Thông tin tài liệu
THE IMPORTANCE OF AN ALLOSTERIC POCKET IN
THE DENGUE PROTEASE
NOEMI REBECCA MEIER
YONG LOO LIN SCHOOL OF MEDICINE
2012
THE IMPORTANCE OF AN ALLOSTERIC POCKET IN
THE DENGUE PROTEASE
NOEMI REBECCA MEIER
B.SC. (MAJOR IN INTEGRATIVE BIOLOGY), UNIVERSITY OF
BASEL
A THESIS SUBMITTED
FOR THE DEGREE OF MASTER OF SCIENCE
IN INFECTIOUS DISEASES,
VACCINOLOGY AND DRUG DISCOVERY
YONG LOO LIN SCHOOL OF MEDICINE
NATIONAL UNIVERSITY OF SINGAPORE
&
BIOZENTRUM UNIVERSITY OF BASEL
2012
Declaration
DECLARATION
I hereby declare that this thesis is my original work and it has been written by me in
its entirety. I have duly acknowledged all the sources of information, which have been
used in the thesis.
This thesis has also not been submitted for any degree in any university previously.
NOEMI REBECCA MEIER
26 DECEMBER 2012
i
Acknowledgments
ACKNOWLEDGMENTS
First and foremost, I would like to express my deepest gratitude to my supervisor at
the Novartis Institute for Tropical Diseases (NITD), Dr. Christian Guy Noble, for his
patience and trust throughout my work. This thesis would not have been possible
without his guidance and support. The freedom he gave me during the course of my
thesis is invaluable personally and scientifically.
Special thanks go to all the people at NITD who made this an unforgettable year! I
greatly enjoyed my time at NITD! Thanks to Pei-Yong Shi for his support and
encouragement. I would also like to thank Alex Chao, Ka Yan Chung, Hongping
Dong, Nahdiyah Ghafar, Zou Jing, Dorcas Larbi, Cheah Chen She, Le Tian Lee,
Xuping Xie, Kim Long Yeo and Andy Yip for their guidance and support with my
work. Thank you Boatema, Hana, Jansy, Ketan, Michelle and Pramila for your great
company throughout this incredible year.
I am also truly thankful to my family for giving me this unique opportunity to pursue
my studies in Singapore, which would not have been possible without their support. I
am grateful for their trust and belief in me.
Last but not least I am grateful to all my friends back home who defied time zones
and distances and who have supported me throughout my journey.
ii
Table of Contents
TABLE OF CONTENTS
Declaration.....................................................................................................................i
Acknowledgments ........................................................................................................ii
Summary......................................................................................................................vi
List of Tables .............................................................................................................viii
List of Figures..............................................................................................................ix
List of Symbols ............................................................................................................xi
Chapter 1 Introduction............................................................................1
1.1
Phylogeny of Dengue Virus ...................................................................2
1.2
Epidemiology .........................................................................................3
1.2.1 Epidemiology of Flaviviruses.....................................................3
1.2.2 Epidemiology of Dengue Virus..................................................4
1.3
Clinical Manifestations...........................................................................6
1.3.1 Dengue Fever (DF).....................................................................6
1.3.2 Dengue Hemorrhagic Fever (DHF) and Dengue Shock
Syndrome (DSS).....................................................................................7
1.4
Pathogenesis of Severe Dengue .............................................................8
1.5
Dengue Virus Life Cycle .....................................................................10
1.5.1 Structure of Dengue Virions........................................................10
1.5.2 Viral Entry and Fusion ................................................................10
1.5.3 Viral Replication, Assembly and Release ...................................11
1.6
DENV Structural and Non-structural Proteins ....................................14
1.6.1 Capsid..........................................................................................14
1.6.2 Pre-membrane .............................................................................15
1.6.3 Envelope......................................................................................15
1.6.4 NS1..............................................................................................16
1.6.5 NS2A ...........................................................................................16
1.6.6 NS2B ...........................................................................................17
1.6.7 NS3..............................................................................................17
1.6.7.1 NS3 Protease ................................................................18
iii
Table of Contents
1.6.8 NS4A and NS4B .........................................................................19
1.6.9 NS5..............................................................................................20
1.7
Control of Dengue ................................................................................21
1.7.1 Treatment of Dengue ................................................................21
1.7.2 Vector Control ..........................................................................21
1.7.3 Vaccines ...................................................................................22
1.7.4 Antiviral Therapy .....................................................................23
1.8
Aims of the Thesis................................................................................25
Chapter 2 Materials and Methods........................................................26
2.1
Materials...............................................................................................27
2.1.1 Cloning Primers........................................................................27
2.1.2 DNA Sequencing Primers ........................................................28
2.1.3 Antibodies.................................................................................29
2.2
Methods ................................................................................................30
2.2.1 Generating DENV-3 Protease Mutants ...................................30
2.2.2 Expression and Purification of DENV-3 Protease Mutants .....30
2.2.3 Dengue NS3 Protease Activity Assay ......................................33
2.2.4 Construction of Genome-length DENV-2 Mutant cDNA........33
2.2.5 In Vitro Transcription of Genome-length DENV-2 Infectious
Clone.........................................................................................37
2.2.6 Culturing and Passaging of BHK21 Cells ................................37
2.2.7 RNA Transfection and Immunofluorescence Assay (IFA) ......38
Chapter 3 Results ...................................................................................39
3.1
The Allosteric Pocket in the Dengue Protease .....................................40
3.1.1 Generating DENV-3 NS2B-NS3 Mutants................................40
3.1.2 Expression
and
Purification
of
DENV-3
NS2B-NS3
Recombinant Protein ................................................................46
3.1.3 Assessing the Enzymatic Activity of DENV-3 NS2B-NS3
Protease Mutants.......................................................................49
3.1.4 Additional Mutagenesis Studies with Selected Residues .........53
iv
Table of Contents
3.1.5 Assessing Viral Replication of Selected Mutants In Vitro.......57
Chapter 4 Discussion ...........................................................................................65
4.1
Alanine Mutagenesis Studies ...............................................................67
4.2
Additional Mutagenesis Studies...........................................................69
4.2.1 M084.........................................................................................69
4.2.2 T118..........................................................................................71
4.2.3 N152 .........................................................................................72
4.2.4 I165...........................................................................................73
4.3
Viral Replication In Vitro.....................................................................75
4.4
Impact of Findings on Drug Discovery................................................77
4.5
Conclusion and Outlook.......................................................................78
Bibliography ...............................................................................................................79
Appendix .....................................................................................................................90
v
Summary
SUMMARY
Dengue is an emerging mosquito-borne viral infection with an estimated 2.5 billion
people being at risk. The virus is found in tropical and subtropical areas around the
globe and is transmitted by the main vector Aedes aegypti. According to WHO there
are an estimated 50-100 million infections every year worldwide with an estimated
500,000 cases being hospitalized annually. Currently there is no treatment available,
thus there is an urgent need for discovering new drugs.
The dengue NS3 serine protease is a promising target for new drugs since it is
involved in viral polyprotein processing together with NS2B and thus important for
viral replication. Crystal structures of NS2B-NS3pro bound to a peptide inhibitor
recently revealed a pocket located at the opposite side of the protein from the active
site. Residues from both NS2B and NS3 are lining the pocket, which is larger than the
active site. Conservation in West Nile virus structures suggests functional importance.
Based on these findings this study aims to characterize the NS2B-NS3 protease with
its large allosteric pocket in more depth. Mutagenesis studies of different residues
lining the pocket should help to understand the functional role of the pocket as a
whole, as well as the impact on function for single residues in viral replication. The
findings could further be used in drug development to specifically target residues that
are crucial for viral replication.
Mutagenesis studies of selected residues to alanine resulted in impaired or abolished
protease activity for most of the mutants. The five mutants V078, W089, T118, G124
and N152 were completely inactive. Mutants M084 and I165 were barely active
vi
Summary
compared to WT. Only mutant Q167 showed slightly higher activity than WT.
Furthermore protease activity could be restored for two selected mutants in additional
conservative mutagenesis studies. The hydroxyl group in the threonine of position
118 seems to be the main factor affecting protease activity since introduction of a
serine lead to restorage of activity by 60%. For mutant M084 the introduction of a
phenylalanine restored activity in a similar range than mutant T118, suggesting that
hydrophobicity to be a main factor influencing activity. In general in vitro studies on
viral replication were able to confirm results obtained from protease activity assays.
In particular, protease activity could surprisingly not be restored for mutants N152D
and I165L, even though the introduced amino acids differ only slightly from the WT
residue. This suggests that those two residues are especially important for protease
function.
Overall, the results obtained from this study helped to identify residues within the
allosteric pocket that are crucial for protease activity and viral replication. The pocket
is therefore an attractive target and could potentially be targeted for the design of
antiviral compounds.
vii
List of Tables
LIST OF TABLES
Table 3.1
Mutated residues and codon usage in E. coli genes .............................44
Table 3.2
Mutant protease activities compared to WT.........................................50
Table 3.3
Kinetic parameters for DENV-3 NS2B-NS3 mutants and WT............52
Table 3.4
Mutated residues and codon usage in E. coli genes .............................53
Table 3.5
Mutant protease activities compared to WT.........................................54
Table 3.6
Kinetic parameters for DENV-3 NS2B-NS3 mutants and WT............57
Table 3.7
Mutated residues and codon usage in E. coli genes .............................58
viii
List of Figures
LIST OF FIGURES
Figure 1.1
Flavivirus classification..........................................................................2
Figure 1.2
Distribution of dengue infection according to the World Health
Organization in 2010 ..............................................................................4
Figure 1.3
WHO dengue classification scheme (1997) ...........................................6
Figure 1.4
Updated classification scheme for dengue according to WHO (2009) ..7
Figure 1.5
Schematic representation of Flavivirus life cycle ................................13
Figure 2.1
Vector pGEX6P1..................................................................................32
Figure 2.2
pACYC-NGC shutter B used to generate infectious clone ..................35
Figure 2.3
pACYC-NGC infectious clone.............................................................36
Figure 3.1
Structure of DENV-3 protease adopting the closed conformation.......41
Figure 3.2
NS3-NS2B construct used for mutagenesis .........................................44
Figure 3.3
Sequencing chromatogram ...................................................................45
Figure 3.4
Alignment of amino acid sequences for DENV 1-4 NS2B (A) and
NS3pro (B) ...........................................................................................45
Figure 3.5
Overexpression of mutated NS3-NS2B protein attached to a GST tag
..............................................................................................................46
Figure 3.6
Typical chromatograms after GST trap (left) and GST removal (right)
..............................................................................................................47
Typical gel pictures of the different protein purification steps ............48
Figure 3.7
Figure 3.8
Schematic diagram of the principle of the AMC assay........................49
Figure 3.9
Substrate dilutions plotted against fluorescence signal and analysed by
non-linear regression fitted by the Michaelis-Menten equation...........51
Figure 3.10
Activities of mutants compared to WT ................................................54
Figure 3.11
Activities of mutants compared to WT ................................................55
Figure 3.12
Substrate dilutions plotted against fluorescence signal and analysed by
non-linear regression fitted by the Michaelis-Menten equation...........55
Figure 3.13
0.8% agarose gel to check for linearization (A) and RNA quality (B)
..............................................................................................................58
ix
List of Figures
Figure 3.14
Viral replication in vitro of DENV-2 wildtype infectious clone..........61
Figure 3.15
Viral replication in vitro of DENV-2 mutant T118S infectious clone
..............................................................................................................62
Figure 3.16
Viral replication in vitro of DENV-2 mutant T118A infectious clone
..............................................................................................................63
Figure 3.17
Viral replication in vitro of DENV-2 mutant I165A infectious clone
..............................................................................................................64
Figure 4.1
Chemical structure of methionine (left) and phenylalanine (right)
including their molecular weight..........................................................70
Figure 4.2
Chemical structure of threonine (left) and serine (right) including their
molecular weight ..................................................................................71
Figure 4.3
Chemical structure of asparagine (left) and aspartic acid (right)
including their molecular weight..........................................................72
Figure 4.4
Chemical structure of isoleucine (left) and leucine (right) including
their molecular weight..........................................................................74
x
List of Symbols
LIST OF SYMBOLS
Aa
Amino Acid
ADE
Antibody Dependent Enhancement
AMC
7-Amino-4-Methylcoumarin
Amp
Ampicillin
BHK
Baby Hamster Kidney
C
Capsid
cDNA
Complementary DNA
CHAPS
3-{(3-Cholamidopropyl)dimethyl-Ammonio}-1Propanesulfonate
DAPI
4',6-Diamidino-2-Phenylindole
DC
Dendritic Cell
DC-SIGN
Dendritic-Cell-Specific ICAM-Grabbing Non-Integrin
DENV
Dengue Virus
DHF
Dengue Hemorrhagic Fever
DMEM
Dulbecco’s Modified Eagle Medium
DMSO
Dimethylsulfoxide
dsRNA
Double-Stranded RNA
DSS
Dengue Shock Syndrome
E
Envelope
EDTA
Ethylenediaminetetra Acetic Acid
ER
Endoplasmic Reticulum
FBS
Fetal Bovine Serum
FBS
Fragment Based Screening
Gly-Arg-Arg-AMC Gly-‐Arg-‐Arg-‐7-‐Amino-‐4-‐Methylcoumarin
xi
List of Symbols
GRP-‐78/BiP
Glucose-‐Regulating
Protein
78
GST
Glutathione-S-Transferase
HCV
Hepatitis C Virus
HTS
High Throughput Screening
ICAM
Intercellular Adhesion Molecule
IFA
Immunofluorescence Assay
IPTG
Isopropyl-β-D-Thiogalactopyranoside
IVT
In Vitro Transcription
JEV
Japanese Encephalitis Virus
Kb
Kilobase
kDA
Kilo Dalton
LB
Luria Bertani
MW
Molecular Weight
NCR
Non Coding Region
NGC
New Guinea C
NITD
Novartis Institute for Tropical Diseases
NS
Non Structural
NS3hel
NS3 Helicase
NS3pro
NS3 Protease
O/N
Overnight
ORF
Open Reading Frame
PBS
Phosphate Buffered Saline
PBST
PBS + 0.05% Tween
PCR
Polymerase Chain Reaction
prM
pre-membrane
xii
List of Symbols
PS
Penicillin Streptomycin
p.t.
Post Transfection
RF
Replicative Form
RC
Replication Complex
RdRp
RNA Dependent RNA Polymerase
Rpm
Rotations per Minute
RT
Room Temperature
SDM
Site Directed Mutagenesis
SDS-PAGE
Sodium Dodecyl Sulfate-polyacrylamide Gel Electrophoresis
STAT
Signal Transducer and Activator of Transcription
TBEV
Tick-borne Encephalitis Virus
TGN
Trans Golgi Network
Tris
Tris(hydroxymethyl)aminomethane
UTR
Untranslated Region
WHO
World Health Organization
WNV
West Nile Virus
WT
Wildtype
YFV
Yellow Fever Virus
xiii
Chapter 1 Introduction
INTRODUCTION
1
Chapter 1 Introduction
Chapter 1 Introduction
1.1 Phylogeny of Dengue Virus
Dengue virus (DENV) belongs to the family of Flaviviridae, which is a large family
of viruses consisting of three genera; Flavivirus, Pestivirus and Hepacivirus. DENV is
one of over 70 members of the genus Flavivirus causing severe disease and mortality
in both humans and animals (Gubler et al., 2007). Flaviviruses are clustered into three
different groups according to their mode of transmission, which can either be tickborne, mosquito-borne or unknown (Figure 1.1). DENV, yellow fever virus (YFV),
Japanese encephalitis virus (JEV), tick-borne encephalitis virus (TBEV) and West
Nile virus (WNV) are the most important pathogens amongst the flaviviruses that
affect humans (Kuno et al., 1998; Mukhopadhyay et al., 2005).
Figure 1.1 Flavivirus classification. The dendrogram shows the relationship of a
selection of flavivirus members. Clades and clusters are based on molecular
phylogenetics, whereas serological criteria are used to subdivide the viruses into
antigenic complexes (Mukhopadhyay et al., 2005).
1.2 Epidemiology
2
Chapter 1 Introduction
1.2.1 Epidemiology of Flaviviruses
Some of the most important emerging as well as resurging diseases worldwide can be
allocated to the genus of the mosquito-borne flaviviruses (Mackenzie et al., 2004).
