RNA (wild-type sequence of the psbA mRNA corresponding