Báo cáo khoa học: A chloroplast RNA binding protein from stromal thylakoid membranes specifically binds to the 5¢ untranslated region of the psbA mRNA potx

Báo cáo khoa học: A chloroplast RNA binding protein from stromal thylakoid membranes specifically binds to the 5¢ untranslated region of the psbA mRNA potx

Báo cáo khoa học: A chloroplast RNA binding protein from stromal thylakoid membranes specifically binds to the 5¢ untranslated region of the psbA mRNA potx

... +13 relative to the AUG); T7 -psbA5 ¢ (5¢- GTAATACGACTCA CTATAGGGTACCATGCTTTTAATAGAAG-3¢)and 2054 (5¢- GATCCATGGTCATATGTTAATTTTTTTAA AG-3¢); )36 -RNA (wild-type sequence of the psbA mRNA corresponding to positions ... )36 to +13 relative to the AUG); T7–36ntA5¢ (5¢- GTAATACGACTCACTATAGG GTTTACGGAGAAATTAAAAC-3¢) and 2054; M1- RNA (sequence of the psbA mRNA corres...

Ngày tải lên: 17/03/2014, 11:20

8 338 0
Báo cáo khoa học: A novel retinol-binding protein in the retina of the swallowtail butterfly, Papilio xuthus docx

Báo cáo khoa học: A novel retinol-binding protein in the retina of the swallowtail butterfly, Papilio xuthus docx

... RBP purified from dark-adapted or light-adapted retinas, and analyzed by HPLC. The molar ratio of all-trans,11-cis and 13-cis 3-hydroxyretinol was then calculated based on the absorbance and the molar ... light adaptation of the eye. Light adaptation also induced the decrease of all-trans isomer both in the distal and proximal portions of the retina. In contrast, the...

Ngày tải lên: 17/03/2014, 03:20

10 596 0
Báo cáo khoa học: A hydrophilic cation-binding protein of Arabidopsis thaliana, AtPCaP1, is localized to plasma membrane via N-myristoylation and interacts with calmodulin and the phosphatidylinositol phosphates PtdIns(3,4,5)P3 and PtdIns(3,5)P2 pptx

Báo cáo khoa học: A hydrophilic cation-binding protein of Arabidopsis thaliana, AtPCaP1, is localized to plasma membrane via N-myristoylation and interacts with calmodulin and the phosphatidylinositol phosphates PtdIns(3,4,5)P3 and PtdIns(3,5)P2 pptx

... with a pair of primers (forward, 5¢- CACCACCACCACCAGATGGGTTACTGGAATTCCA AG-3¢; reverse, 5¢- GTGGTGTTTCATATGTATATCTCCT TCTTAAAGTTAAAC-3¢; italic type shows the His-tag adaptor sites). After confirmation ... Lanes 1 and 6, A. thaliana; lanes 2 and 7, Raphanus sativus; lanes 3 and 8, Brassica rapa; lanes 4 and 9, B. rapa var. glabra; lanes 5 and 10, B. oleracea var. italica. The amount...

Ngày tải lên: 23/03/2014, 07:20

16 424 0
Báo cáo khoa học: A structured RNA in hepatitis B virus post-transcriptional regulatory element represses alternative splicing in a sequence-independent and position-dependent manner pot

Báo cáo khoa học: A structured RNA in hepatitis B virus post-transcriptional regulatory element represses alternative splicing in a sequence-independent and position-dependent manner pot

... For the detection of the unspliced pgRNA and the SP1 splicing variant of HBV, primers SP1 (tgcccctatcctatcaacac), SP2 (actcccataggaattttccgaaa) and U2 (ttccaatgaggattaaagacag) were used. Quantification ... PRE-ISS. (A) RNase footprinting analysis of the fragments of the 5¢ end labeled and folded PRE-ISS wild-type RNA, which was cleaved by RNase T1, RNase V1 and RNase A....

Ngày tải lên: 28/03/2014, 23:20

14 379 0
Báo cáo khoa học: A new phospholipase A2 isolated from the sea anemone Urticina crassicornis – its primary structure and phylogenetic classification pptx

Báo cáo khoa học: A new phospholipase A2 isolated from the sea anemone Urticina crassicornis – its primary structure and phylogenetic classification pptx

... Kyoto, Japan). RACE 5¢- RACE and 3¢-RACE were performed on the RACE- ready cDNA prepared from previously isolated total RNA with the GeneRacer Kit (Invitrogen, Carlsbad, CA, USA). For the 3¢-RACE ... hunting and defense) of the sea anemone Adamsia carciniopados (AcPLA 2 ) [20]. Nested RT-PCR with degenerate primers and RACE was used to clone the PLA 2 from this animal. Ac...