Emerging diseases are diseases characterized by a rapid increase in incidence or
geographic spread of newly introduced or previously existing diseases in a population
(Morse, 1995). Genomic sequence analyses have been used to understand origin,
evolution and spread of flaviviruses. It has been suggested that they have evolved
from an ancestral virus in Africa within the past 10’000 years. It is thought that 3’000
years ago the tick-borne lineage evolved followed by the mosquito-borne lineage.
YFV, from where the genus and the family got their names, is believed to have been
carried from West Africa into the Americas during the slave trade in the 17th and 18th
centuries. DENV on the other hand has spread globally in the 18th and 19th centuries
with expanding shipping industry and trading. Additionally DENV transmission
dynamics and epidemiology were shaped dramatically during and following World
War II in South East Asia resulting in geographical spread of the disease and the
vector. The factors contributing to emergence and resurgence of mosquito-borne
viruses are complex and not well understood. However human activities like
urbanization, transportation or changes in land use have clearly accounted strongly for
global spread of mosquito-borne flaviviruses (Gubler, 2002; Mackenzie et al., 2004).
3
Chapter 1 Introduction
1.2.2 Epidemiology of Dengue Virus
According to the World Health Organization (WHO) over 40% of the world’s
population, or 2.5 billion people, live in areas of transmission and hence are at risk of
getting dengue. Only nine countries were known to have severe dengue epidemics
before 1970 and dengue is now endemic in more than 100 countries across the globe.
The disease is present in many parts of the tropics and subtropics in Africa, the
Americas, South-East Asia, the Western Pacific as well as the Eastern Mediterranean.
An estimated 50-100 million dengue infections occur worldwide annually with
500’000 severe cases every year being hospitalized and 2.5% deaths of those affected
(Mackenzie et al., 2004).
Figure 1.2. Distribution of dengue infection according to the World Health
Organization in 2010. Highlighted in orange are the areas and countries where
dengue has been reported. The January and July isotherms illustrate the areas at risk.
4
Chapter 1 Introduction
DENV circulates as four serotypes (DENV 1-4) and is mainly transmitted by
mosquitoes Aedes aegypti and Aedes albopictus. It accounts for the highest disease
and mortality rates amongst flaviviruses (Gubler, 1998). The four serotypes are
closely related and share around 65% identity in their genome, which makes diagnosis
difficult since they cross-react extensively in serological tests (Guzman et al., 2010).
Although they are closely related, infection with one serotype only provides lifelong
immunity for that specific serotype, but does not provide cross-protective immunity
against another serotype (Mackenzie et al., 2004). In contrast, subsequent infection
with another serotype has been reported to be a risk factor for developing Dengue
hemorrhagic fever (DHF) or Dengue shock syndrome (DSS) (Halstead, 1988).
5
Chapter 1 Introduction
1.3 Clinical Manifestations
A mosquito bite infected with DENV can lead to a wide range of clinical
manifestations after an incubation period of 3-14 days (average 4-7 days). Infection
can be asymptomatic or cause mild febrile illness, classical dengue fever, severe or
sometimes even fatal hemorrhagic disease (World Health Organization Geneva 1997;
Figure 1.3).
Figure 1.3. WHO dengue classification scheme (1997).
1.3.1 Dengue Fever (DF)
Classical DF affects mainly older children and adults, resulting in a flu-like febrile
illness accompanied by two or more manifestations like fever, frontal headache, body
aches, joint pains, weakness, nausea and vomiting. DF is self-limiting and rarely fatal.
Fever usually lasts 2 to 7 days and the virus is cleared from the blood in an average of
5 days (Gubler, 1998; Rigau-Perez et al., 1998; WHO Geneva, 1997).
6
Chapter 1 Introduction
1.3.2 Dengue Hemorrhagic Fever (DHF) and Dengue Shock Syndrome (DSS)
A small portion of DENV infections results in a more severe form of the disease
called DHF and DSS. DHF is defined as meeting all of the following four criteria
(WHO guidelines, 1997): fever or history of fever lasting 2-7 days, hemorrhagic
tendency, low platelet count and plasma leakage. Distinguishing DHF from DF and
other diseases found in tropical areas is difficult especially in the acute phase of
illness and can also have an impact on treatment and hence on the fatality of the
infection. Although DHF/ DSS is observed in all age groups, children are mainly
affected. DSS refers to DHF where shock is present. DSS can be further classified
into different severity grades of moderate or profound shock where pulse pressure is
narrowed or not detectable respectively (Gubler, 1998; WHO Geneva, 1997).
Since distinction between DF and DHF/DSS is difficult and crucial for disease
outcome regarding treatment, the WHO classification scheme has recently been
updated. Disease is classified into dengue with or without warning signs and severe
disease. Warning signs include abdominal pain, mucosal bleed, persistent vomiting,
clinical fluid accumulation, lethargy, restlessness, liver enlargement, increase in
haematocrit and decrease in platelet count (WHO, 2009).
Figure 1.4. Updated classification scheme for dengue according to WHO (2009).
7
Chapter 1 Introduction
1.4 Pathogenesis of Severe Dengue
A variety of factors contributing to disease severity have been identified (Lei et al.,
2001). A number of studies have suggested prior encounter of dengue to be one of the
most important risk factors for developing severe dengue (Dejnirattisai et al., 2010;
Halstead, 1988; Gubler, 1998; Rothman, 2003).
Antibody-dependant enhancement (ADE) has been proposed to play a key role in
developing severe dengue. This was based on the fact that children who display
severe manifestations of DHF/ DSS have already encountered a primary infection
with a different serotype. In vitro studies have shown that preexisting antibodies to a
previously exposed DENV serotype are not able to neutralize the new DENV
serotype. In contrast they are able to enhance infection. Although epidemiological
studies were able to confirm the association of secondary infection with disease
severity, the underlying molecular mechanisms are still poorly understood. One
hypothesized mechanism behind ADE is enhanced virus uptake into Fc-bearing cells,
like monocytes or macrophages, promoted by opsonization through cross-reacting
antibodies (Dejnirattisai et al., 2010; Halstead, 1988; Kliks et al., 1989; Lei et al.,
2001). In addition ADE has been shown to promote viral replication accompanied by
upregulation of cytokines associated with DHF/ DSS resulting in a TH2-type response
(Chareonsirisuthigul et al., 2007; Yang et al., 2001).
An alternative hypothesis for pathogenesis of DHF/ DSS is the degree of virulence of
different variants of DENV. The ability of viral replication in the host might
contribute to the clinical outcome, since high viremia titer was associated with disease
8
Chapter 1 Introduction
severity. In addition it has been reported that the risk of DHF/ DSS is higher in
secondary infections with DENV-2 compared to other serotypes (Rico-Hesse et al.,
1997; Rico-Hesse et al., 1998).
Lei et al. suggested a new hypothesis of DENV immunopathogenesis in which both
ADE and virus virulence can be explained. Dengue infection causes extensive
immune activation leading to overproduction of cytokines as well as inability of the
immune system to clear the virus that results in increased viral replication. Viral load
becomes the key aspect linking both ADE and virus virulence (Lei et al., 2001).
Although cross-reacting antibodies and virus virulence seem to play a key role in
modulating the immune response and shaping disease outcome other factors most
likely contribute to disease outcome as well. Additional risk factors that have been
linked to severe disease include race, age, sex and host genetic factors (Martina et al.,
2009).
9
Chapter 1 Introduction
1.5 Dengue Virus Life Cycle
1.5.1 Structure of Dengue Virions
Dengue virions are approximately 500 Å in diameter and contain a single positivestrand RNA genome. The genome of around 10.8 kB is packaged by virus capsid
protein and surrounded by a host-derived lipid bilayer. The virion surface incorporates
two viral proteins, E (envelope) and M (membrane). The E glycoprotein mediates
binding and fusion during virus entry, whereas the M glycoprotein is the remaining
proteolytic fragment of precursor prM protein and produced during maturation
(Figure 1.5 (a)). The RNA genome has an open reading frame that encodes a single
polyprotein comprised of three structural and seven non-structural proteins (Figure
1.5 (b)). The structural proteins – capsid, membrane and envelope – play an important
role in viral assembly and viral maturation, whereas the non-structural proteins – NS1,
NS2A, NS2B, NS3, NS4A, NS4B and NS5 – are essential for viral replication (Kuhn
et al., 2002; Lindenbach et al., 2007; Mukhopadhyay et al., 2005).
1.5.2 Viral Entry and Fusion
DENV particles enter the cell via receptor-mediated endocytosis, triggered by hostcell receptor and viral glycoprotein interactions (Figure 1.5 (1c)). In vitro studies have
shown that DENV is able to infect a number of different human cells including
dendritic cells, monocytes/ macrophages, B cells, T cells, endothelial cells,
hepatocytes and neuronal cells. In vivo studies suggested that the main target cells of
10
Chapter 1 Introduction
DENV are cells of the mononuclear phagocyte lineage (monocytes, macrophages and
DCs) (Clyde et al., 2006). Host-cell receptors interacting upon virus particle
attachment include DC-SIGN (Navarro-Sanchez et al., 2003), GRP78/BiP
(Jindadamrongwech et al., 2004) and CD14-associated molecules (Chen et al., 1999).
Membrane fusion is mediated by the viral surface E protein and takes place in the
endosome (Figure 1.5 (2c)). The E protein undergoes conformational changes to form
trimers triggered by the acidic environment within the endosome that leads to fusion
of the viral and the cell membrane (Figure 1.5 (3c)). The nucleocapsid is then released
into the cytoplasm and replication of the RNA genome is initiated after dissociation of
the capsid protein and the viral RNA (Mukhopadhyay et al., 2005; Figure 1.5 (4c,
5c)).
1.5.3 Viral Replication, Assembly and Release
Upon release into the cytoplasm the positive-sense viral RNA is translated into a
single polyprotein that is further cleaved co- and post-translationally by host and viral
proteases into 10 proteins (Lindenbach and Rice, 2003). Virus assembly occurs on the
surface of the endoplasmic reticulum (ER) (Figure 1.5 (6c)). Immature, non-infectious
viral particles, that cannot induce host-cell fusion, are formed in the lumen of the ER
and later released into the trans-Golgi network (TGN). Cleavage of the prM protein
(Figure 1.5 (7c)), mediated by the host-cell protease furin in the TGN, creates mature
and infectious particles that are later released at the cell surface via exocytosis
(Mukhopadhyay et al., 2005).
11
Chapter 1 Introduction
It is thought that the genomic RNA forms a replication complex (RC) together with
NS proteins and host proteins on cytoplasmic membranes (Lindenbach and Rice,
2003; Westaway et al., 2003). Replication starts at the 3’ end and results in an
intermediate double-stranded negative-sense RNA, called the replicative form (RF).
The dsRNA RF is then converted into a replicative intermediate complex (RI) that
serves as a template in order to synthesize more positive-strand genomic RNA
(Khromykh and Westaway, 1997). NS5, containing the RNA dependent RNA
polymerase (RdRp), is essential for the production of RFs (Ackermann and
Padmanabhan, 2001; Tan et al., 1996), whereas conversion of RF to RI involves
interaction of both NS5 and NS3 (Bartholomeusz and Wright, 1993; Kapoor et al.,
1995; Raviprakash et al., 1998). Other studies have shown colocalization of RCs with
NS1, NS2A, NS2B and NS4A, suggesting a functional role in viral replication (Chu
et al., 1992; Mackenzie et al., 1996; Mackenzie et al., 1998).
12
Chapter 1 Introduction
Figure 1.5. Schematic representation of Flavivirus life cycle. (a) Schematic
representation of the virus particle. Immature virions contain prM and E as
membrane-associated proteins. Upon maturation the prM protein is cleaved and the M
protein stays attached to the surface. (b) Schematic representation of the genome
organization. The positive-stranded RNA genome of approximately 11 kB comprises
an ORF encoding three structural and seven non-structural proteins. The ORF is
flanked by NCRs at both ends. (c) The virus life cycle can be divided into seven parts:
(1) Attachment of the virus particle to the host cell membrane (2) Viral entry via
receptor-mediated endocytosis (3) Fusion of viral and host cell membrane (4)
Uncoating and release of viral RNA into cytoplasm (5) Translation and replication of
viral genome (6) Assembly of viral particles (7) Exocytosis and release of mature
virions. Adapted from Stiasny and Heinz, 2006.
13
Chapter 1 Introduction
1.6 DENV Structural and Non-structural Proteins
DENV is an enveloped virus containing a single-stranded positive-sense RNA
genome of approximately 11 Kb in length. The genome encodes three structural
proteins (pre-membrane, envelope and capsid) forming the viral particle and seven
non-structural proteins (NS1, NS2A, NS2B, NS3, NS4A, NS4B and NS5) required
for viral replication, virion assembly and invasion (Kummerer and Rice, 2002; Liu et
al., 2003; Rice et al., 1985).
1.6.1 Capsid
The capsid (C) protein is highly basic, approximately 11 kDa in size, and contains
charged residues at its N- and C- termini. An internal short hydrophobic domain
mediates membrane association (Boege et al., 1983; Khromykh and Westaway, 1997;
Rice et al., 1985; Trent, 1977). Dimerization of the C protein, triggered by viral RNA,
is essential for viral assembly (Kiermayr et al., 2004; Kummerer and Rice, 2002;
Lopez et al., 2009; Ma et al., 2004). Although the C protein sequence homology
within Flavivirus is low, the hydrophobic and hydrophilic regions are conserved
(Chambers et al., 1990; Markoff et al., 1997).
14
Chapter 1 Introduction
1.6.2 Pre-membrane
The Pre-membrane (prM) protein is a precursor protein (~ 34 kDa) of the membrane
(M) protein (~ 26 kDa) and is cleaved by the host protease furin in the TGN. Cleavage
mediates maturation and is important for release of viral particles (Elshuber et al.,
2003). In addition prM is essential for proper folding and secretion of the envelope
protein. Its association with prM protein prevents it from undergoing conformational
changes that normally trigger fusogenic activity (Guirakhoo et al., 1991; Guirakhoo et
al., 1992). After cleavage of prM, pr gets secreted, whereas the M protein stays
attached to the mature virion.
More recent studies have shown that recombinant E-prM complexes are immunogenic
and protective in vaccines against several flaviviruses like JEV (Mason et al., 1991),
YFV (Pincus et al., 1992), DENV (Fonseca et al., 1994) and TBEV (Heinz et al.,
1995).
1.6.3 Envelope
The E protein (~ 53 kDa) is the major structural protein exposed at the surface of the
virion. It plays a role in a number of processes including receptor binding, membrane
fusion, virion assembly and is the major target for neutralizing antibodies (Chambers
et al., 1990; Heinz, 1986). The E protein contains 12 cysteine residues, which form
intramolecular disulfide bonds and are highly conserved within Flavivirus (Chambers
et al., 1990; Mandl et al., 1989). In immature virions E is linked to prM and forms
15
Chapter 1 Introduction
heterodimers that protect it from premature acidification while they are transported
through the TGN (Guirakhoo et al., 1993; Konishi and Mason, 1993; Perera and
Kuhn, 2008).
1.6.4 NS1
NS1 (~ 46 kDa) is a highly conserved glycoprotein that is exported via the secretory
pathway to the membrane, where it is either anchored or released as a soluble protein
(Mackenzie et al., 1996; Mason, 1989; Schlesinger et al., 1990; Westaway et al.,
1997). NS1 contains 12 conserved cysteine residues, invariant glycosylation sites and
some other regions of high sequence homology. In recent studies NS1 has been
shown to associate with double-stranded RF suggesting a role in viral replication
(Mackenzie et al., 1996; Westaway et al., 1997). In addition association with
immature E protein in the ER most likely indicates a role in virion assembly and
maturation (Winkler et al., 1988).
1.6.5 NS2A
NS2A (~ 22 kDa) is one of four (NS2A, NS2B, NS4A, NS4B) small, hydrophobic
proteins of the polyprotein. The hydrophobic regions are conserved in position but not
sequence, suggesting membrane-association of these proteins (Chambers et al., 1990;
Rice et al., 1986). The function has yet to be discovered. NS2A has been shown to
16
Chapter 1 Introduction
bind to NS3 and NS5 and localize to the RC, suggesting an involvement in viral
replication (Mackenzie et al., 1998).
