522 compact representation of a 4 ¥ 3 pla with six product terms
Giáo án tiếng anh lớp 5 - UNIT 5 SPORTS AND GAMES Section A(4, 5, 6, 7) Period 22 ppsx
... you want to play chess, Nam? Sure It’s an exitting game Say it right - read follow teacher (2 -3 times) Ss read aloud 1-b; 2-d; 3 -a; 4- c Ss read in group Activity3(10’) Read individual Say it ... (It’s an exitting game) - Call some pairs talk in front of the class -Call two Ss write on the board 7.Let’s play T remark One S has an apple said: IV Other activity: Do you want to (play badminton)? ... board -Two Ss speak dialogue -4Ss exercises1 -4 New lesson TEACHER’S ACTIVITIES Activity 1: (3 ) Warm up and review STUDENTS’ ACTIVITIES -T ask some question: Listen and answer Do you want to (play...
- 6
- 1,139
- 1
Tài liệu Báo cáo khoa học: The single tryptophan of the PsbQ protein of photosystem II is at the end of a 4-a-helical bundle domain docx
... degradation of the extrinsic 23- kDa protein of the photosystem II complex of spinach Biochim Biophys Acta 936 , 46 5 47 4 22 Kuwabara, T., Murata, T., Miyao, M & Murata, N (1986) Partial degradation of the ... T., Yamasaki, H., Sakuma, S., Tomakawa, Y., Tamura, N., Shen, J.R & Yamamoto, Y (20 03) Dynamic interaction between the D1 protein, CP 43 and OEC 33 at the lumenal side of photosystem II in spinach ... determined numerical values of the ratio a/ b, and is the theoretical numerical value of ratio a/ b for a mixture of aromatic amino acids (Tyr and Trp), containing the same molar ratio as the protein...
- 12
- 550
- 0
Báo cáo khoa học: A possible physiological function and the tertiary structure of a 4-kDa peptide in legumes potx
... primers: the 4- kDa peptide N-terminal primer: 5¢-AACCATGGCTAAAGCAGATTGTAATGG TGCATGT -3 ; the 4- kDa peptide C-terminal primer: 5¢-AAGAATTCTTATTATCCAGTTGGATGTATGCA GAA -3 The amplified sequence was cloned ... the 43 -kDa protein was detected with anti- (4- kDa peptide) Ig Ligand: (A) normal 4- kDa peptide; (B) Arg16fiAla mutant; (C) Val29fiAla mutant; (D) Phe31fiAla mutant signalling pathway This signalling ... Immunocytochemical studies revealed that a small amount of 4- kDa peptide is localized around the plasma membranes and cell walls [9] The subcellular localization of 4- kDa peptide is similar to that of the 43 -kDa...
- 8
- 386
- 0
Báo cáo hóa học: " Pharmacokinetic evaluation of a 1,3-dicyclohexylurea nanosuspension formulation to support early efficacy assessment" docx
... used a copper X-ray source maintained at 40 kV and 40 mA to provide radiation with an intensity weighted ˚ average of (Kaave) 1. 541 84 A A scintillation counter was ¨ used for detection A Gobel ... Assessment and Accreditation of Laboratory Animal Care, International Plasma protein binding measurement Plasma protein binding measurements were performed using a 96-well plate equilibrium dialysis ... method that has been described previously [ 23] Equilibrium dialysis was performed using pooled, heparinized rat plasma at a final DCU concentration of 10 lM at 37 °C for h Pharmacokinetic data analysis...
- 6
- 336
- 0
Giáo án tiếng anh lớp 7: Test 1 Grade: 10 Time limit: 45 minutes (0.5 point for each of a right pot
... eyes These social “rules” are the same for two men, two women, a man and a woman, or an adult and a child In the US and Canada, when you are having a conversation with someone,…… A not look directly ... the board or read the correct answers passage again several times - Compare with - Get students toread the the passage again carefully other classmates - Call some students to - Compare with write ... A uneasy B main C unreasonable D mean A cities B distances C states D C with D countries A on B from in A written D spoken B spelling C dictation II Speaking: Match each of the sentences in A...
- 14
- 786
- 0
Compact Summary of VHDL phần 3 ppt
... can not be similarly defined in a package and may have to be physically copied A process has some additional capability not available in a concurrent procedure concurrent assertion statement A ... type type word is array (0 to 31 ) of bit; data is array (7 downto 0) of word; mem is array (natural range ) of word; matrix is array (integer range , integer range ) of real; type stuff is ... X as an integer, real(I) yields the value of the integer variable I as a real Predefined type declarations Notes: Reserver words are in bold type, Type names are alphabetical and begin with an...
