4 if a normal stress component puts the left surface of an imaginary cut in tension then the right surface will be in compression
Báo cáo y học: "Frequent CXCR4 tropism of HIV-1 subtype A and CRF02_AG during late-stage disease - indication of an evolving epidemic in West Africa" docx
Ngày tải lên :
12/08/2014, 23:23
... Denmark) according to the manufacturer’s instructions using primers JE12F (5’-AAAGAGCAGAAGATAGTGGCAATGA-3’) and V 3A_ R2 (5’-TTACAATAGAAAAATTCTCCTCYACA-3’) for one-step RT-PCR and E2 0A_ F (5’-GGGCTACACATGCCTGTGTACCYACAG-3’) ... subtype A or CRF02_AG infected individuals in late-stage disease CXCR4-using viral populations were found in as much as 79% of the analyzed samples, demonstrating the importance of analyzing samples ... A or CRF02_AG infected individuals in late-stage disease by evaluating the performance of a recombinant virus phenotypic assay for subtype A and CRF02_AG Using this tool, we found an increasing...
- 13
- 240
- 0
Unit 3: At home.Period 17: Lesson 4: ReadI. Objectives: - After the lesson, Ss will be able to pptx
Ngày tải lên :
08/08/2014, 02:20
... answers of the given questions - Ask Ss to give their answers by both only and in writing - Give answers: a Because children often try to eat and drink them b Because the kitchen is a dangerous place ... place c Because playing with one match can cause the fire d Because children often try to put ST into electrical sockets and electricity can kill e Because the dangerous objects can injure or ... reading: a Reading the text - Ss read the text and check their prediction - Ask Ss to correct if the statements are false b, Comprehension questions: - Ask Ss to work in pairs to find out the answers...
- 4
- 345
- 0
Báo cáo y học: "The International Documentation and Evaluation System IDES: a single center observational case series for development of an ankle prosthesis documentation questionnaire and study of its feasibility and face validity" pdf
Ngày tải lên :
10/08/2014, 21:24
... evaluation AP and lateral images of the ankles were taken in full weight-bearing position An α-angle (AP view: angle between the longitudinal axis of the tibia and the articulating surface of the tibial ... tibial component) , β-angle (lateral view: angle between the longitudinal axis of the tibia and the articulating surface of the tibial component) and γ-angle (lateral view: angle between a line drawn ... through the anterior shield and the posterior edge of the talar component and a line drawn between the dorsal aspect of the talonavicular joint and the calcaneal tubercle) were measured (Attachments...
- 8
- 316
- 0
Báo cáo y học: "Two discrete events, human T-cell leukemia virus type I Tax oncoprotein expression and a separate stress stimulus, are required for induction of apoptosis in T-cells" pptx
Ngày tải lên :
13/08/2014, 13:20
... and monoclonal anti-caspase-8 were purchased from Pharmingen Monoclonal anti-XIAP was purchased from Panvera Polyclonal antisurvivin, -cIAP-1, and -cIAP-2, and monoclonal anti-PARP and anti-Bcl-2 ... through NF-kappaB in apoptosis-resistant T-cell transfectants with Tax J Virol 1999, 73:7981-7987 Kawakami A, Nakashima T, Sakai H, Urayama S, Yamasaki S, Hida A: Inhibition of caspase cascade by ... incapable of activating NF-kappaB retains its immortalizing potential for primary T-lymphocytes J Biol Chem 1998, 273:6698-6703 Tanaka A, Takahashi C, Yamaoka S, Nosaka T, Maki M, Hatanaka M:...
- 12
- 240
- 0
Tài liệu Báo cáo khoa học: "Collecting a Why-question corpus for development and evaluation of an automatic QA-system" pdf
Ngày tải lên :
20/02/2014, 09:20
... cheating was to mark the question unaswerable Because of this the first data set included only the real answers, and the NoAs were removed (NoA not included, 3872 answers) If an answer was compared ... corresponding articles, and answered by available (different) workers Our hypothesis is that the questions are more natural if their answer is not known at the time of the creation Finally, in an additional ... which are not asked, and also contain practical examples Human-powered answers often contain unrelated information and discourselike elements Additionally, the answers not always have a connection...