1.6.6 NS2B
NS2B is a small (~ 14 kDa) mebrane-associated protein, which is involved in
polyprotein processing together with NS3. The conserved, hydrophilic region,
spanning residues 49-95, is flanked by two hydrophobic domains. The hydrophobic
domains enable membrane-association, whereas the hydrophilic portion interacts with
NS3. Recent studies have shown, that the conserved 40 residue long hydrophilic
portion is crucial for NS3 serine-protease activity. Disruption of NS2B-NS3
interaction can abolish NS3 protease activity (Arias et al., 1993; Chambers et al.,
1991; Chambers et al., 1993; Falgout et al., 1991; Falgout et al., 1993; Leung et al.,
2001; Li et al., 1999; Li et al., 2005; Yusof et al., 2000).
1.6.7 NS3
NS3 (~ 68 kDa) is the second largest protein of the DENV genome and contains
multiple functions crucial for viral propagation. Protease, helicase, NTPase as well as
5’-terminal RNA triphosphatase activities are key features involved in viral
polyprotein processing, genome replication and virus particle assembly (Chambers et
al., 1990; Lindenbach et al., 2007). The RNA helicase is required for unwinding
dsRNA during viral replication, whereas the NTPase is necessary to provide the
energy for unwinding. The RTPase on the other hand is involved in capping of viral
RNA. The NS3 protease is crucial for cleavage of the polyprotein together with NS2B
17
Chapter 1 Introduction
(Benarroch et al., 2004; Borowski et al., 2001; Chambers et al., 1993; Lescar et al.,
2008; Patkar and Kuhn, 2008; Wengler et al., 1991).
1.6.7.1 NS3 Protease
The first 180 aa at the N-terminal region of NS3 encode for the DENV NS3pro and
are highly conserved among flaviviruses (Valle and Falgout, 1998). NS3pro itself is
not active and also not stable unless it is bound to NS2B, which is required for
catalytic activity (Li et al., 2005). A construct containing residues 49-95 of NS2B
linked to residues 1-169 of NS3 via a Gly4-Ser-Gly4 linker has been described for
WNV and DENV 1-4 in order to express soluble and active protease (Leung et al.,
2001; Li et al., 2005). A number of studies to characterize the NS2B-NS3 protease as
well as to screen new potent protease inhibitors have been conducted based on this
construct (Noble et al., 2011; Salaemae et al., 2010; Yin et al., 2006a,b). A recent
study in addition has revealed the ligand-bound crystal structure of the NS2B-NS3
protease closed conformation. When NS2B wraps around NS3 a cavity larger than the
active site is formed on its opposite side. Residues of both NS2B and NS3 are lining
this newly identified pocket, which could be a potential new drug target (Noble et al.,
2011).
The DENV protease is a trypsin-like serine protease containing a His-Asp-Ser
catalytic triad (H51, D75 and S135) that is essential for protease activity since
mutations in those residues abolish enzymatic activity (Bazan and Fletterick, 1989;
Speight et al., 1988). Trypsin-like serine proteases are able to cleave peptide bonds
following a positive charged amino acid like arginine and lysine. The hydroxyl-group
18
Chapter 1 Introduction
of the serine (Ser) acts as a nucleophile, attacking the carbon of the substrate’s
carbonyl-group. Histidine (His) firstly acts as a base and assists in forming a
tetrahedral intermediate, which is stabilized by the hydrogen bond to aspartic acid
(Asp). The now positively charged His then acts as a general acid leading to the
formation of an acylenzyme intermediate. This is later attacked by water yielding a
second tetrahedral intermediate and finally leading to cleavage of the peptide bond
(Hedstrom, 2002).
NS2B-NS3 protease mediates cleavage of the polyprotein between NS2A/ NS2B,
NS2B/ NS3, NS3/ NS4A, NS4A/ NS4B and NS4B/ NS5. In addition it is also
responsible for cleavage within C, NS2A and NS3 (Lindenbach et al., 2007).
1.6.8 NS4A and NS4B
NS4A (~ 16 kDa) and NS4B (~ 27 kDa) are two small, hydrophobic proteins with yet
unknown functions (Lindenbach et al., 2007). The C-terminus of NS4A acts as a
signal sequence for NS4B to translocate to the ER lumen (Lin et al., 1993; Preugschat
et al., 1991). In addition NS4A colocalizes with the RF, suggesting a functional role
in viral replication (Mackenzie et al., 1998).
Colocalization of the transmembrane protein NS4B with NS3 and viral dsRNA in
cytoplasmic ER-derived membrane structures suggests a role in viral replication
(Miller et al., 2006). In addition NS4B is able to dissociate NS3 from ssRNA
(Umareddy et al., 2006). NS4B has also been shown to interfere with interferon by
19
Chapter 1 Introduction
blocking STAT1 and STAT2 activation (Jones et al., 2005; Munoz-Jordan et al.,
2003).
1.6.9 NS5
NS5 is the largest (~ 104 kDa) protein and is also highly conserved. NS5 contains a Sadenosylmethionine dependent methyltransferase (MTase) at its N-terminus, which is
involved in 5’ capping of the viral genome (Dong et al., 2008; Koonin and Dolja,
1993). The C-terminus encodes for a RNA dependent RNA polymerase (RdRp),
which is essential for viral replication (Rawlinson et al., 2006; Tan et al., 1996). In
addition NS5 harbours two nuclear localization signals at residues 320 to 405, which
are likely to play an important role in transportation of NS5 into the nucleus (Brooks
et al., 2002; Forwood et al., 1999; Johansson et al., 2001).
20
Chapter 1 Introduction
1.7 Control of Dengue
1.7.1 Treatment of Dengue
Although primary DENV infections do not need treatment in most cases, a lot of
patients have to be hospitalized in hyperendemic countries, which is associated with a
high financial burden. And yet there is no treatment or vaccine available to control
dengue. Currently the only way to tackle dengue is to prevent transmission by
controlling its vector, Aedes aegypti (Mackenzie et al., 2004).
Current treatment for DF and DHF/ DSS are non-specific and basically treat the
symptoms. Patients with DF require rest, oral fluids to prevent dehydration and
antipyretics for high fever. Acetaminophens but not salicylates are recommended to
reduce risk of bleeding complications. DHF treatment involves a combination of
immediate diagnosis, monitoring hemorrhagic complications and supportive care
(Rigau-Perez et al., 1998).
1.7.2 Vector Control
Given the fact that there is no treatment for dengue, vector control is the only means
to prevent DF and DHF/ DSS. The most effective way to control mosquito
populations is to reduce larval habitats by removing or cleaning water-holding
containers where mosquitoes can breed. Successful eradication programs have been
implemented in the American region in the 1950’s and 1960’s. Unfortunately the
program was disbanded after reduced disease burden and has lead to re-infestation of
21
Chapter 1 Introduction
the mosquito vector. Increased awareness of dengue as a public health issue, together
with implementation of sustainable vector control strategies are therefore likely to
have a huge impact on dengue transmission (Mackenzie et al., 2004; Gubler, 1998).
1.7.3 Vaccines
The fact that infection with one serotype of DENV confers life-long immunity against
that serotype indicates the potential for developing a vaccine against DENV. In
addition vaccines for closely related flaviviruses like YFV, JEV and TBEV have been
marketed already. However, to date there are no vaccines against dengue on the
market, although vaccine development was initiated as early as the 1940’s (Coller et
al., 2011). According to the Pediatric Dengue Vaccine Initiative, a promising vaccine
candidate might be marketed as early as 2015.
The occurrence of four different serotypes represents a huge challenge in developing
vaccines. Especially challenging, with regards to the ADE hypothesis, is the concern
of immune enhancement triggered by vaccination leading to more severe disease upon
a secondary encounter of the pathogen. The lack of an adequate animal model makes
it additionally complex to test vaccine candidates (Bente and Rico-Hesse, 2006).
Nevertheless a promising vaccine candidate is currently undergoing phase III clinical
studies. This live attenuated tetravalent vaccine is based on the YFV vaccine strain
with additional substitutions of dengue virus membrane and envelope protein genes
(Guirakhoo et al., 2006; Whitehorn and Farrar, 2010).
22
Chapter 1 Introduction
1.7.4 Antiviral Therapy
Approximately 40% of the world’s population is at risk of getting dengue. It is
therefore essential to develop therapeutics that inhibit DENV, since there are no
antivirals available on the market. However development of drugs against dengue are
complicated. Drugs need to be safe, inexpensive and effective. High survival rates and
often mild disease outcomes are factors that counteract attempts to develop
treatments. Another issue hindering the development of new treatments is the lack of
appropriate animal disease models (Bente and Rico-Hesse, 2006). Replication in
animals other than humans and mosquitoes is impaired and the clinical pathology of
the disease is often not reflected (Julander et al., 2011).
Research on dengue virus biology has revealed a variety of viral and host proteins that
could potentially be targeted by antiviral therapeutics. Whereas host factors are
difficult to target, due to potential toxicity and side effects, a few viral proteins are
promising.
Both structural as well as non-structural proteins of the DENV polyprotein present
interesting targets. A drug targeting the viral E protein, involved in viral-hostmembrane fusion, could inhibit viral entry (Heinz et al., 2012). Therapeutic antibodies
could be used to attack structural proteins that are found on the surface, however ADE
of dengue infection has to be avoided (Rajamanonmani et al., 2009). NS3 and NS5 on
the other hand are involved in viral replication and could therefore be targeted to
reduce viremia in patients (Lescar et al., 2008; Noble et al., 2011). In addition, a lot of
23
Chapter 1 Introduction
these proteins are highly conserved among flaviviruses inferring potential application
for other viruses.
24
Chapter 1 Introduction
1.8 Aims of the Thesis
The emergence and resurgence of dengue in tropical and subtropical areas together
with the lack of available antiviral therapeutics or vaccines urges the need to develop
new treatment methods. Understanding the basic molecular mechanisms that underlie
viral replication are essential in finding new drug targets as well as obtaining
information for rational drug design.
The work in this study focuses on the viral NS3-NS2B protease that has progressively
gained attention as a potential antiviral target. The crystal structure of NS3-NS2B
protease, involved in polyprotein processing and crucial for viral replication, has
recently been solved. Crystal structures have revealed an allosteric pocket lined by
residues of both NS2B and NS3. The goal of this study is to assess the functional
importance of this pocket by mutating selected residues lining the pocket. Enzymatic
activities of the recombinant mutant protein will be measured and a selection of
mutants will be used to study viral replication in vitro. Together these studies should
help characterize the allosteric pocket and its potential role in viral replication and
whether it can be targeted by rational drug design.
25
Chapter 2 Materials and Methods
MATERIALS AND METHODS
26
Chapter 2 Materials and Methods
Chapter 2 Material and Methods
2.1 Materials
2.1.1 Cloning Primers
Primer Name
DNA Sequence (5’-3’)
D3NS2B_V078A_FOR
D3NS2B_V078A_REV
CACAACTTAATGATCACAGCTGATGATGATGGAAC
GTTCCATCATCATCAGCTGTGATCATTAAGTTGTG
D3NS2B_M084A_FOR
CACAGTTGATGATGATGGAACAGCGAGAATAAAAG
ATGATG
CATCATCTTTTATTCTCGCTGTTCCATCATCATCA
ACTGTG
D3NS2B_M084A_REV
D3NS3_W089A_FOR
D3NS3_W089A_REV
GGAGACTGAGCGCACAAGCGCAGAAGGGGGAG
GAGGTG
CACCTCCTCCCCCTTCTGCGCTTGTGCGCTCAGTCTCC
D3NS3_T118A_FOR
D3NS3_T118A_REV
CAGGCACTTTTCAGGCTACCACAGGGGAAATAG
CTATTTCCCCTGTGGTAGCCTGAAAAGTGCCTG
D3NS3_G124A_FOR
D3NS3_G124A_REV
CTACCACAGGGGAAATAGCAGCAATTGCACTGG
CCAGTGCAATTGCTGCTATTTCCCCTGTGGTAG
D3NS3_N152A_FOR
D3NS3_N152A_REV
GTAGTGGGACTGTATGGCGCTGGAGTGGTTACAAAG
CTTTGTAACCACTCCAGCGCCATACAGTCCCACTAC
D3NS3_I165A_FOR
D3NS3_I165A_REV
GGCTATGTCAGCGGAGCAGCGCAAACAAATGCAG
CTGCATTTGTTTGCGCTGCTCCGCTGACATAGCC
D3NS3_Q167A_FOR
D3NS3_Q167A_REV
GTCAGCGGAATAGCGGCAACAAATGCAGAACCAG
CTGGTTCTGCATTTGTTGCCGCTATTCCGCTGAC
D3NS2B_M084F_FOR
CACAGTTGATGATGATGGAACATTCAGAATAAAAG
ATGATG
CATCATCTTTTATTCTGAATGTTCCATCATCATCA
ACTGTG
D3NS2B_M084F_REV
D3NS3_T118S_FOR
D3NS3_T118S_REV
CAGGCACTTTTCAGTCTACCACAGGGGAAATAG
CTATTTCCCCTGTGGTAGACTGAAAAGTGCCTG
27
Chapter 2 Materials and Methods
D3NS3_N152D_FOR
D3NS3_N152D_REV
GTAGTGGGACTGTATGGCGATGGAGTGGTTACAAAG
CTTTGTAACCACTCCATCGCCATACAGTCCCACTAC
D3NS3_I165L_FOR
D3NS3_I165L_REV
GGCTATGTCAGCGGACTAGCGCAAACAAATGCAG
CTGCATTTGTTTGCGCTAGTCCGCTGACATAGCC
D2NS3_T118A_FOR
CCAAACAAAACCTGGTCTTTTCAAAGCAAACGCC
GGAACC
GGTTCCGGCGTTTGCTTTGAAAAGACCAGGTTTT
GTTTGG
D2NS3_T118A_REV
D2NS3_T118S_FOR
D2NS3_T118S_REV
D2NS3_I165A_FOR
D2NS3_I165A-REV
CCAAACAAAACCTGGTCTTTTCAAAAGCAACGCC
GGAACC
GGTTCCGGCGTTGCTTTTGAAAAGACCAGGTTTT
GTTTGG
GCATATGTGAGTGCTGCAGCCCAGACTGAAAAAA
GTATTG
CAATACTTTTTTCAGTCTGGGCTGCAGCACTCAC
ATATGC
Mutated residues are highlighted in red
2.1.2 DNA Sequencing Primers
Primer Name
DNA sequence
SEQ_D2NS3_FOR
SEQ_D2NS3_REV
CCATCATGGGCGGACGTTAAGAAAGACC
GGTCCATGATGGTCAATTTTCTCTTTCG
SEQ_D2-3’UTR_FOR
GGGCAAAGAACATCCAAACAGC
pGEX_FOR
PGEX_REV
GGGCTGGCAAGCCACGTTTGGTG
CCGGGAGCTGCATGTGTCAGAGG
T7 Promotor
TAATACGACTCACTATAGGG
28
Chapter 2 Materials and Methods
2.1.3 Antibodies
Primary Antibody
Anti-NS3
Species
rabbit
Clonal
polyclonal
Company
in house
Anti-E 4G2
mouse
monoclonal
in house
Secondary Antibody
Goat anti-rabbit IgG,
fluorescin conjugated
Goat anti-mouse IgG,
fluorescin conjugated
Name
TRTC
Catalogue Nr.
T6778
Company
Sigma-Aldrich
FITC
F0257
Sigma
29
Chapter 2 Materials and Methods
2.2 Methods
2.2.1 Generating DENV-3 Protease Mutants
Vector pGEX6P1 (GE Healthcare, Figure 2.1) containing the residues 49 to 96 of
NS2B DENV serotype 3 (strain S221/03) connected to residues 1-182 of NS3 DENV3 by a G4SG4 linker was used to generate protease mutants (V078A, M084A,
W089A, T118A, G124A, N152A, I165A, Q167A kindly provided by Lee, Le Tian;
NITD as well as M084F, T118S, N152D, and I165L). Mutations were introduced
using QuickChangeTM site-directed mutagenesis (SDM) with specific mutagenic
primers. PCR conditions were as follows: 95°C for 30 sec; followed by 18 cycles of
95°C for 50 sec, 60°C for 50 sec and 68°C for 9 min; and finished with 68°C for 7
min) (detailed protocol in section appendix: PCR mix and cleaning up of PCR
product). The PCR products were then transformed into XL1Blue competent cells (in
house) and spread on LB agar plates containing 100 µg / ml ampicillin (detailed
protocol of bacterial transformation in section appendix). Clones were isolated and
purified using the QIAprep Spin Miniprep Kit to further be verified by DNA
sequencing (AITbiotech, Singapore).