- 10
- 263
- 0
Tổng hợp đề thi học kì 2 lớp 5 được tải nhiều trong tháng 4 (3)
... Câu 4: Tại nói: Ngày 30 /4/ 1975 mốc quan trọng lịch sử dân tộc ta? B/ PHẦN II: MÔN Đ A LÍ Khoanh tròn vào chữ cái trước ý đúng (Từ câu đến câu 2) Câu 1: Châu lục có số dân đông giới: A Châu ... 19 73 c. 30 /4/ 1975 Câu 2: Khoanh tròn vào ý trước câu trả lời Đường Trường Sơn có tên gọi khác là: A Đường Hồ Chí Minh biển B Đường số C Đường Hồ Chí Minh Câu 3: Tại nói: Ngày 30 /4/ 1975 mốc quan ... lịch sử dân tộc ta? Câu 4: Ta mở đường Trường Sơn nhằm mục đích gì? B/ PHẦN II:MÔN Đ A LÍ Câu 1: Đúng ghi Đ sai ghi S vào ô trống a số dân cư châu Á là: a. Da vàng b. Da trắng Câu 2: Đánh...
- 7
- 545
- 0
AN1025 converting a 5 0v supply rail to a regulated 3 0v
... 86-10-8528-21 04 India - New Delhi Tel: 91-11-5160-8 631 Fax: 91-11-5160-8 632 Austria - Wels Tel: 43 -7 242 -2 244 -39 9 Fax: 43 -7 242 -2 244 -39 3 Denmark - Copenhagen Tel: 45 -44 50-2828 Fax: 45 -44 85-2829 China - Chengdu ... Tel: 82- 54- 4 73 - 43 01 Fax: 82- 54- 4 73 - 43 02 China - Qingdao Tel: 86- 532 -8502- 735 5 Fax: 86- 532 -8502-7205 Korea - Seoul Tel: 82-2-5 54- 7200 Fax: 82-2-558-5 932 or 82-2-558-59 34 Atlanta Alpharetta, GA Tel: ... Italy - Milan Tel: 39 - 033 1- 742 611 Fax: 39 - 033 1 -46 6781 Netherlands - Drunen Tel: 31 -41 6-69 039 9 Fax: 31 -41 6-690 34 0 Spain - Madrid Tel: 34 - 91-708-08-90 Fax: 34 - 91-708-08-91 UK - Wokingham Tel: 44 -118-921-5869...
- 8
- 163
- 0
An experimental investigation of performance and exhaust emission of a diesel engine fuelled with Jatropha biodiesel and its blends
... supply large volume of biodiesel, in fact, nearly half a dozen states of India have reserve a total of 1.72 million hectares of land for Jatropha cultivation and small quantities of Jatropha biodiesel ... Figure shows Jatropha plant in Energy park of Rajiv Gandhi Proudyogiki Vishwavidyalaya (R.G.P.V.) Jatropha plant bears fruits from second year of its plantation and the economic yield stabilizes from ... 2005, 84, 1 5 43 –1 549 [27] Abd-Alla G.H., Soliman H .A. , Badr O .A. , Abd-Rabbo M.F Effects of diluent admissions and intake air temperature in exhaust gas recirculation on the emissions of an indirect...
- 12
- 568
- 0
Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast doc
... GTATGCGATGTGGAATTTG GATGCCTTCCAATGAATTAC GAACCAATGAAATAAGGGCG GGGGATCCGTCGACCTGCAGCGTACGAGGAAAGGAAATAGGC GTTTAAACGAGCTCGAATTCATCGATCCGTCAACGACAGTTG GCATCAGAAAGCATAGGC TGGGAATACGATAGAGTAG GTTTAAACGAGCTCGAATTC ... CCGTCGACCAAGCTTATGTTTCCTTATTTTTACAGACG CCCCCGGGGCCACTTTCTGGTG GTACAAGCTTGTAAATTTTCGATGG CATAGAATTCTTGGTAATC AAAGTCGACATGTTGTCACGTAGACAG CAAGCAGGTGAATTAGGC GGGGATCCGTCGACCTGCAGCGTACGAAAATCGTTTACACATC ... GTTTAAACGAGCTCGAATTCATCGATGCTAGTCCTTTATG CAGGCAAGTCTGTTTATTG CTTGGATGAGCTTTCCAC CGTATAAATTACAATACCG GGGGATCCGTCGACCTGCAGCGTACGACATACTACTTCATTTG GTTTAAACGAGCTCGAATTCATCGATCCTAGCGTTACCGTTG GTATGCGATGTGGAATTTG...