Ngày tải lên: 06/03/2014, 11:20

13 462 0
Báo cáo khoa học: A single EF-hand isolated from STIM1 forms dimer in the absence and presence of Ca2+ ppt

Báo cáo khoa học: A single EF-hand isolated from STIM1 forms dimer in the absence and presence of Ca2+ ppt

... oligo- merization, translocates from the ER membrane to form ‘punctae’ near the plasma membrane [1,3,4] and activates the Ca 2+ release-activated Ca 2+ (CRAC) channel through direct interaction with the ... ‘punctae’ and aggregates near the plasma membrane [1,6]. The N-terminal region of STIM1 contains a canonical EF-hand motif and a pre- dicted SAM domain. Stathopulos...

Ngày tải lên: 07/03/2014, 00:20

9 465 0
Báo cáo khoa học: cAMP response element-binding protein (CREB) is imported into mitochondria and promotes protein synthesis docx

Báo cáo khoa học: cAMP response element-binding protein (CREB) is imported into mitochondria and promotes protein synthesis docx

... is an autoradiogram of an amount of the radioactive CREB synthesis mixture corresponding to half of the amount added to mitochondria for the import assay. No precipitable aggregate of radioactive ... synthesized in the RRL translation system, was added to isolated rat liver mitochondria. (A, C) Autoradiograms of SDS ⁄ PAGE slabs of the mitochondrial pellet. The...

Ngày tải lên: 07/03/2014, 02:20

9 396 0
Báo cáo khoa học: A novel metallocarboxypeptidase-like enzyme from the marine annelid Sabellastarte magnifica – a step into the invertebrate world of proteases pdf

Báo cáo khoa học: A novel metallocarboxypeptidase-like enzyme from the marine annelid Sabellastarte magnifica – a step into the invertebrate world of proteases pdf

... granulifera, Cassiopea xamachana, Condylactys gigantea, Gorgonia ventalina, Lebrunia danae, Palythoa caribaeorum, Physalia phy- salis, Plexaura homomalla, Stichodactyla helianthus and Zoanthus pulchellus); ... belong- ing to the Phyla Cnidaria, Annelida, Mollusca, Echi- nodermata, Arthropoda and Chordata, amongst others, collected on the coasts of Havana, Cuba. The study has been ba...

Ngày tải lên: 07/03/2014, 02:20

16 628 0
Báo cáo khoa học: Two CCAAT/enhancer binding protein sites in the cytochrome P4503A1 locus Potencial role in the glucocorticoid response ppt

Báo cáo khoa học: Two CCAAT/enhancer binding protein sites in the cytochrome P4503A1 locus Potencial role in the glucocorticoid response ppt

... 5¢- GGAGA AAGTCC GTCTATGGTGGTGTGCAGATGACACAG TTTTGGC-3¢; site 3A1 -600: 5¢- GCCTCTGCTCTGTA AGTGCAGGA CCGTAGAGGTCTATTACTTATG-3¢. mRNA analysis Total liver RNA was extracted by a modification of the ... time-course variation of the relative concentrations of C/EBPa mRNAandproteinwasmonitoredintheratliver. In parallel we also followed the accumulation of the CYP 3A1 mRNA,...

Ngày tải lên: 17/03/2014, 09:20

9 425 0
Báo cáo khoa học: Double-stranded RNA-dependent protein kinase (PKR) is downregulated by phorbol ester ppt

Báo cáo khoa học: Double-stranded RNA-dependent protein kinase (PKR) is downregulated by phorbol ester ppt

... Mosialos G & Koromilas AE (2001) Activation of the IkappaB alpha kinase (IKK) complex by double-stranded RNA- binding defective and catalytic inactive mutants of the inter- feron-inducible protein ... protein kinase-dependent pathway mediating stress-induced apoptosis. Proc Natl Acad Sci USA 94, 3279–3283. 13 Balachandran S, Kim CN, Yeh WC, Mak TW, Bhalla K & Barber GN...

Ngày tải lên: 23/03/2014, 13:20

9 168 0
w