2.2.2 Expression and Purification of DENV-3 Protease Mutants
Protease mutant constructs and the wildtype (WT) construct were transformed into
chemically competent BL21 DE3 cells (in house), spread on Luria Bertani (LB) plates
containing 100 µg / ml ampicillin and grown overnight (O/N) at 37°C. One individual
30
Chapter 2 Materials and Methods
colony per plate was picked and inoculated into 20 ml of LB broth containing 100 µg
/ ml ampicillin and incubated at 37°C O/N shaking at 220 rpm. 5 ml of the O/N
culture was then inoculated into 500 ml LB broth containing ampicillin using a 2l
flask. The cultures were grown at 37°C shaking at 220 rpm until the OD595 had
reached 0.6-0.8 and then cooled down to 4°C for 10 min. Protein expression was then
induced by adding 0.5 mM Isopropyl-β-D-thiogalactopyranoside (IPTG) and kept
shaking at 160 rpm at 16°C O/N. The cultures were harvested by centrifugation at
6’000 rpm at 4°C for 10 min and the cell pellet was then resuspended in GST binding
buffer (20 mM TRIS-HCl pH 7.5, 300 mM NaCl, 1 mM EDTA) before being lysed
using a sonicator (50% intensity, 10 min, pulse 2 sec on and 5 sec off) (detailed
protocol in section appendix: growing cells and expression of proteins, protein
purification). The lysate was later centrifuged at 20’000 rpm for 1 hour at 4°C and the
supernatant, containing the recombinant protein attached to a glutathione Stransferase (GST) tag at its N-terminus, loaded onto a GSTrapTM FF 5 ml column (GE
Healthcare) for further purification with GST binding buffer and GST elution buffer
(40mM TRIS-HCL pH 7.5, 300 mM NaCl, 1 mM EDTA and 2 mM gluthathione).
Fractions
were
analyzed
by
sodium
dodecyl
sulfate-polyacrylamide
gel
electrophoresis (SDS-PAGE) to select for cleavage using Prescission protease (GE
Healthcare) incubating at 4°C O/N. After being purified through the GST column
again, cleavage was confirmed by SDS-PAGE. In a last step the proteins were
concentrated using a Vivaspin concentrator (Sartorius) and then loaded onto a
HiLoadTM 26/60 SuperdexTM 200 column that was equilibrated with gel filtration
buffer (20 mM TRIS-HCl pH 7.5, 300 mM NaCl). Samples were picked according to
SDS-PAGE gel analysis and concentrated and quantified using a NanoDrop®
Spectrophotometer ND-1000m by measuring the absorbance at 280 nm.
31
Chapter 2 Materials and Methods
Figure 2.1. Vector pGEX6P1. Schematic representation of vector containing the
DENV-3 NS2B-NS3 protease construct as well as an ampicillin resistance cassette
(AmpR) to select for mutants that successfully have taken up the plasmid. In addition
the vector carries a LacI site to induce protein expression as well as a GST tag used
for purification of the protein.
32
Chapter 2 Materials and Methods
2.2.3 Dengue NS3 Protease Activity Assay
The enzymatic activity of the NS2B-NS3 recombinant protease mutants was assessed
using a fluorogenic peptide substrate Gly-Arg-Arg-7-amino-4-methylcoumarin (GlyArg-Arg-AMC) and an automated fluorescence plate reader (Tecan). The assay
principle is explained in chapter 3, section 3.1.3. The substrate was diluted in 50 mM
TRIS-HCl, pH 8.5 + 20% (v/v) glycerol and the recombinant protease mutants were
diluted in 50 mM TRIS-HCl, pH 8.5 + 20% (v/v) glycerol + 2.5 mM CHAPS. The
enzyme assay was performed in a final volume of 20 µl per well of a Corning Costar
black 96-well plate. Both substrate and enzymes were incubated at 37° C for 10 min
prior to putting them together and measuring the fluorescence. Measurement was also
done at 37° C at an excitation wavelength of 385 nM and an emission wavelength of
465 nM. Substrate concentrations were in the range of 30 µM to 750 µM whereas
protease concentrations were in the range of 0.1 µM to 0.5 µM. Fluorescence values
in rfu/min were plotted vs. substrate concentration and Michealis-Menten kinetics
were obtained using Prism software by performing non-linear regression. Various
dilutions and sets of measurement were conducted. Duplicates for each measurement
were performed and average and standard deviations were calculated.
2.2.4 Construction of Genome-length DENV-2 Mutant cDNA
pACYC-NGC SacII/XhoI (shutter B, kindly provided by Xie, Xuping; NITD)
containing the structural proteins C, prM and E as well as the non-structural proteins
NS1, NS2A, NS2B and NS3 of DENV-2 (Figure 2.2) was used to generate a new set
33
Chapter 2 Materials and Methods
of protease mutants using QuickChangeTM SDM and the respective primers as
previously described. The PCR product was then transformed into XL1 Blue
competent cells and positive clones were isolated and DNA sequencing was used to
verify the mutations (AITbiotech, Singapore).
The positive mutant constructs and the WT construct (DENV-2 infectious clone
Figure 2.3; kindly provided by Xie, Xuping; NITD) were digested with Xho-1 and
Nhe-1 for 3 h at 37°C (detailed protocol in section appendix: digestion mix). Samples
were run on a 0.8% agarose gel and the respective bands excised and further purified
using a QIAquick spin column (detailed protocol in section appendix: QIAquick gel
extraction kit protocol). The vector and the individual mutants were then ligated O/N
at 16°C using T4 DNA ligase to generate genome-length DENV-2 infectious clones
(detailed protocol in section appendix: ligation mix). The ligation mixture was then
transformed into Top10 competent cells (Invitrogen) and positive clones further
analyzed by DNA sequencing.
34
Chapter 2 Materials and Methods
Figure 2.2. pACYC-NGC shutter B used to generate infectious clone. Vector
containing the structural proteins C, prM and E as well as the non-structural proteins
NS1, NS2A, NS2B and NS3. The restriction sites Xho I and Nhe I were used to cut
out the part of interest in order to be introduced into the WT infectious clone.
35
Chapter 2 Materials and Methods
Figure 2.3 pACYC-NGC infectious clone. WT construct containing the whole
genome of DENV-2 and the restriction sites Xho I and Nhe I to introduce the shutter
containing the mutation in NS3.
36
Chapter 2 Materials and Methods
2.2.5 In Vitro Transcription of Genome-length DENV-2 Infectious Clone
In order to be in vitro transcribed, the genome-length DENV-2 constructs were
linearized using ClaI restriction enzyme incubated at 37°C for 2 h (detailed protocol
in section appendix: linearization). Cleavage was then confirmed by running a 0.8%
agarose gel and the linear plasmid further purified by ethanol precipitation. In vitro
transcription was performed using the mMessage mMachine® Kit (Ambion) at 37°C
for 2 h followed by a DNase I treatment for 15 min (detailed protocol in section
appendix: in vitro transcription). The mixtures were then cleaned by phenolchloroform and precipitated using ethanol.
2.2.6 Culturing and Passaging of BHK21 Cells
A
vial
containing
frozen
baby
hamster
kidney
cells
(BHK21-US)
in
Dimethylsulfoxide (DMSO, Sigma) and Fetal Bovine Serum (FBS, Thermo
Scientific) was dissolved in 10 ml fresh Dulbecco’s Modified Eagle Medium
(DMEM) containing 10% FBS, 1% Penicillin-Streptomycin (PS, Gibco) and 5%
glutamine. The cells were incubated at 37°C and 5% CO2 in a culture flask. Cells
were passaged as soon as they had reached at least 90% confluency.
37
Chapter 2 Materials and Methods
2.2.7 RNA Transfection and Immunofluorescence Assay (IFA)
Cells were harvested and counted in order to get a suspension of 1 x 107/ ml BHK21US cells in PBS. Work using living virus was done in the virus room under Biosafety
conditions 2. 800 µl of that cell suspension and 10 µg of the in vitro transcribed RNA
were then transferred into a 0.4 cm gap sterile Gene Pulser Electroporation cuvette
(Bio-Rad) and pulsed 3 times at 850 V and 25 µF (3 second intervals) using Gene
Pulser XcellTM Electroporation System (Bio-Rad). After a recovery time of 10 min at
RT the cells were resuspended in a final volume of 25 ml DMEM with 10% FCS and
5% glutamine. 500 µl, 250 µl, 150 µl and 100 µl (respectively for the different days
post transfection) of the cell suspension were then seeded into 4-well plates with
coverslips and incubated at 37°C. Samples were then fixed and stained on day 1, day
2, day 3 and day 4 p.t. and analyzed under the fluorescence microscope (Leica
DM4000 B).
38
Chapter 3 Results
RESULTS
39
Chapter 3 Results
Chapter 3 Results
3.1 The Allosteric Pocket in the Dengue Protease
3.1.1 Generating DENV-3 NS2B-NS3 Mutants
Correct polyprotein processing is crucial for viral replication and is mediated by a
combination of host proteases and the viral NS2B-NS3 protease (Cahour et al., 1992;
Falgout et al., 1991). In order to be fully active the NS3 protease, encoded by residues
1-182 of the N-terminal non-structural protein 3, requires NS2B for activity. In
addition subsequent findings suggested that a 47 amino acid long hydrophilic portion
of the non-structural protein 2B is sufficient for its activity (Erbel et al., 2006).
Crystal structures have been reported recently for the DENV-3 protease-peptide
complex that revealed a cavity larger than the active site. This pocket is formed when
NS2B wraps around NS3 and is located at the opposite side of the protein from the
active site (Chappell et al., 2008; Noble et al., 2011; Figure 3.1).
40
Chapter 3 Results
(A)
(B)
41
Chapter 3 Results
(C)
Figure 3.1. Structure of DENV-3 protease adopting the closed conformation. (A)
Surface view of the DENV-3 protease shown in green and residues selected for
mutagenesis highlighted in magenta. (B) Reverse view of A. (C) Structure of DENV3 protease in its closed conformation shown in cartoon representation. NS3 is
coloured in green, whereas NS2B is shown in blue. Residues selected for mutagenesis
are represented as sticks and highlighted in red for residues on NS2B and magenta for
residues on NS3. The cartoons were generated using PyMOL software and the
structure from the Protein Data Bank (PDB: 3U1I).
42
Chapter 3 Results
A construct containing residues 49 to 96 of DENV-3 NS2B linked by Gly4SerGly4
(G4SG4) to residues 1-182 of DENV-3 NS3 (Figure 3.2) was used to generate
protease mutants in order to assess the importance of this newly identified pocket.
Since the crystallized structure from the recent study was DENV-3, this serotype was
also used in my study.
A subset of residues that are lining the pocket formed by NS2B-NS3 were picked to
introduce an amino acid change to alanine using SDM. Replacing the residues with an
alanine removes the functional side chain of the original amino acid. Since alanine is
the simplest amino acid, carrying only a non-reactive methyl group at the α-carbon, it
is seldom directly involved in enzyme catalysis. Suggesting that, residues mutated to
alanine, which show impaired or abolished enzymatic activity are of functional
importance for the protease. The primers for SDM containing the mutation site were
designed according to a codon usage table for E. coli. I tried to achieve a change of as
few nucleotides as possible in the codon of interest itself as well as avoiding the use
of very rare codons in order to reduce mismatches to make the PCR reaction simpler
(Table 3.1). The mutant constructs were then analysed by sequencing. Figure 3.3
shows a typical sequencing result where mutagenesis could be confirmed.
Figure 3.4 shows the sequence alignment for NS2B and NS3 for all four DENV
serotypes. The residues selected for mutagenesis studies are highlighted with asterisk.
Residues lining the newly identified pocket were picked based on conservation among
the serotypes. They are highly conserved for the four serotypes. In addition, NS3
shows a high level of sequence conservation within the Flavivirus genus, implying
functional importance of this region. NS2B on the other hand is less conserved among
43
Chapter 3 Results
flavivirus. However NS2B of different flaviviruses contain structural similarities like
hydrophobic domains, with a potential to span membranes (Chambers et al., 1990).
Figure 3.2 NS3-NS2B construct used for mutagenesis. Schematic representation of
the NS3-NS2B construct used to generate mutants (adapted from Lescar et al., 2008).
Codon usage frequency1
Residue
NS2B-DENV-3
Codon switch
Val078Ala
GTT to GCT
1.8
Met084Ala
ATG to GCG
3.2
NS3-DENV-3
Trp089Ala
TGG to GCG
3.2
Thr118Ala
ACT to GCT
1.8
Gly124Ala
GGA to GCA
2.1
Asn152Ala
AAT to GCT
1.8
Ile165Ala
ATA to GCA
2.1
Gln167Ala
CAA to GCA
2.1
1
average frequency this codon is used per 100 Codons
Table 3.1. Mutated residues and codon usage in E. coli genes.
44
Chapter 3 Results
Figure 3.3. Sequencing chromatogram. Typical sequencing result with mutated
nucleotides highlighted in yellow (Mutant Met084Phe).
(A)
(B)
Figure 3.4. Alignment of amino acid sequences for DENV 1-4 NS2B (A) and
NS3pro (B). Residues selected for mutagenesis studies are highlighted with asteriks.
Yellow shading indicates 100% identity, whereas blue indicates conservative regions
with green shading for amino acids with similar properties.
45
Chapter 3 Results
3.1.2 Expression and Purification of DENV-3 NS2B-NS3 Recombinant Protein
Mutant constructs were transformed into competent E. coli cells, cultured and protein
expression was induced by IPTG. Overexpression was confirmed by SDS-PAGE
(Figure 3.5). Proteins were purified using a GST column in a three-step process.
Figure 3.6 shows selected graphs and Figure 3.7 shows selected gels of the different
purification steps.
Figure 3.5. Overexpression of mutated NS3-NS2B protein attached to a GST tag.
Overexpression of NS2B-NS3 protease mutants expressed in E. coli was confirmed
by SDS-PAGE. The red arrow indicates the band referring to the overexpressed
protein.
.
46
Figure 3.6. Typical chromatograms after GST trap (left) and GST removal
(right). The peak fractions were collected for SDS-PAGE to confirm fractions
containing the protein of interest attached to the GST tag and cleavage of the GST tag
respectively.
Chapter 3 Results
47
Chapter 3 Results
(A)
(B)
(C)
48
Chapter 3 Results
Figure 3.7. Typical gel pictures of the different protein purification steps. SDSPAGE after GST trap (A), GST removal (B) and Gel filtration (C). Fractions
containing the protein attached to GST are collected (Frac 8-12, A) and prescission
protease is used to cleave the tag. The flow through (B) containing the cleaved protein
is further purified and fractions collected (Frac B1-B6 & C1, C).
3.1.3 Assessing the Enzymatic Activity of DENV-3 NS2B-NS3 Protease Mutants
In order to assess the enzymatic activity for the different protease mutants an assay
was performed using a fluorogenic peptide substrate Gly-Arg-Arg-AMC. The peptide
bound to the fluorophore (AMC) is preventing the fluorescence of AMC. Cleavage
mediated by the protease releases AMC and a strong fluorescence signal can be
measured (Yusof et al., 2000; Figure 3.8). Based on that principle the performance of
the different NS2B-NS3 protease mutants can be assessed and compared.
Figure 3.8. Schematic diagram of the principle of the AMC assay. Peptide bound
to the AMC substrate is only weakly fluorescent. As soon as the protease cleaves to
release AMC, the coumarin starts to strongly fluoresce and the signal can be
measured.
A variety of different enzyme as well as substrate concentrations were used to assess
the protease activity. Enzyme concentrations were in the range of 0.1 to 0.5 µM,
whereas substrate dilutions were performed in the range of 30 to 750 µM. Activities
relative to WT are summarised in table 3.2. Mutant Q167A showed a slight increase
49
Chapter 3 Results
of activity compared to WT. Residual activity could be seen with mutants I165A (3%
compared to WT) and M084A (11% compared to WT).