- 9
- 610
- 1
Báo cáo nghiên cứu khoa học " Development of an Improved Capability in support of National Bio-security for the Surveillance and Control of Foot & Mouth Disease in Cattle and Pigs " pptx
Ngày tải lên :
22/06/2014, 12:20
... Veterinary laboratories in Vietnam and the training of DAH veterinarians in disease investigation and control This will strengthen the profile of DAH which will play a vital role in making Vietnam ... for the detection of FMD antigen and antibody and the standardisation of reagents Training was carried out under a quality system emphasizing the importance of Quality Assurance in the laboratory ... important part of the laboratory training was Quality Assurance in the laboratory to ensure tests will be run according to a standard protocol and to allow AAHL to audit the results from each laboratory...
- 28
- 445
- 0
Báo cáo nghiên cứu khoa học " Development of an Improved Capability in support of National Bio-security for the Surveillance and Control of Foot & Mouth Disease in Cattle and Pigs - Milestone 3 " pptx
Ngày tải lên :
22/06/2014, 12:20
... improve the diagnostic capability of the veterinary laboratories in Vietnam and the training of DAH veterinarians in disease investigation and control This will strengthen the profile of DAH which will ... CaMau 11 4A A HL 0 644 3 CanTho 11 0A A HL 0 647 6 11 5A A HL 0 645 7 CaMau 10 2A A HL 0 646 3 V inhLong 10 5A A HL 0739 CanTho 9 2A A HL 0757 V inhLong 8 8A A HL 0753 CanTho 11 1A A HL 0716 75 CanTho 11 6A A ... ang 10 0A A HL 0 645 7H CaMau 11 4A A HL 0 644 3 CanTho 11 0A A HL 0 647 6 11 5A A HL 0 645 7 CaMau 10 2A A HL 0 646 3 V inhLong 10 5A A HL 0739 CanTho 9 2A A HL 0757 V inhLong 8 8A A HL 0753 CanTho 11 1A A HL 0716...
- 23
- 439
- 0
Báo cáo nghiên cứu khoa học " Development of an Improved Capability in support of National Bio-security for the Surveillance and Control of Foot & Mouth Disease in Cattle and Pigs - Milestone 6 " ppt
Ngày tải lên :
22/06/2014, 12:20
... supplying training for AI Training in data analysis by DAH staff is also an area that needs further input 6.2 Options The government of Vietnam is looking at increasing the support to DAH and has increased ... on the A ELISA is significantly lower than on either the O or Asia1 ELISA another strain may have been used in the vaccine This can be checked with the vaccine manufacturer and/or by testing the ... with the same vaccine? Is it known if the same animals were both vaccinated and sampled? Were all animals of this species in the village vaccinated at the same time? What is the name of the vaccine...
- 44
- 321
- 0
Báo cáo nghiên cứu khoa học " Development of an Improved Capability in support of National Bio-security for the Surveillance and Control of Foot & Mouth Disease in Cattle and Pigs " ppt
Ngày tải lên :
22/06/2014, 12:20
... and Hanoi laboratories Training under a quality assurance system was provided at AAHL and was then implemented at the participating laboratories Achieved 1.1 Train field veterinary staff in outbreak ... is a disease of importance in Vietnam and of strategic significance not only to Australia and neighbouring countries in SEA but also worldwide As a result of this CARD AusAID and earlier ACIAR ... improved animal health will lead to an increase in rural productivity though increased animal production Healthy animals will enable small farmers to be more competitive in the local market and the...
- 34
- 360
- 0
Báo cáo nghiên cứu khoa học " Development of an Improved Capability in support of National Bio-security for the Surveillance and Control of Foot & Mouth Disease in Cattle and Pigs - Milestone 5 " ppt
Ngày tải lên :
22/06/2014, 12:20
... of the Veterinary laboratories in Vietnam and the training of DAH veterinarians in disease investigation and control This will strengthen the profile of DAH which will play a vital role in making ... animals and incomes will be protected by better disease diagnosis, management and control Since women at the village level are the primary animal handlers and managers, they will be major beneficiaries ... selection of the right vaccine and improving the efficacy of vaccination 5.3 Capacity Building Training and education of field veterinarians in disease prevention, disease investigation and sample collection...