- 16
- 646
- 0
Tài liệu Báo cáo Y học: Analyses of the CYP11B gene family in the guinea pig suggest the existence of a primordial CYP11B gene with aldosterone synthase activity docx
... pool Using a combination of a primer complementary to the adapter (adapter primer: 5¢-CCATCCTAATACGACTCACTA TAGGGC -3 ) and a gene-specific sense primer (5¢-GCCG CTCGAGTTTGAGTTAGCCAGAAACTCC -3 , XhoI ... of the order rodentia using the same data as Graur In contrast, the distance matrix algorithms again placed the guinea pig together with artiodactyls and primates, thus supporting paraphyly albeit ... O.B & Carr, B (19 93) Modulation of aldosterone synthase messenger ribonucleic acid levels by dietary sodium and 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 potassium and by adrenocorticotropin...
- 9
- 671
- 0
Đề tài " On the Julia set of a typical quadratic polynomial with a Siegel disk " ppt
... of π /3 with S1 at Lemma 4. 10 There exist the following asymptotically universal bounds: n area(P0 An+2 ) n area(P0 n area(Pqn+1 An+2 ) n area(Pqn+1 area(Qn An+2 ) area(Qn An+2 ) An+2 ) An+2 ) ... rational maps with Siegel disks; see for example [P2] and [Mc2] for the case of quadratic polynomials, and [Z1] and [YZ] for variants in the case of cubic polynomials and quadratic rational maps ... Proof Combining Lemma 4. 10 with Lemma 4. 11, we obtain a universal constant < λ < and an integer N ≥ such that for every n ≥ N , area(P An+2 ) ≥ λ area(P ∪ P ) for all P An , area(P (4. 20) An+2...
- 53
- 383
- 0
Optimal Design of a Hybrid Electric Car with Solar Cells pptx
... 19.29 03 14. 9 43 2 35 .8 637 0. 749 012 16 54. 3 3.60097 1.10998 44 7. 139 31 5.609 131 . 53 43 .7909 40 .0219 13. 13 14 10.1722 24. 41 34 0.7000 04 1 642 . 43 3. 92112 1.217 04 430 .756 297.069 133 .687 38 . 147 3 43 .5801 14. 2989 ... 35 36 35 36 1.9 544 8 1.81 9 43 1.6 635 6 1.0156 1.01206 0.999926 556.2 94 558. 238 565.0 14 412 .47 7 41 4 .42 1 42 1.197 1 43 .817 1 43 .817 1 43 .817 36 36 36 49 .18 03 49 .18 03 49 .18 03 16. 13 64 16. 13 64 16. 13 64 12.5 ... 1.00822 39 9.0 13 366. 035 45 0 .40 4 44 6.8 93 286.7 84 245 .229 34 9 . 74 35 0. 844 112.228 120.806 100.6 63 96. 048 9 0 23. 6 53 20.1 23 51.1927 55.10 53 35.1281 34 . 63 34 16.7966 18.08 04 11.5257 11 .36 34 13. 0115 14. 0059...
- 12
- 600
- 0
báo cáo hóa học:" Establishment of an animal model of a pasteurized bone graft, with a preliminary analysis of muscle coverage or FGF-2 administration to the graft" potx
... size of the bone formation was also quantitatively measured in the lateral view using Alpha Ease FC software (Alpha Innotech, San Leandro, CA, USA) The area was calculated in relation with that ... Kawaguchi N, Matsumoto S, Matsushita Y: Radiographic analysis of pasteurized autologous bone graft Skeletal Radiol 20 03, 32 :45 4 -46 1 Rong Y, Sato K, Sugiura H, Ito T, Sakano S, Iwata H, Kimata ... immediate reimplantation of resected bone J Craniomaxillofac Surg 1991, 19 :31 -39 Ehara S, Nishida J, Shiraishi H, Tamakawa Y: Pasteurized intercalary autogenous bone graft: radiographic and scintigraphic...
- 10
- 478
- 0
báo cáo hóa học:" Functional bracing for delayed union of a femur fracture associated with Paget''''s disease of the bone in an Asian patient: a case report" pot
... and treatment J Oral Pathol Med 19 94, 23: 12-16 Hashimoto J, Ohno I, Nakatsuka K, Yoshimura N, Takata S, Zamma M, Yabe H, Abe S, Terada M, Yoh K, et al.: Prevalence and clinical features of Paget's ... this article as: Takigami et al., Functional bracing for delayed union of a femur fracture associated with Paget's disease of the bone in an Asian patient: a case report Journal of Orthopaedic ... disease in Australia, New Zealand, North America and most European countries, but it has a low incidence in Scandinavia, and is extremely rare in the Japanese population, with a prevalence of...