In order to obtain kinetic parameters, substrate dilutions were performed and
fluorescence signals were plotted against substrate concentrations. The graphs were
then analyzed by non-linear regression using GraphPad Prism 5 software and fitted to
the Michealis-Menten equation. Figure 3.9 shows two graphs obtained after analysis.
Measurements were conducted in duplicates and average values and the
corresponding standard deviations were plotted against substrate concentrations.
Mutant
Wildtype
NS2B-DENV-3
Val078Ala
Met084Ala
Activity in %
100%
Not active
11%
Mutant
NS3-DENV-3
Trp089Ala
Thr118Ala
Gly124Ala
Asn152Ala
Ile165Ala
Gln167Ala
Activity in %
Not active
Not active
Not active
Not active
3%
123%
Table 3.2. Mutant protease activities compared to WT. Mutants were compared at
0.25 µM enzyme concentration and at 150 µM substrate concentration. Measurements
were done in duplicates and the mean value was normalized to the WT.
50
Chapter 3 Results
(A)
(B)
Figure 3.9. Substrate dilutions plotted against fluorescence signal and analysed
by non-linear regression fitted by the Michaelis-Menten equation. A shows WT
and B shows mutant T118A that showed no activity. Mean values were plotted and
error bars reflect standard deviations obtained from duplicate measurements.
Table 3.3 shows the different kinetic parameters that were obtained from the
measurements of the enzymatic assay for the mutants and WT. Since the values have
not been compared and adjusted to standard concentrations of AMC, they are quoted
in arbitrary units of RFU. They still represent true kinetic values and can be used to
compare the mutants.
51
Chapter 3 Results
As already shown in table 3.2 only three mutants showed activity. Mutants V087A,
W089A, T118A, G124A, N152A showed no activity at all and values for vmax are
extremely small and therefore calculations of kinetic parameters meaningless. Even
with increasing enzyme and substrate concentrations enzymatic activity could not be
rescued. The same is true for mutant I165A that showed only little activity (Table
3.2). The kcat and the kcat/KM as well as vmax are reduced for M084A, whereas the KM
is increased. The kcat for Q167A as well as the kcat/KM are highly increased with an
almost two-fold and three-fold increase respectively compared to WT. The KM on the
other hand is reduced. The main difference between the active mutants lies in the
Michaelis-Menten constant (KM), therefore suggesting that mutant M084A reduces
the affinity and Q167A increases the affinity for the substrate.
Mutant
KM (µM)
vmax (Rfu/min)
kcat (Rfu µM min-1)
kcat / KM
Wildtype
215.2 ± 58.2
220.1 ± 25.2
880.4 ± 100.8
4.1 ± 1.7
–
526.8 ± 170.6
–
136.9 ± 31.2
–
547.6 ± 124.8
–
1.04 ± 0.73
–
–
–
–
–
110.9 ± 20.6
0.3 ± 0.1
0.3 ± 0.1
0.9 ± 0.4
0.8 ± 0.1
1 ± 0.7
331.3 ± 21.8
–
–
–
–
–
1325.2 ± 87.2
–
–
–
–
–
11.9 ± 4.2
NS2B-DENV-3
Val078Ala
Met084Ala
NS3-DENV-3
Trp089Ala
Thr118Ala
Gly124Ala
Asn152Ala
Ile165Ala
Gln167Ala
Table 3.3. Kinetic parameters for DENV-3 NS2B-NS3 mutants and WT.
52
Chapter 3 Results
3.1.4 Additional Mutagenesis Studies with Selected Residues
From the previously picked residues four were chosen to conduct some additional
mutagenesis studies. The mutations as well as the codons that were used in the
primers are summarized in Table 3.4.
Codon usage frequency1
Residue
NS2B-DENV-3
Codon switch
Met084Phe
ATG to TTC
NS3-DENV-3
Thr118Ser
ACT to TCT
1.1
Asn152Asp
AAT to GAT
3.3
Ile165Leu
ATA to CTA
0.3
1
1.8
average frequency this codon is used per 100 Codons
Table 3.4. Mutated residues and codon usage in E. coli genes
Table 3.5 summarizes the activities in percentages compared to WT. Mutant N152D
is completely inactive, likewise the mutant N152A. Mutant I165L shows residual
activity in a similar range to mutant I165A. However mutants M084F as well as
T118S show activities that are only slightly reduced compared to WT. This is a
striking contrast to when the same residues are mutated to alanine (Table 3.2). Figure
3.10 compares the same four mutants with WT graphically including the data for the
corresponding alanine mutants. For an overall comparison Figure 3.11 shows the data
for all mutants that showed activity compared to the WT.
53
Chapter 3 Results
Mutant
Wildtype
NS2B-DENV-3
Met084Phe
Activity in %
100%
62%
Mutant
NS3-DENV-3
Thr118Ser
Asn152Asp
Ile165Leu
Activity in %
61%
Not active
6%
Table 3.5. Mutant protease activities compared to WT. Mutants were compared at
an enzyme concentration of 0.25 µM and a substrate concentration of 150 µM.
Measurements were done in duplicates and the mean value was normalized to the
WT.
Figure 3.10. Activities of mutants compared to WT. Graph shows the four mutants
that were selected for further mutagenesis studies as well as their corresponding
alanine mutants. T118A, N152A and N152D are also included in the graph although
they did not show activity. Measurements were done in duplicates and the mean value
was normalized to the WT.
54
Chapter 3 Results
Figure 3.11. Activities of mutants compared to WT. Graph shows all active
mutants from the two sets of mutagenesis studies. Measurements were done in
duplicates and the mean value was normalized to the WT.
(A)
55
Chapter 3 Results
(B)
(C)
Figure 3.12. Substrate dilutions plotted against fluorescence signal and analysed
by non-linear regression fitted by the Michaelis-Menten equation. Mutant T118S
(A) exhibited increased activity compared to the alanine mutant, whereas I165L (C)
only showed a little and N152D (B) no activity. Mean values were plotted and error
bars reflect standard deviations obtained from duplicate measurements.
Table 3.6 shows the different kinetic parameters that were obtained from the
measurements of the enzymatic assay for the four selected mutants and WT. No
activity could be measured for mutant N152D, which is also reflected in the kinetic
parameters. Vmax is again extremely small similar to mutant N152A and therefore
calculations for additional kinetic parameters have been excluded. The same is true
for mutant I165L, which exhibited little activity (Table 3.5). The kinetic parameters
for both mutants M084F and T118S are similar (Table 3.5). They have an increased
kcat and a significantly higher kcat/KM as compared to the inactive mutants. The KM
56
Chapter 3 Results
values for the active mutants and WT are in a similar range, suggesting that the
mutations do not have an influence on substrate affinity. However the differences for
the vmax values are substantial, indicating an impact on the maximal rate due to the
mutations.
Mutant
kcat / KM
215.2 ± 58.2
220.1 ± 25.2
880.4 ± 100.8
4.1 ± 1.7
171.7 ± 23.7
42.03 ± 2.3
168.1 ± 9.2
1 ± 0.4
167.2 ± 33.5
–
–
41.5 ± 3.3
0.6 ± 0.3
2.8 ± 0.1
166 ± 13.2
–
–
1 ± 0.4
–
–
NS2B-DENV-3
Met084Phe
Thr118Ser
Asn152Asp
Ile165Leu
kcat (Rfu µM min-1)
Wildtype
NS3-DENV-3
vmax (Rfu/min)
KM (µM)
Table 3.6. Kinetic parameters for DENV-3 NS2B-NS3 mutants and WT.
3.1.5 Assessing Viral Replication of Selected Mutants In Vitro
To examine the relevance of the biochemical results obtained in section 3.1.3 and
3.1.4 a DENV-2 infectious clone, carrying mutations on NS2B-NS3 protease, was
generated and transfected into BHK21 cells. In contrast to the biochemical assays
previously conducted, DENV-2 was used, simply because this serotype was available
57
Chapter 3 Results
at our institute. The idea was to monitor viral replication in vitro using
immunofluorescence. The mutations as well as the codons that were used in the
primers to generate the infectious clone are summarized in Table 3.7. A smaller
shutter vector containing approximately half of the viral genome (8’934 bp, Figure
2.2) was used to first introduce the mutation, since it is easier to genetically
manipulate this smaller vector. In a second step, the shutter containing the desired
mutation was cleaved and ligated into the whole WT infectious clone (14’369 bp,
Figure 2.3). Sequencing was used to check for the 3’ UTR as well as the introduction
of the correct mutation. In order to be in vitro transcribed, the cDNA plasmid was
linearized using a restriction enzyme (ClaI). Linearization was confirmed by 0.8%
agarose gel electrophoresis (Figure 3.13 A). After in vitro transcription the RNA
quality was checked by agarose gel electrophoresis (Figure 3.13 B) before BHK21
cells could be transfected.
Codon usage frequency1
Residue
Codon switch
NS3-DENV-2
Thr118Ala
ACC to GCA
2.1
Thr118Ser
ACC to AGC
1.5
Ile165Ala
ATA to GCA
2.1
1
average frequency this codon is used per 100 Codons
Table 3.7. Mutated residues and codon usage in E. coli genes
58
Chapter 3 Results
(A)
(B)
Figure 3.13. 0.8% agarose gel to check for linearization (A) and RNA quality (B).
Gel confirmed that mutant infectious clones were linearized by ClaI restriction
enzyme (A). RNA purity after IVT was checked by an agarose gel (B).
59
Chapter 3 Results
Viral replication was monitored for 4 days post transfection (p.t.) and samples were
stained for the envelope protein (anti-E 4G2) and NS3 (anti-NS3). Expression of both
NS3 and the envelope protein can be clearly seen in the WT clone, where expression
peaked at day 3 and 4 p.t. respectively (Figure 3.14). For mutant T118S NS3
expression is slower and fewer cells are IFA-positive compared to WT with peaked
expression at day 4. The staining for the envelope protein is not as strong as for NS3.
Nevertheless substantial expression can be seen on day 4 p.t (Figure 3.15). Mutant
T118A shows less expression of NS3 as well as envelope protein compared to both
WT and T118S. Only a few cells express both proteins and the majority of cells are
IFA-negative even at day 4 p.t. (Figure 3.16). Samples for mutant I165A were IFAnegative for both NS3 as well as the envelope protein (Figure 3.17).
These findings are consistent with the data from the enzyme activity assay and show
that mutations to alanine impair NS3 activity, whereas the specific mutation of
residue T118 to serine is able to restore NS3 activity similar to WT.
60
48 h.p.t.
72 h.p.t.
Figure 3.14. Viral replication in vitro of DENV-2 wildtype infectious clone. IFA of BHK21
cells electroporated with genome-length WT RNA. At the indicated time points, cells were fixed
with 100% cold methanol and incubated with anti-NS3 antibody (red, upper panel) and anti-E
antibody (green, lower panel). Nuclear DNA was stained with DAPI (blue). Slides were analyzed
by fluorescence microscopy.
24 h.p.t.
96 h.p.t.
Anti-E
Anti-NS3
Chapter 3 Results
61
48 h.p.t.
72 h.p.t.
Figure 3.15. Viral replication in vitro of DENV-2 mutant T118S infectious clone. IFA of
BHK21 cells electroporated with genome-length mutant T118S RNA. At the indicated time points,
cells were fixed with 100% cold methanol and incubated with anti-NS3 antibody (red, upper
panel) and anti-E antibody (green, lower panel). Nuclear DNA was stained with DAPI (blue).
Slides were analyzed by fluorescence microscopy.
24 h.p.t.
96 h.p.t.
Anti-E
Anti-NS3
Chapter 3 Results
62
24 h.p.t.
48 h.p.t.
72 h.p.t.
96 h.p.t.
Anti-E
Anti-NS3
Figure 3.16. Viral replication in vitro of DENV-2 mutant T118A infectious clone. IFA of
BHK21 cells electroporated with genome-length mutant T118A RNA. At the indicated time
points, cells were fixed with 100% cold methanol and incubated with anti-NS3 antibody (red,
upper panel) and anti-E antibody (green, lower panel). Nuclear DNA was stained with DAPI
(blue). Slides were analyzed by fluorescence microscopy.
Chapter 3 Results
63
48 h.p.t.
72 h.p.t.
96 h.p.t.
Anti-E
Anti-NS3
Figure 3.17. Viral replication in vitro of DENV-2 mutant I165A infectious clone. IFA of
BHK21 cells electroporated with genome-length mutant I165A RNA. At the indicated time points,
cells were fixed with 100% cold methanol and incubated with anti-NS3 antibody (red, upper
panel) and anti-E antibody (green, lower panel). Nuclear DNA was stained with DAPI (blue).
Slides were analyzed by fluorescence microscopy.
24 h.p.t.
Chapter 3 Results
64
Chapter 4 Discussion
DISCUSSION
65
Chapter 4 Discussion
Chapter 4 Discussion
An estimated 50 to 100 million infections are caused every year by one of the four
DENV serotypes (Guzman et al., 2010). And yet there are no clinically approved
vaccines or therapeutics. It is therefore essential to understand the basic principles
behind DENV infection in order to get new potential targets leading to vaccines or
antiviral therapeutics.
Viral proteases have shown to be a potential target. Two protease inhibitors that are
acting against the viral protease of HCV, belonging to the genus Flavivirus, have been
approved recently (Chen and Njoroge, 2009). Others are still in various stages of
clinical trials (Soriano et al., 2011).
The DENV protease domain, comprising the first ~ 170 amino acids of NS3, shares
high sequence homology with various members of the genus Flavivirus (Valle and
Falgout, 1998). The serine protease is crucial for viral polyprotein processing and
depends on association with a hydrophilic portion of the NS2B protein for activity
(Erbel et al., 2006). Together with host proteases, the viral protease is essential for
viral replication and therefore a putative target against DENV infection (Chambers et
al., 1990). Recent findings have revealed a pocket larger than the active site that is
formed, when NS3-NS2B adopts the closed conformation. Residues from both NS3 as
well as NS2B are lining that pocket (Noble et al., 2011). Furthermore conservation of
the pocket in the WNV protease structure suggests that it is functionally important
(Aleshin et al., 2007; Erbel et al., 2006).
66
Chapter 4 Discussion
Based on these findings mutagenesis studies were conducted on selected residues
lining the pocket in order to get a better understanding of how this newly identified
pocket influences protease activity, and whether it can be targeted by direct-acting
antivirals.
In the first part of our study eight residues of DENV-3 NS2B-NS3 that line this
pocket, were selected, mutated to alanine and tested for enzymatic activity (Table
3.1). Based on these results, four of these residues were picked for further
mutagenesis studies (Table 3.4). Finally, an infectious clone of DENV-2 was used to
assess viral replication in vitro for three of the selected mutants (Table 3.7).
4.1. Alanine Mutagenesis Studies
Alanine substitutions in the selected residues of DENV-3 NS2B-NS3pro indeed had
marked effects on enzymatic activities. Five Mutants were completely inactive,
whereas activity for two mutants was substantially decreased compared to WT.
However one mutant showed slightly increased activity compared to WT. Since the
values obtained for vmax for the inactive mutants were extremely small, kinetic
parameters were only calculated for the two active mutants and WT. Substantial
differences could be seen in KM, a measure that is related to the substrate binding
affinity. It is more than two-fold increased for mutant M084 whereas reduced by half
for Q167 compared to WT. Differences for vmax were not as striking. The same is true
for kcat values, since calculations directly depend on vmax (Table 3.3). Together this
67
Chapter 4 Discussion
suggests that mutations in those two residues have an impact on the binding affinity
rather than on the maximal rate and the turnover number kcat.
Salaemae et al. have previously conducted a similar study where they mutated
selected residues of DENV-2 NS3 to alanine. They were able to show that alanine
substitution had a vital effect on substrate affinity for all selected mutants with one
exception. All mutants showed increased KM values whereas one mutant had a
slightly higher substrate affinity compared to WT. Of interest in relation to my study
are their results for residues N152 and I165. Of all the mutants, where activity was
detectable, those showed the highest KM values and smallest values for kcat, indicating
a dramatic impairment on enzymatic activity (Salaemae et al., 2010). This is
overlapping with our findings where activities for residues N152 and I165 were also
dramatically reduced. Yet our values have not been adjusted to standard
concentrations of AMC as compared to Salaemae’s study and hence individual values
cannot be compared directly. In addition DENV-3 was used in my study, whereas the
previous study used DENV-2 protease, which is more active in vitro and hence the
kinetics cannot be directly compared anyway. However, these results suggest that
these two residues are of high importance for the function of the NS3 protease and
likely to be involved in substrate binding.