- 25
- 313
- 0
Báo cáo nghiên cứu khoa học " Development of an Improved Capability in support of National Bio-security for the Surveillance and Control of Foot & Mouth Disease in Cattle and Pigs - Milestones 7 " docx
Ngày tải lên :
22/06/2014, 12:20
... with a focus on cell culture and QA Two AAHL consultants also carried out training at the HCMC and Hanoi laboratories with one consultant also visiting the laboratories at Can Tho and Da Nang The ... primary animal handlers and managers, they will be major beneficiaries of the final outcome of better diagnosis and control of animal diseases Implementation & Sustainability Issues 7.1 Issues and ... This training has already shown an impact with an increase in quality of sample collection and number of samples collected and submitted to the laboratory The project has provided training and technology...
- 12
- 378
- 0
Giáo án Anh văn lớp 7 : Tên bài dạy : People and places. Lesson 3: B1 - 2. I.Ojectives : -After the lesson Ss will be able to know more docx
Ngày tải lên :
06/08/2014, 15:22
... -Ask Ss retell the name of some countries in the south-east Asia -Work in pairs to discuss and write the answers on the BB Thai land - Laos - Cambodia - Singapore - Indonesia Malaysia ... *Practice - Play the tape again and then read the text to the exercise True- False - Give the correct answers a) False ( Liz knows nothing about General Giap.) b) False ( The People Army of Vietnam ... work in pairs) *Production -Ask Ss to retell some things about the General Nguyen Van Giap -Work in pairs to discuss -Speak aloud before the class Consolidation: -Ask Ss to retell the main content...
- 4
- 654
- 1
Báo cáo sinh học: "Expected efficiency of selection for growth in a French beef cattle breeding scheme. II. Prediction of asymptotic genetic gain in a heterogeneous population" docx
Ngày tải lên :
09/08/2014, 18:21
... within a class to have an equal amount of information Ducrocq and Quaas (1988) described the algorithm to calculate the relevant truncation point, given the number of animals to be selected and the ... structure of data was constructed to evaluate sampling variances and covariances between preweaning genetic parameters (Phocas et al, 1995) The sampling variance-covariance matrix is derived for 40 50 ... may be to maintain a basic rate of AI in all herds to ensure genetic connections and then to increase AI rate in only a part of the herds breed, can REFERENCES Bichard M (1971) Dissemination of...
- 18
- 304
- 0
Báo cáo y học: "Life-threatening biopsy of an iliopsoas pseudotumour in a patient with haemophilia: a case report" docx
Ngày tải lên :
11/08/2014, 23:21
... hematoma in hemophilia A J Pediatr Surg 1989, 24: 406 -40 8 Prasad S, Patankar T, Krishnan A, Pathare A: Spontaneous isolated lesser sac hematoma in a patient with hemophilia Indian J Gastroenterol 1999, ... are ordered based on information obtained from the history and physical examination; in our case this was missed and, coupled with the assumed radiological diagnosis of a psoas sarcoma, all of ... along the Tru -cut path; this was sutured and diathermized, the mass examined and a second biopsy was taken The patient was reviewed the following day; haemoglobin was 12 g/l, and his other vital...
- 4
- 293
- 0
Báo cáo khoa học: "Stratification, Blinding and Placebo Effect in a Randomized, Double Blind Placebo-controlled Clinical Trial of Gold Bead Implantation in Dogs with Hip Dysplasia" doc
Ngày tải lên :
12/08/2014, 15:21
... dysplasia, and to investigate the effect of blinding and placebo in a controlled clinical trial of pain treatment in CHD Materials and methods Animals A total of 80 dogs recruited from all parts of ... lumbar spine and muscles and the skeleton of the hind limbs The examination included a neurological examination and hip extension test All dogs were sedated and anesthetized, and then the coat was ... there was obesity and hence enhanced weight load on the joint As clinicians trained in the causes of a specific disease, we can mistakenly come to regard a cause as a factor that can in uence the...