- 4
- 402
- 0
Báo cáo hóa học: " Research Article On Stability of a Functional Equation Connected with the Reynolds Opera" docx
... equation,” Proceedings of the American Mathematical Society, vol 80, no 3, pp 41 1 41 6, 1980 ´ Adam Najdecki: Institute of Mathematics, University of Rzeszow, Rejtana 1 6A, ´ 35 -31 0 Rzeszow, Poland ... Equations and Their Applications, Birkh¨ user Boston, a Boston, Mass, USA, 1998 [2] J Acz´ l and J Dhombres, Functional Equations in Several Variables, vol 31 of Encyclopedia of e Mathematics and ... Journal of Inequalities and Applications Banach algebra Ꮽ They have shown that if a mapping f : X → Ꮽ satisfies f (x ◦ y) − f (x) f (y) ≤ (3) with some > 0, then there exist a commutative C ∗ -algebra...
- 3
- 216
- 0
Báo cáo hóa học: "OSCILLATION OF A LOGISTIC DIFFERENCE EQUATION WITH SEVERAL DELAYS" ppt
... Israel E-mail address: brznsky@cs.bgu.ac.il E Braverman: Department of Mathematics and Statistics, University of Calgary, 2500 University Drive N.W., Calgary, Alberta T2N 1N4, Canada E-mail address: ... of Mathematical Analysis and Applications 165 (1992), no 2, 34 6 36 0 [16] Y Zhou, Oscillation and nonoscillation for difference equations with variable delays, Applied Mathematics Letters An International ... Oscillation and linearized oscillation of a logistic equation with several delays, Applied Mathematics and Computation 131 (2002), no 2 -3, 46 9 47 6 [ 13] Ch G Philos, Oscillations in a nonautonomous...
- 12
- 291
- 0
Báo cáo khoa học: "Evaluation of the effect of a 3rd GnRH injection administered six days after the 2nd GnRH injection of Ovsynch on the reproductive performance of Japanese black cows" pps
... in cattle Theriogenology 1997, 47 , 7 03- 7 14 13 Kuroiwa T, Ishibashi A, Fukuda M, Kim S, Tanaka T, Kamomae H Estrus synchronization and conception rate after a progesterone releasing intravaginal ... effect of day injection of GnRH analogue in two estrus synchronization methods on the pregnancy rate of Japanese black cows To accomplish this, a total of 41 multiparous Japanese black cows were randomly ... fertirelin acetate, gonadorelin and buserelin Theriogenology 1990, 34 , 81-98 Dhali A, Mishra DP, Mech A, Karunakaran M, Rajkhowa C Role of LH and prostaglandin F2α on the development and regression of...
- 7
- 498
- 0
Báo cáo khoa học: "Case of a sigmoid colon cancer with metachronous metastases to the mesorectum and the abdominal wall" pdf
... free of metastatic adenocarcinoma The patient had an uneventful recovery On rectum examination one year later a palpable extramucosal mass was noticed at the anterior rectum wall An abdominal CT ... survival and it seems to increase as the primary tumor stage advance In this case, a sigmoid adenocarcinoma is infiltrating 2 /3 of muscularis propria with four lymph nodes harvested free of metastatic ... Greene FL: The staging of colorectal cancer: 20 04 and beyond Ca Cancer J Clin 20 04, 54: 295 -30 8 International Union Against Cancer (UICC): Colon and rectum TNM classification of malignant tumors New...
- 4
- 463
- 0
Báo cáo khoa hoc:" Construction and characterization of a bovine BAC library with four genome-equivalent coverage" pptx
... 2.2 BAC vector preparation pBeloBAC11 was kindly provided by H Shizuya, Department of Biology, California Institute of Technology (Pasadena, Calif.) Preparation of pBeloBAC11 was carried out as ... Lehrach H., Construction and characterization of a gridded cattle BAC library, Anim Genet 31 (2001) 34 7 35 1 [2] Cai L., Taylor J.F., Wing R .A. , Gallagher D.S., Woo S.S., Davis S.K., Construction and ... copies of each 96-well microtitre plate were prepared and stored at 80 C at different locations Superpools of 24 plates and pools of individual plates ( 24) , 12 columns and rows were prepared by...
- 6
- 271
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008