68
Chapter 4 Discussion
4.2. Additional Mutagenesis Studies
Residues M084 located on NS2B as well as T118, N152 and I165 located on NS3
were picked for further mutagenesis studies.
4.2.1 M084
Mutating the methionine at position 84 to an alanine in NS2B had already an
extensive impact on protease function. Activity was ten-fold reduced compared to WT
indicating the residue to be of importance for enzymatic activity (Table 3.2). Ligandbound crystal structures of NS2B-NS3 have recently revealed that NS2B actually
wraps around NS3 forming a β-hairpin in the closed conformation. Where backbone
carbonyls of M084, as well as of G82, interact with specific substrate side chains and
thereby stabilize the β-hairpin structure (Noble et al., 2011). In addition to that,
DENV-4 (Figure 3.4) as well as WNV proteases carry a phenylalanine instead of the
methionine at the same position. We therefore decided to generate another mutant
containing a phenylalanine at residue 84. The protease function could be partially
rescued by addition of an aromatic side chain instead of a methyl group and lead to a
five-fold increase in activity compared to M084A (Figure 4.1). However mutant
M084F still showed impaired cleavage efficiency compared to WT, despite both
residues having long hydrophobic side chains.
69
Chapter 4 Discussion
Figure 4.1. Chemical structure of methionine (left) and phenylalanine (right)
including their molecular weight.
Comparing the obtained kinetic parameters to WT substantial differences for vmax and
therefore kcat as well can be seen. However the KM differs only slightly from WT.
Suggesting that the mutation has an impact on the maximal rate and the catalytic
efficiency rather than on the binding affinity. This agrees with the findings of Noble
et al. where residue M084 was suggested to be stabilizing the β-hairpin of NS2B
wrapping around NS3 (Noble et al., 2011), therefore facilitating cleavage, once
substrate has bound, by keeping NS2B in close proximity to NS3. Additionally
methionine and phenylalanine are both hydrophobic, whereas alanine is smaller and
less hydrophobic. Hydrophobic interactions are important for stabilizing the protein’s
tertiary structure, which is directly associated with its function.
70
Chapter 4 Discussion
4.2.2. T118
The alanine mutation at position 118 in NS3 had a remarkable impact on cleavage
activity of the protease. No activity could be detected. The idea of introducing a serine
instead of an alanine at that position was to see if activity could be rescued, by a more
conservative change for threonine to serine. Essentiallly the serine was able to restore
activity to more than 60% compared to WT. As seen for mutant M084F, the
Michaelis-Menten constant for mutant T118S was also only slightly affected.
However the maximal rate and the kcat showed a five-fold decrease in contrast to WT.
Serine and threonine are the two only amino acids carrying an aliphatic hydroxyl
group. They can basically be seen as the hydroxylated version of alanine and valine.
Adding a hydroxyl group renders them more hydrophilic as well as more reactive
(Figure 4.2).
Figure 4.2. Chemical structure of threonine (left) and serine (right) including
their molecular weight.
Recovery of activity by introducing a serine instead of an alanine therefore suggests
that the hydroxyl group is the main factor influencing protease activity.
71
Chapter 4 Discussion
4.2.3. N152
N152 was shown to be important for protease activity in a recent study on WNV as
well as on DENV-2. Activity of the N152A mutant was completely abolished in
WNV, whereas in DENV-2 a substantial 60-fold decrease in catalytic efficiency
compared to WT could be measured (Chappell et al., 2005; Salaemae et al., 2010).
There was no detectable activity in my study, which is consistent with the earlier
findings. In order to identify the determinant responsible for abolished activity we
wanted to introduce a subtle change and see if activity could be rescued. An aspartic
acid was introduced instead of an asparagine basically replacing the amide group by a
carboxylate (Figure 4.3).
Figure 4.3. Chemical structure of asparagine (left) and aspartic acid (right)
including their molecular weight.
Similar to mutant N152A, only residual activity could be detected for N152D.
Residue N152 is part of the allosteric pocket and its side chain presumably interacts
72
Chapter 4 Discussion
with the substrate side chain via hydrogen bonding as suggested recently (Erbel et al.,
2006). Asparagine can function both as a hydrogen bond donor as well as an acceptor.
The amino group in particular serves as a donor enabling it to potentially form a
specific contact with the substrate. Aspartic acid on the other hand is only able to
serve as a hydrogen bond acceptor at physiological pH. Therefore suggesting that the
hydrogen donor function is essential for protease function, since activity could not be
restored by introducing an aspartic acid.
4.2.4. I165
Mutation of I165 to alanine resulted in a dramatic increase in KM in a recent study
suggesting an important role in substrate binding (Salaemae et al., 2010). Removing
the bulky side chain lead to a dramatic decline in activity likewise in my study. By
replacing the alanine by a leucine I wanted to find out whether activity was dependent
on the size and shape of the side chain. Isoleucine and leucine share the same
chemical formula and properties. The only difference between the two amino acids is
the orientation and shape of the carbon side chain (Figure 4.4).
73
Chapter 4 Discussion
Figure 4.4. Chemical structure of isoleucine (left) and leucine (right) including
their molecular weight.
Although a two-fold increase in activity could be detected compared to mutant I165A,
activity is still extremely low compared to WT. This again agrees with the suggestion
of Salaemae et al. for residue I165 being involved in substrate binding rather than
catalysis. The hydrophobicity of the amino acid does not determine activity. Instead
the shape of the side chain within the protein seems to be a major factor influencing
protease function.
74
Chapter 4 Discussion
4.3 Viral Replication In Vitro
In order to assess the relevance of the biochemical results from the mutagenesis
studies, viral replication was monitored in vitro. RNA from DENV-2 whole-genome
infectious clones of mutants T118A, T118S, I165A and WT were transfected into
BHK21 cells and immunofluorescence staining was done for days 1-4 post
transfection. Cells were stained for NS3 protein as well as the envelope protein. DAPI
was used to confirm the localization of NS3 and envelope protein with respect to the
nucleus within the infected cell.
NS3 staining was chosen since we were mutating the NS3 protease and wanted to
know whether NS3 was actually present in infected cells. In addition, since the
protease is mediating polyprotein processing by cleavage, occurrence of envelope
protein indicates NS3 protease activity.
Surprisingly NS3 as well as envelope staining were detectable for mutant T118A.
Although only few cells were IFA-positive and replication seemed to be delayed this
result contradicts the AMC assay outcome, where no activity was detectable. A
possible explanation for the observed discrepancy could be due to the fact that two
different serotypes of DENV were used in the biochemical assay and the IFA. DENV2 is in general more active than DENV-3 in vitro, explaining the partial activity of
DENV-2 T118A infectious clone in the IFA. Another possible reason for the observed
differences could also be due to assay sensitivity. Low activity may be sufficient for
in vitro replication. Mutant T118S on the other hand agreed with the biochemical
results. Viral replication was slower as well as fewer cells were infected compared to
75
Chapter 4 Discussion
WT. Nevertheless a substantial number of cells were IFA-positive. In general a clear
difference can be observed between the two mutants, suggesting that the main driving
factor for protease function is the hydroxyl group.
For mutant I165A, which hardly showed enzyme activity in vitro, no IFA-positive
cells could be detected. Viral replication was totally abolished suggesting that even
though the protease was partially active, the virus was not able to propagate within the
cell. This again strengthens the important role for NS3 protease in viral replication,
and suggests isoleucine to be essential at this position.
76
Chapter 4 Discussion
4.4 Impact of Findings on Drug Discovery
I was able to show that apart from the active site an even larger pocket formed within
the NS2B-NS3 protease has an impact on enzymatic activity. This could be due to an
allosteric mechanism affecting the active site and hence affecting protease function.
Key residues and features of amino acids have been identified that had marked effect
on protease function. Therefore this pocket could serve as a potential target for an
antiviral drug against dengue. In order to screen for compounds that specifically bind
to this pocket and not the active site, fragment-based screening (FBS) would be a
novel useful tool, as opposed to other conventional screening methods like high
throughput screening (HTS). FBS compounds have usually a much lower molecular
weight and often only bind weakly to the target. Detection of hits is therefore
challenging and relies on use of specific techniques like nuclear magnetic resonance
(NMR) or X-ray crystallography. FBS in general leads to higher hit rates and
compared to HTS also fewer compounds have to be screened. But since the affinity
towards the target is usually lower it can be difficult to optimize leads in order to get a
lead that meets all the necessary requirements. One possible way to increase affinity is
for example to combine multiple low affinity hits that bind to different sites of the
target molecule and link these fragments together. In relation to the NS2BNS3protease, structural approaches can now be used to identify molecules that
specifically bind to the identified key residues in the allosteric pocket and that later
could be potential compounds for an antiviral drug.
77
Chapter 4 Discussion
4.5 Conclusion and Outlook
The DENV NS2B-NS3 protease has progressively gained interest in the last years,
especially as a potential target for antiviral therapeutics. A number of studies have
been conducted to characterize the two-component protease from a biochemical point
of view as well as from the structural point of view. Studies in the past have mainly
focussed on the active site of the DENV protease. However, recent studies have
revealed another pocket larger than the active site, which is conserved among the
DENV serotypes and likely to be of importance for the protease function.
This study was for the first time able to identify key residues in the DENV NS2BNS3 protease allosteric pocket, that are important for protease function. In addition,
conservative mutagenesis studies revealed key features of a selected subset of
identified residues, crucial for protease activity. Recombinant DENV-3 protease was
used to biochemically assess the functional importance of the allosteric site. In vitro
replication studies, with a DENV-2 infectious clone, were later used to in confirm the
biochemical results obtained with DENV-3.
Taken together these findings are especially valuable for drug discovery. The
identified key residues are highly conserved within DENV 1-4 and our results for
both DENV-3 and DENV-2 were overlapping. A protease inhibitor targeting the
allosteric site could therefore potentially be used for more than one serotype.
Fragment-based screening, as a novel approach, could be useful in order to design
inhibitors targeting not only one specific binding site, but combining several binding
sites in close proximity. It would be interesting to further extend our experiments to
78
Chapter 4 Discussion
other DENV serotypes and include additional conserved mutagenesis studies for
additional key residues. This could give us a complete picture of the functional
importance of the allosteric pocket within the four serotypes. In addition one could
also think of applying the concept on other closely related viruses like YFV or WNV.
79
Bibliography
BIBLIOGRAPHY
80
Bibliography
Ackermann, M. and Padmanabhan, R., 2001. De novo synthesis of RNA by the
dengue virus RNA-dependent RNA polymerase exhibits temperature dependence at
the initiation but not elongation phase. J.Biol.Chem. 276, 39926-39937.
Aleshin, A.E., Shiryaev, S.A., Strongin, A.Y., and Liddington, R.C., 2007. Structural
evidence for regulation and specificity of flaviviral proteases and evolution of the
Flaviviridae fold. Protein Sci. 16, 795-806.
Arias, C.F., Preugschat, F., and Strauss, J.H., 1993. Dengue 2 virus NS2B and NS3
form a stable complex that can cleave NS3 within the helicase domain. Virology 193,
888-899.
Bartholomeusz, A.I. and Wright, P.J., 1993. Synthesis of dengue virus RNA in vitro:
initiation and the involvement of proteins NS3 and NS5. Arch.Virol. 128, 111-121.
Bazan, J.F. and Fletterick, R.J., 1989. Comparative analysis of viral cysteine protease
structural models. FEBS Lett. 249, 5-7.
Benarroch, D., Egloff, M.P., Mulard, L., Guerreiro, C., Romette, J.L., and Canard, B.,
2004. A structural basis for the inhibition of the NS5 dengue virus mRNA 2'-Omethyltransferase domain by ribavirin 5'-triphosphate. J.Biol.Chem. 279, 3563835643.
Bente, D.A. and Rico-Hesse, R., 2006. Models of dengue virus infection. Drug
Discov.Today Dis.Models. 3, 97-103.
Boege, U., Heinz, F.X., Wengler, G., and Kunz, C., 1983. Amino acid compositions
and amino-terminal sequences of the structural proteins of a flavivirus, European
Tick-Borne Encephalitis virus. Virology 126, 651-657.
Borowski, P., Niebuhr, A., Mueller, O., Bretner, M., Felczak, K., Kulikowski, T., and
Schmitz, H., 2001. Purification and characterization of West Nile virus nucleoside
triphosphatase (NTPase)/helicase: evidence for dissociation of the NTPase and
helicase activities of the enzyme. J.Virol. 75, 3220-3229.
Brooks, A.J., Johansson, M., John, A.V., Xu, Y., Jans, D.A., and Vasudevan, S.G.,
2002. The interdomain region of dengue NS5 protein that binds to the viral helicase
NS3 contains independently functional importin beta 1 and importin alpha/betarecognized nuclear localization signals. J.Biol.Chem. 277, 36399-36407.
Cahour, A., Falgout, B., and Lai, C.J., 1992. Cleavage of the dengue virus polyprotein
at the NS3/NS4A and NS4B/NS5 junctions is mediated by viral protease NS2B-NS3,
whereas NS4A/NS4B may be processed by a cellular protease. J.Virol. 66, 15351542.
Chambers, T.J., Hahn, C.S., Galler, R., and Rice, C.M., 1990. Flavivirus genome
organization, expression, and replication. Annu.Rev.Microbiol. 44, 649-688.
81
Bibliography
Chambers, T.J., Grakoui, A., and Rice, C.M., 1991. Processing of the yellow fever
virus nonstructural polyprotein: a catalytically active NS3 proteinase domain and
NS2B are required for cleavages at dibasic sites. J.Virol. 65, 6042-6050.
Chambers, T.J., Nestorowicz, A., Amberg, S.M., and Rice, C.M., 1993. Mutagenesis
of the yellow fever virus NS2B protein: effects on proteolytic processing, NS2B-NS3
complex formation, and viral replication. J.Virol. 67, 6797-6807.
Chappell, K.J., Nall, T.A., Stoermer, M.J., Fang, N.X., Tyndall, J.D., Fairlie, D.P.,
and Young, P.R., 2005. Site-directed mutagenesis and kinetic studies of the West Nile
Virus NS3 protease identify key enzyme-substrate interactions. J.Biol.Chem. 280,
2896-2903.
Chappell, K.J.; Stoermer, M.J.; Fairlie, D.P.; Young, P.R., 2008. Mutagenesis of the
West Nile virus NS2B cofactor domain reveals two regions essential for protease
activity. J.Gen.Virol. 89, 1010-1014.
Chareonsirisuthigul, T., Kalayanarooj, S., and Ubol, S., 2007. Dengue virus (DENV)
antibody-dependent enhancement of infection upregulates the production of antiinflammatory cytokines, but suppresses anti-DENV free radical and pro-inflammatory
cytokine production, in THP-1 cells. J.Gen.Virol. 88, 365-375.
Chen, K.X. and Njoroge, F.G., 2009. A review of HCV protease inhibitors.
Curr.Opin.Investig.Drugs 10, 821-837.
Chen, Y.C., Wang, S.Y., and King, C.C., 1999. Bacterial lipopolysaccharide inhibits
dengue virus infection of primary human monocytes/macrophages by blockade of
virus entry via a CD14-dependent mechanism. J.Virol. 73, 2650-2657.
Chu, P.W., Westaway, E.G., and Coia, G., 1992. Comparison of centrifugation
methods for molecular and morphological analysis of membranes associated with
RNA replication of the flavivirus Kunjin. J.Virol.Methods 37, 219-234.
Clyde, K., Kyle, J.L., and Harris, E., 2006. Recent advances in deciphering viral and
host determinants of dengue virus replication and pathogenesis. J.Virol. 80, 1141811431.
Coller, B.A. and Clements, D.E., 2011. Dengue vaccines: progress and challenges.
Curr.Opin.Immunol. 23, 391-398.
Dejnirattisai, W., Jumnainsong, A., Onsirisakul, N., Fitton, P., Vasanawathana, S.,
Limpitikul, W., Puttikhunt, C., Edwards, C., Duangchinda, T., Supasa, S.,
Chawansuntati, K., Malasit, P., Mongkolsapaya, J., and Screaton, G., 2010. Crossreacting antibodies enhance dengue virus infection in humans. Science 328, 745-748.