- 12
- 201
- 0
Báo cáo khoa học: "Efficacy and safety of a low-flow veno-venous carbon dioxide removal device: results of an experimental study in adult sheep" pps
Ngày tải lên :
13/08/2014, 03:20
... none of them demonstrated a clear superiority and became the standard Pharmacologic approaches included nitric oxide inhalation, surfactant replacement therapy, antioxidants, prostaglandins, and ... experiments and data acquisition MV conducted experiments, interpretation of data, and manuscript drafting GB performed study conception and design, statistical analysis and interpretation of data, and ... time interval After the completion of data collection, general anaesthesia was discontinued and the sheep were assisted until complete recovery and extubation Data collection and statistical analysis...
- 7
- 287
- 0
A review on sample preparation and chromatographic determination of acephate and methamidophos in different samples
Ngày tải lên :
02/09/2015, 13:47
... Extraction Techniques Human blood Acephate methamidophos, etc Methamidophos, etc Liquid–liquid extraction Plasma alanine aminotransferase, aspartate aminotransferase, creatinine, urea, and gamma ... Degradation and mineralization kinetics of acephate in humid tropic soils of Malaysia Chemosphere 79, 43 4 44 0 Chuanjiang, T., Dahui, L., Xinzhong, Z., Shanshan, C., Lijuan, F., 2010 Residue analysis ... of quantification were lg/L and lg/L, respectively (Araoud et al., 2010) 4. 2 Determination of acephate and methamidophos in human and animal urine Acephate concentrations in the human urine were...
- 8
- 428
- 0
Development of an intelligent electrolytic in process dressing (ELID) grinding system 4
Ngày tải lên :
14/09/2015, 08:44
... by assuming the grits to be a combination of cone and sphere as shown in the figure 4. 2 (a) where r is the radius of the arc, rb is the grain contact width and α is the inclination angle At small ... than conventional ELID grinding because the dressing power is varied according to the change in the force ratio of grinding as explained earlier Hence the normal grinding force (Fn) in grinding ... the variation of the peak dressing voltage and grinding force ratio in one machining cycle The two peaks as shown in the figure describe the high value of grinding force ratio during the initial...
- 18
- 213
- 0
THE IMPORTANCE OF AN ALLOSTERIC POCKET IN THE DENGUE PROTEASE
Ngày tải lên :
02/10/2015, 17:13
... D3NS2B_V07 8A_ REV CACAACTTAATGATCACAGCTGATGATGATGGAAC GTTCCATCATCATCAGCTGTGATCATTAAGTTGTG D3NS2B_M08 4A_ FOR CACAGTTGATGATGATGGAACAGCGAGAATAAAAG ATGATG CATCATCTTTTATTCTCGCTGTTCCATCATCATCA ACTGTG D3NS2B_M08 4A_ REV ... CTTTGTAACCACTCCATCGCCATACAGTCCCACTAC D3NS3_I165L_FOR D3NS3_I165L_REV GGCTATGTCAGCGGACTAGCGCAAACAAATGCAG CTGCATTTGTTTGCGCTAGTCCGCTGACATAGCC D2NS3_T11 8A_ FOR CCAAACAAAACCTGGTCTTTTCAAAGCAAACGCC GGAACC GGTTCCGGCGTTTGCTTTGAAAAGACCAGGTTTT ... CTTTGTAACCACTCCAGCGCCATACAGTCCCACTAC D3NS3_I16 5A_ FOR D3NS3_I16 5A_ REV GGCTATGTCAGCGGAGCAGCGCAAACAAATGCAG CTGCATTTGTTTGCGCTGCTCCGCTGACATAGCC D3NS3_Q16 7A_ FOR D3NS3_Q16 7A_ REV GTCAGCGGAATAGCGGCAACAAATGCAGAACCAG...
- 109
- 316
- 0
Confidence or complacency the implications of an ageing workforce in germany
Ngày tải lên :
04/12/2015, 00:03
... points they are broadly in line with the European average, and well ahead of laggards such as France and Spain Confidence or Complacency? The implications of an ageing workforce in Germany Chart ... rebalancing of their priorities than their counterparts in other countries Today, those in the UK, Italy and Spain, for example, say cost is far more important than talent; and by 2020, they think ... fall on employers (42 % in Germany, compared with 55% across Europe.) Why Germans not fear increasing costs in this area? Perhaps the answer is that many of them have been adapting their working...
- 26
- 170
- 0