Dong, H., Ren, S., Zhang, B., Zhou, Y., Puig-Basagoiti, F., Li, H., and Shi, P.Y.,
2008. West Nile virus methyltransferase catalyzes two methylations of the viral RNA
cap through a substrate-repositioning mechanism. J.Virol. 82, 4295-4307.
82
Bibliography
Elshuber, S., Allison, S.L., Heinz, F.X., and Mandl, C.W., 2003. Cleavage of protein
prM is necessary for infection of BHK-21 cells by tick-borne encephalitis virus.
J.Gen.Virol. 84, 183-191.
Erbel, P., Schiering, N., D'Arcy, A., Renatus, M., Kroemer, M., Lim, S.P., Yin, Z.,
Keller, T.H., Vasudevan, S.G., and Hommel, U., 2006. Structural basis for the
activation of flaviviral NS3 proteases from dengue and West Nile virus.
Nat.Struct.Mol.Biol. 13, 372-373.
Falgout, B., Pethel, M., Zhang, Y.M., and Lai, C.J., 1991. Both nonstructural proteins
NS2B and NS3 are required for the proteolytic processing of dengue virus
nonstructural proteins. J.Virol. 65, 2467-2475.
Falgout, B., Miller, R.H., and Lai, C.J., 1993. Deletion analysis of dengue virus type 4
nonstructural protein NS2B: identification of a domain required for NS2B-NS3
protease activity. J.Virol. 67, 2034-2042.
Fonseca, B.A., Pincus, S., Shope, R.E., Paoletti, E., and Mason, P.W., 1994.
Recombinant vaccinia viruses co-expressing dengue-1 glycoproteins prM and E
induce neutralizing antibodies in mice. Vaccine 12, 279-285.
Forwood, J.K., Brooks, A., Briggs, L.J., Xiao, C.Y., Jans, D.A., and Vasudevan, S.G.,
1999. The 37-amino-acid interdomain of dengue virus NS5 protein contains a
functional NLS and inhibitory CK2 site. Biochem.Biophys.Res.Commun. 257, 731737.
Gubler, D.J., 1998. Dengue and dengue hemorrhagic fever. Clin.Microbiol.Rev. 11,
480-496.
Gubler, D.J., 2002. The global emergence/resurgence of arboviral diseases as public
health problems. Arch.Med.Res. 33, 330-342.
Gubler, D.J., 2007. The continuing spread of West Nile virus in the western
hemisphere. Clin.Infect.Dis. 45, 1039-1046.
Guirakhoo, F., Heinz, F.X., Mandl, C.W., Holzmann, H., and Kunz, C., 1991. Fusion
activity of flaviviruses: comparison of mature and immature (prM-containing) tickborne encephalitis virions. J.Gen.Virol. 72 ( Pt 6), 1323-1329.
Guirakhoo, F., Bolin, R.A., and Roehrig, J.T., 1992. The Murray Valley encephalitis
virus prM protein confers acid resistance to virus particles and alters the expression of
epitopes within the R2 domain of E glycoprotein. Virology 191, 921-931.
Guirakhoo, F., Hunt, A.R., Lewis, J.G., and Roehrig, J.T., 1993. Selection and partial
characterization of dengue 2 virus mutants that induce fusion at elevated pH. Virology
194, 219-223.
83
Bibliography
Guirakhoo, F., Kitchener, S., Morrison, D., Forrat, R., McCarthy, K., Nichols, R.,
Yoksan, S., Duan, X., Ermak, T.H., Kanesa-Thasan, N., Bedford, P., Lang, J.,
Quentin-Millet, M.J., and Monath, T.P., 2006. Live attenuated chimeric yellow fever
dengue type 2 (ChimeriVax-DEN2) vaccine: Phase I clinical trial for safety and
immunogenicity: effect of yellow fever pre-immunity in induction of cross
neutralizing antibody responses to all 4 dengue serotypes. Hum.Vaccin. 2, 60-67.
Guzman, M.G., Halstead, S.B., Artsob, H., Buchy, P., Farrar, J., Gubler, D.J.,
Hunsperger, E., Kroeger, A., Margolis, H.S., Martinez, E., Nathan, M.B., Pelegrino,
J.L., Simmons, C., Yoksan, S., and Peeling, R.W., 2010. Dengue: a continuing global
threat. Nat.Rev.Microbiol. 8, S7-16.
Halstead, S.B., 1988. Pathogenesis of dengue: challenges to molecular biology.
Science 239, 476-481.
Hedstrom, L., 2002. Serine protease mechanism and specificity. Chem.Rev. 102,
4501-4524.
Heinz, F.X., Tuma, W., Guirakhoo, F., and Kunz, C., 1986. A model study of the use
of monoclonal antibodies in capture enzyme immunoassays for antigen quantification
exploiting the epitope map of tick-borne encephalitis virus. J.Biol.Stand. 14, 133-141.
Heinz, F.X., Allison, S.L., Stiasny, K., Schalich, J., Holzmann, H., Mandl, C.W., and
Kunz, C., 1995. Recombinant and virion-derived soluble and particulate immunogens
for vaccination against tick-borne encephalitis. Vaccine 13, 1636-1642.
Heinz, F.X. and Stiasny, K., 2012. Flaviviruses and flavivirus vaccines. Vaccine 30,
4301-4306.
Jindadamrongwech, S., Thepparit, C., and Smith, D.R., 2004. Identification of GRP
78 (BiP) as a liver cell expressed receptor element for dengue virus serotype 2.
Arch.Virol. 149, 915-927.
Johansson, M., Brooks, A.J., Jans, D.A., and Vasudevan, S.G., 2001. A small region
of the dengue virus-encoded RNA-dependent RNA polymerase, NS5, confers
interaction with both the nuclear transport receptor importin-beta and the viral
helicase, NS3. J.Gen.Virol. 82, 735-745.
Jones, M., Davidson, A., Hibbert, L., Gruenwald, P., Schlaak, J., Ball, S., Foster,
G.R., and Jacobs, M., 2005. Dengue virus inhibits alpha interferon signaling by
reducing STAT2 expression. J.Virol. 79, 5414-5420.
Julander, J.G., Perry, S.T., and Shresta, S., 2011. Important advances in the field of
anti-dengue virus research. Antivir.Chem.Chemother. 21, 105-116.
Kapoor, M., Zhang, L., Ramachandra, M., Kusukawa, J., Ebner, K.E., and
Padmanabhan, R., 1995. Association between NS3 and NS5 proteins of dengue virus
type 2 in the putative RNA replicase is linked to differential phosphorylation of NS5.
J.Biol.Chem. 270, 19100-19106.
84
Bibliography
Khromykh, A.A. and Westaway, E.G., 1997. Subgenomic replicons of the flavivirus
Kunjin: construction and applications. J.Virol. 71, 1497-1505.
Kiermayr, S., Kofler, R.M., Mandl, C.W., Messner, P., and Heinz, F.X., 2004.
Isolation of capsid protein dimers from the tick-borne encephalitis flavivirus and in
vitro assembly of capsid-like particles. J.Virol. 78, 8078-8084.
Kliks, S.C., Nisalak, A., Brandt, W.E., Wahl, L., and Burke, D.S., 1989. Antibodydependent enhancement of dengue virus growth in human monocytes as a risk factor
for dengue hemorrhagic fever. Am.J.Trop.Med.Hyg. 40, 444-451.
Konishi, E. and Mason, P.W., 1993. Proper maturation of the Japanese encephalitis
virus envelope glycoprotein requires cosynthesis with the premembrane protein.
J.Virol. 67, 1672-1675.
Koonin, E.V. and Dolja, V.V., 1993. Evolution and taxonomy of positive-strand RNA
viruses: implications of comparative analysis of amino acid sequences. Crit
Rev.Biochem.Mol.Biol. 28, 375-430.
Kuhn, R.J., Zhang, W., Rossmann, M.G., Pletnev, S.V., Corver, J., Lenches, E.,
Jones, C.T., Mukhopadhyay, S., Chipman, P.R., Strauss, E.G., Baker, T.S., and
Strauss, J.H., 2002. Structure of dengue virus: implications for flavivirus
organization, maturation, and fusion. Cell 108, 717-725.
Kummerer, B.M. and Rice, C.M., 2002. Mutations in the yellow fever virus
nonstructural protein NS2A selectively block production of infectious particles.
J.Virol. 76, 4773-4784.
Kuno, G., Cropp, C.B., Wong-Lee, J., and Gubler, D.J., 1998. Evaluation of an IgM
immunoblot kit for dengue diagnosis. Am.J.Trop.Med.Hyg. 59, 757-762.
Lei, H.Y., Yeh, T.M., Liu, H.S., Lin, Y.S., Chen, S.H., and Liu, C.C., 2001.
Immunopathogenesis of dengue virus infection. J.Biomed.Sci. 8, 377-388.
Lescar, J., Luo, D., Xu, T., Sampath, A., Lim, S.P., Canard, B., and Vasudevan, S.G.,
2008. Towards the design of antiviral inhibitors against flaviviruses: the case for the
multifunctional NS3 protein from Dengue virus as a target. Antiviral Res. 80, 94-101.
Leung, D., Schroder, K., White, H., Fang, N.X., Stoermer, M.J., Abbenante, G.,
Martin, J.L., Young, P.R., and Fairlie, D.P., 2001. Activity of recombinant dengue 2
virus NS3 protease in the presence of a truncated NS2B co-factor, small peptide
substrates, and inhibitors. J.Biol.Chem. 276, 45762-45771.
Li, H., Clum, S., You, S., Ebner, K.E., and Padmanabhan, R., 1999. The serine
protease and RNA-stimulated nucleoside triphosphatase and RNA helicase functional
domains of dengue virus type 2 NS3 converge within a region of 20 amino acids.
J.Virol. 73, 3108-3116.
85
Bibliography
Li, J., Lim, S.P., Beer, D., Patel, V., Wen, D., Tumanut, C., Tully, D.C., Williams,
J.A., Jiricek, J., Priestle, J.P., Harris, J.L., and Vasudevan, S.G., 2005. Functional
profiling of recombinant NS3 proteases from all four serotypes of dengue virus using
tetrapeptide and octapeptide substrate libraries. J.Biol.Chem. 280, 28766-28774.
Lin, C., Amberg, S.M., Chambers, T.J., and Rice, C.M., 1993. Cleavage at a novel
site in the NS4A region by the yellow fever virus NS2B-3 proteinase is a prerequisite
for processing at the downstream 4A/4B signalase site. J.Virol. 67, 2327-2335.
Lindenbach, B.D. and Rice, C.M., 2003. Molecular biology of flaviviruses. Adv.Virus
Res. 59, 23-61.
Lindenbach, B.D., Thiel, H.J., Rice, C.M., 2007. Flaviviridae: the virus and their
replication. Philadelphia: Lippincott-Raven Publishers.
Liu, W.J., Chen, H.B., and Khromykh, A.A., 2003. Molecular and functional analyses
of Kunjin virus infectious cDNA clones demonstrate the essential roles for NS2A in
virus assembly and for a nonconservative residue in NS3 in RNA replication. J.Virol.
77, 7804-7813.
Lopez, C., Gil, L., Lazo, L., Menendez, I., Marcos, E., Sanchez, J., Valdes, I., Falcon,
V., de la Rosa, M.C., Marquez, G., Guillen, G., and Hermida, L., 2009. In vitro
assembly of nucleocapsid-like particles from purified recombinant capsid protein of
dengue-2 virus. Arch.Virol. 154, 695-698.
Ma, L., Jones, C.T., Groesch, T.D., Kuhn, R.J., and Post, C.B., 2004. Solution
structure
of
dengue
virus
capsid
protein
reveals
another
fold.
Proc.Natl.Acad.Sci.U.S.A 101, 3414-3419.
Mackenzie, J.M., Jones, M.K., and Young, P.R., 1996. Immunolocalization of the
dengue virus nonstructural glycoprotein NS1 suggests a role in viral RNA replication.
Virology 220, 232-240.
Mackenzie, J.M., Khromykh, A.A., Jones, M.K., and Westaway, E.G., 1998.
Subcellular localization and some biochemical properties of the flavivirus Kunjin
nonstructural proteins NS2A and NS4A. Virology 245, 203-215.
Mackenzie, J.S., Gubler, D.J., and Petersen, L.R., 2004. Emerging flaviviruses: the
spread and resurgence of Japanese encephalitis, West Nile and dengue viruses.
Nat.Med. 10, S98-109.
Mandl, C.W., Guirakhoo, F., Holzmann, H., Heinz, F.X., and Kunz, C., 1989.
Antigenic structure of the flavivirus envelope protein E at the molecular level, using
tick-borne encephalitis virus as a model. J.Virol. 63, 564-571.
Markoff, L., Falgout, B., and Chang, A., 1997. A conserved internal hydrophobic
domain mediates the stable membrane integration of the dengue virus capsid protein.
Virology 233, 105-117.
86
Bibliography
Martina, B.E., Koraka, P., and Osterhaus, A.D., 2009. Dengue virus pathogenesis: an
integrated view. Clin.Microbiol.Rev. 22, 564-581.
Mason, P.W., 1989. Maturation of Japanese encephalitis virus glycoproteins produced
by infected mammalian and mosquito cells. Virology 169, 354-364.
Mason, P.W., Pincus, S., Fournier, M.J., Mason, T.L., Shope, R.E., and Paoletti, E.,
1991. Japanese encephalitis virus-vaccinia recombinants produce particulate forms of
the structural membrane proteins and induce high levels of protection against lethal
JEV infection. Virology 180, 294-305.
Miller, S., Sparacio, S., and Bartenschlager, R., 2006. Subcellular localization and
membrane topology of the Dengue virus type 2 Non-structural protein 4B.
J.Biol.Chem. 281, 8854-8863.
Morse, S.S., 1995. Factors in the emergence of infectious diseases. Emerg.Infect.Dis.
1, 7-15.
Mukhopadhyay, S., Kuhn, R.J., and Rossmann, M.G., 2005. A structural perspective
of the flavivirus life cycle. Nat.Rev.Microbiol. 3, 13-22.
Munoz-Jordan, J.L., Sanchez-Burgos, G.G., Laurent-Rolle, M., and Garcia-Sastre, A.,
2003. Inhibition of interferon signaling by dengue virus. Proc.Natl.Acad.Sci.U.S.A
100, 14333-14338.
Navarro-Sanchez, E., Altmeyer, R., Amara, A., Schwartz, O., Fieschi, F., Virelizier,
J.L., Arenzana-Seisdedos, F., and Despres, P., 2003. Dendritic-cell-specific ICAM3grabbing non-integrin is essential for the productive infection of human dendritic cells
by mosquito-cell-derived dengue viruses. EMBO Rep. 4, 723-728.
Noble, C.G., Seh, C.C., Chao, A.T., and Shi, P.Y., 2011. Ligand-bound structures of
the dengue virus protease reveal the active conformation. J.Virol. 86, 438-446.
Patkar, C.G. and Kuhn, R.J., 2006. Development of novel antivirals against
flaviviruses. Novartis.Found.Symp. 277, 41-52.
Perera, R. and Kuhn, R.J., 2008. Structural proteomics of dengue virus.
Curr.Opin.Microbiol. 11, 369-377.
Pincus, S., Mason, P.W., Konishi, E., Fonseca, B.A., Shope, R.E., Rice, C.M., and
Paoletti, E., 1992. Recombinant vaccinia virus producing the prM and E proteins of
yellow fever virus protects mice from lethal yellow fever encephalitis. Virology 187,
290-297.
Preugschat, F., Lenches, E.M., and Strauss, J.H., 1991. Flavivirus enzyme-substrate
interactions studied with chimeric proteinases: identification of an intragenic locus
important for substrate recognition. J.Virol. 65, 4749-4758.
87
Bibliography
Rajamanonmani, R., Nkenfou, C., Clancy, P., Yau, Y.H., Shochat, S.G., SukupolviPetty, S., Schul, W., Diamond, M.S., Vasudevan, S.G., and Lescar, J., 2009. On a
mouse monoclonal antibody that neutralizes all four dengue virus serotypes.
J.Gen.Virol. 90, 799-809.
Raviprakash, K., Sinha, M., Hayes, C.G., and Porter, K.R., 1998. Conversion of
dengue virus replicative form RNA (RF) to replicative intermediate (RI) by
nonstructural proteins NS-5 and NS-3. Am.J.Trop.Med.Hyg. 58, 90-95.
Rawlinson, S.M., Pryor, M.J., Wright, P.J., and Jans, D.A., 2006. Dengue virus RNA
polymerase NS5: a potential therapeutic target? Curr.Drug Targets. 7, 1623-1638.
Rice, C.M., Lenches, E.M., Eddy, S.R., Shin, S.J., Sheets, R.L., and Strauss, J.H.,
1985. Nucleotide sequence of yellow fever virus: implications for flavivirus gene
expression and evolution. Science 229, 726-733.
Rice, C.M., Aebersold, R., Teplow, D.B., Pata, J., Bell, J.R., Vorndam, A.V., Trent,
D.W., Brandriss, M.W., Schlesinger, J.J., and Strauss, J.H., 1986. Partial N-terminal
amino acid sequences of three nonstructural proteins of two flaviviruses. Virology
151, 1-9.
Rico-Hesse, R., Harrison, L.M., Salas, R.A., Tovar, D., Nisalak, A., Ramos, C.,
Boshell, J., de Mesa, M.T., Nogueira, R.M., and da Rosa, A.T., 1997. Origins of
dengue type 2 viruses associated with increased pathogenicity in the Americas.
Virology 230, 244-251.
Rico-Hesse, R., Harrison, L.M., Nisalak, A., Vaughn, D.W., Kalayanarooj, S., Green,
S., Rothman, A.L., and Ennis, F.A., 1998. Molecular evolution of dengue type 2 virus
in Thailand. Am.J.Trop.Med.Hyg. 58, 96-101.
Rigau-Perez, J.G., Clark, G.G., Gubler, D.J., Reiter, P., Sanders, E.J., and Vorndam,
A.V., 1998. Dengue and dengue haemorrhagic fever. Lancet 352, 971-977.
Rothman, A.L., 2003. Immunology and immunopathogenesis of dengue disease.
Adv.Virus Res. 60, 397-419.
Salaemae, W., Junaid, M., Angsuthanasombat, C., and Katzenmeier, G., 2010.
Structure-guided mutagenesis of active site residues in the dengue virus twocomponent protease NS2B-NS3. J.Biomed.Sci. 17, 68.
Schlesinger, J.J., Brandriss, M.W., Putnak, J.R., and Walsh, E.E., 1990. Cell surface
expression of yellow fever virus non-structural glycoprotein NS1: consequences of
interaction with antibody. J.Gen.Virol. 71 ( Pt 3), 593-599.
Soriano, V., Vispo, E., Poveda, E., Labarga, P., Martin-Carbonero, L., FernandezMontero, J.V., and Barreiro, P., 2011. Directly acting antivirals against hepatitis C
virus. J.Antimicrob.Chemother. 66, 1673-1686.
88
Bibliography
Speight, G., Coia, G., Parker, M.D., and Westaway, E.G., 1988. Gene mapping and
positive identification of the non-structural proteins NS2A, NS2B, NS3, NS4B and
NS5 of the flavivirus Kunjin and their cleavage sites. J.Gen.Virol. 69 ( Pt 1), 23-34.
Stiasny, K. and Heinz, F.X., 2006. Flavivirus membrane fusion. J.Gen.Virol. 87,
2755-2766.
Tan, B.H., Fu, J., Sugrue, R.J., Yap, E.H., Chan, Y.C., and Tan, Y.H., 1996.
Recombinant dengue type 1 virus NS5 protein expressed in Escherichia coli exhibits
RNA-dependent RNA polymerase activity. Virology 216, 317-325.
Trent, D.W., 1977. Antigenic characterization of flavivirus structural proteins
separated by isoelectric focusing. J.Virol. 22, 608-618.
Umareddy, I., Chao, A., Sampath, A., Gu, F., and Vasudevan, S.G., 2006. Dengue
virus NS4B interacts with NS3 and dissociates it from single-stranded RNA.
J.Gen.Virol. 87, 2605-2614.
Valle, R.P. and Falgout, B., 1998. Mutagenesis of the NS3 protease of dengue virus
type 2. J.Virol. 72, 624-632.
Wengler, G., Czaya, G., Farber, P.M., and Hegemann, J.H., 1991. In vitro synthesis of
West Nile virus proteins indicates that the amino-terminal segment of the NS3 protein
contains the active centre of the protease which cleaves the viral polyprotein after
multiple basic amino acids. J.Gen.Virol. 72 ( Pt 4), 851-858.
Westaway, E.G., Mackenzie, J.M., Kenney, M.T., Jones, M.K., and Khromykh, A.A.,
1997. Ultrastructure of Kunjin virus-infected cells: colocalization of NS1 and NS3
with double-stranded RNA, and of NS2B with NS3, in virus-induced membrane
structures. J.Virol. 71, 6650-6661.
Westaway, E.G., Mackenzie, J.M., and Khromykh, A.A., 2003. Kunjin RNA
replication and applications of Kunjin replicons. Adv.Virus Res. 59, 99-140.
Whitehorn, J. and Farrar, J., 2010. Dengue. Br.Med.Bull. 95, 161-173.
WHO. Dengue haemorrhagic fever: diagnosis, treatment, prevention and control, 2nd
ed. Geneva, World Health Organization, 1997.
WHO. Dengue: Guidelines for diagnosis, treatment, prevention and control, new ed.
Geneva, World Health Organization, 2009.
Winkler, G., Randolph, V.B., Cleaves, G.R., Ryan, T.E., and Stollar, V., 1988.
Evidence that the mature form of the flavivirus nonstructural protein NS1 is a dimer.
Virology 162, 187-196.
Yang, K.D., Yeh, W.T., Yang, M.Y., Chen, R.F., and Shaio, M.F., 2001. Antibodydependent enhancement of heterotypic dengue infections involved in suppression of
IFNgamma production. J.Med.Virol. 63, 150-157.
89
Bibliography
Yin, Z., Patel, S.J., Wang, W.L., Chan, W.L., Ranga Rao, K.R., Wang, G., Ngew, X.,
Patel, V., Beer, D., Knox, J.E., Ma, N.L., Ehrhardt, C., Lim, S.P., Vasudevan, S.G.,
and Keller, T.H., 2006a. Peptide inhibitors of dengue virus NS3 protease. Part 2: SAR
study of tetrapeptide aldehyde inhibitors. Bioorg.Med.Chem.Lett. 16, 40-43.
Yin, Z., Patel, S.J., Wang, W.L., Wang, G., Chan, W.L., Rao, K.R., Alam, J., Jeyaraj,
D.A., Ngew, X., Patel, V., Beer, D., Lim, S.P., Vasudevan, S.G., and Keller, T.H.,
2006b. Peptide inhibitors of Dengue virus NS3 protease. Part 1: Warhead.
Bioorg.Med.Chem.Lett. 16, 36-39.
Yusof, R., Clum, S., Wetzel, M., Murthy, H.M., and Padmanabhan, R., 2000. Purified
NS2B/NS3 serine protease of dengue virus type 2 exhibits cofactor NS2B dependence
for cleavage of substrates with dibasic amino acids in vitro. J.Biol.Chem. 275, 99639969.
90
Appendix
APPENDIX
91
Appendix
6. Appendix
6.1 Additional protocols
Bacterial transformation
1.
2.
3.
4.
5.
6.
add 1-10 µl of the plasmid DNA to one tube of competent cells
incubate on ice for 30 min
heat shock the cells for 30-60 sec in the waterbath at 42°C (not shaking)
transfer the tube on ice and incubate for another 2 min
add 300 µl of nutrient broth (LB), 100 µl for SDM
cap the tube tightly and shake it for 30-60 min at 37°C shaking at 220 rpm, place on
ice
7. spread the transformation onto a LB plate containing 100 µg/ml ampicillin, incubate
for 10 min at RT and then invert the plate and place it into the 37°C incubator O/N
Cleaning up of PCR product
1.
2.
3.
4.
5.
6.
add 1/10 of the whole volume of 4M NaCl to PCR product
add 2.5 times of the total volume of 100% ice cold ethanol to the mixture
incubate on ice for 15 min
centrifuge at 4°C at maximum speed for 15 min
remove liquid and air dry the tube
resuspsend in 3-10 µl water
Growing cells and expression of proteins
1. pick an individual colony from the LB plate grown O/N and start a 20 ml LB culture
containing 100 mg/ml amp O/N at 37°C shaking at 220 rpm
2. inoculate 5 ml of the O/N culture into 500 ml LBAmp in a 2 l flask (aeration!)
3. shake the flasks at 37°C and 160 rpm for 2-3 hours and regularly check the OD
4. as soon as the OD has reached 0.6-0.8 cool down the cultures to 4°C for 10 min
5. add IPTG to 0.5 mM and incubate shaking at 30°C and 160 rpm for 4 hours
(alternatively incubate at 16°C O/N)
6. centrifuge the culture for 10 min at 6000 rpm and discard the supernatant
7. resuspend the pellet in 10-20 ml GST binding buffer
Protein purification
1.
2.
3.
4.
5.
sonicate the sample at 50% intensity, pulse 2 sec on and 5 sec off for 10 min
centrifuge cell lysate after sonication at 20'000 rpm for 45-60 min at 4°C
filter lysate with a 0.20 µm filter
inject lysate into FPLC machine using a GST column
set up the programme: GST trap, GST removal, Gel filtration
92
Appendix
QIAquick gel extraction kit protocol
1. weigh the gel slice in a colorless tube and add 3 volumes of buffer QG to the tube
(100 mg = 100 µl)
2. incubate the tube containing the gel slice and buffer QG in a waterbath at 50°C until
the slice has completely dissolved (make sure that the color of the mixture is still
yellow)
3. add 1 gel volume of isopropanol to the sample mix and place it into a QIAquick spin
column
4. spin the column for 1 min and then discard the flow through
5. add another 500 µl buffer QG to the spin column and centrifuge for 1 min
6. to wash add another 750 µl of buffer PE + ethanol to the column, let it stand for 5 min
and centrifuge for 1 min
7. repeat step 6
8. discard the flow through and centrifuge for another 1 min
9. place the column into a new microcentrifuge
10. add 35 µl of water to center of the column to elute DNA, let it stand for 1 min and
centrifuge for 1 min at maximum speed
Ligation mix
T4 DNA Ligase
T4 DNA ligase buffer (10x)
µl
Plasmid1
µl
Insert1
µl
Add water to a final volume of
1 µl
1.5
3-6
3-6
15 µl
1
The ratio between plasmid and insert has to be 1:3-5. My plasmid is about 3 times bigger than the inserts hence I
can use the same concentrations for insert and plasmid.
Digestion mix
10x buffer NEB2
5 µl
10x BSA
5 µl
DNA
2 µg
Nhe-I
1 µl
Xho-I
1 µl
Add water to a final volume of
50 µl
93
Appendix
In vitro transcription
cDNA (linear)
2 x dNTPs/ Cap
10x buffer
Enzyme mix
Add water to a final volume of
2 µg
10 µl
2 µl
2 µl
20 µl
Linearization
10x buffer NEB
10x BSA
ClaI
DNA
Add water to a final volume of
10 µl
10 µl
10 µl
10 µg
100 µl
PCR mix
Nuclease-free water
Quik Solution (DMSO)
10x Buffer with MgSO4
dNTP mix, 10 mM each
primer mix (10mM each)
DNA template (20 ng/µl)
Polymerase (2.5/ µl)
37.5 µl
3 µl
5 µl
1 µl
1.5 µl
1 µl
1 µl
94
[...]... Africa into the Americas during the slave trade in the 17th and 18th centuries DENV on the other hand has spread globally in the 18th and 19th centuries with expanding shipping industry and trading Additionally DENV transmission dynamics and epidemiology were shaped dramatically during and following World War II in South East Asia resulting in geographical spread of the disease and the vector The factors... virion surface incorporates two viral proteins, E (envelope) and M (membrane) The E glycoprotein mediates binding and fusion during virus entry, whereas the M glycoprotein is the remaining proteolytic fragment of precursor prM protein and produced during maturation (Figure 1.5 (a)) The RNA genome has an open reading frame that encodes a single polyprotein comprised of three structural and seven non-structural... (WHO) over 40% of the world’s population, or 2.5 billion people, live in areas of transmission and hence are at risk of getting dengue Only nine countries were known to have severe dengue epidemics before 1970 and dengue is now endemic in more than 100 countries across the globe The disease is present in many parts of the tropics and subtropics in Africa, the Americas, South-East Asia, the Western Pacific... the Eastern Mediterranean An estimated 50-100 million dengue infections occur worldwide annually with 500’000 severe cases every year being hospitalized and 2.5% deaths of those affected (Mackenzie et al., 2004) Figure 1.2 Distribution of dengue infection according to the World Health Organization in 2010 Highlighted in orange are the areas and countries where dengue has been reported The January and... structure of threonine (left) and serine (right) including their molecular weight 71 Figure 4.3 Chemical structure of asparagine (left) and aspartic acid (right) including their molecular weight 72 Figure 4.4 Chemical structure of isoleucine (left) and leucine (right) including their molecular weight 74 x List of Symbols LIST OF SYMBOLS Aa Amino Acid ADE Antibody Dependent Enhancement... cytoplasm the positive-sense viral RNA is translated into a single polyprotein that is further cleaved co- and post-translationally by host and viral proteases into 10 proteins (Lindenbach and Rice, 2003) Virus assembly occurs on the surface of the endoplasmic reticulum (ER) (Figure 1.5 (6c)) Immature, non-infectious viral particles, that cannot induce host-cell fusion, are formed in the lumen of the ER and... 1990; Markoff et al., 1997) 14 Chapter 1 Introduction 1.6.2 Pre-membrane The Pre-membrane (prM) protein is a precursor protein (~ 34 kDa) of the membrane (M) protein (~ 26 kDa) and is cleaved by the host protease furin in the TGN Cleavage mediates maturation and is important for release of viral particles (Elshuber et al., 2003) In addition prM is essential for proper folding and secretion of the envelope... (Pincus et al., 1992), DENV (Fonseca et al., 1994) and TBEV (Heinz et al., 1995) 1.6.3 Envelope The E protein (~ 53 kDa) is the major structural protein exposed at the surface of the virion It plays a role in a number of processes including receptor binding, membrane fusion, virion assembly and is the major target for neutralizing antibodies (Chambers et al., 1990; Heinz, 1986) The E protein contains... triggered by the acidic environment within the endosome that leads to fusion of the viral and the cell membrane (Figure 1.5 (3c)) The nucleocapsid is then released into the cytoplasm and replication of the RNA genome is initiated after dissociation of the capsid protein and the viral RNA (Mukhopadhyay et al., 2005; Figure 1.5 (4c, 5c)) 1.5.3 Viral Replication, Assembly and Release Upon release into the cytoplasm... required for unwinding dsRNA during viral replication, whereas the NTPase is necessary to provide the energy for unwinding The RTPase on the other hand is involved in capping of viral RNA The NS3 protease is crucial for cleavage of the polyprotein together with NS2B 17 Chapter 1 Introduction (Benarroch et al., 2004; Borowski et al., 2001; Chambers et al., 1993; Lescar et al., 2008; Patkar and Kuhn, 2008; .. .THE IMPORTANCE OF AN ALLOSTERIC POCKET IN THE DENGUE PROTEASE NOEMI REBECCA MEIER B.SC (MAJOR IN INTEGRATIVE BIOLOGY), UNIVERSITY OF BASEL A THESIS SUBMITTED FOR THE DEGREE OF MASTER OF SCIENCE... during the slave trade in the 17th and 18th centuries DENV on the other hand has spread globally in the 18th and 19th centuries with expanding shipping industry and trading Additionally DENV transmission... revealed an allosteric pocket lined by residues of both NS2B and NS3 The goal of this study is to assess the functional importance of this pocket by mutating selected residues lining the pocket
Ngày đăng: 02/10/2015, 17:13
Xem thêm: THE IMPORTANCE OF AN ALLOSTERIC POCKET IN THE DENGUE PROTEASE , THE IMPORTANCE OF AN ALLOSTERIC POCKET IN THE DENGUE PROTEASE
