386 a type 1 5alpha reductase inhibitor
Báo cáo khoa học: Isolation, characterization, sequencing and crystal structure of charybdin, a type 1 ribosome-inactivating protein from Charybdis maritima agg. potx
... (28S rRNA-N-glycosidases) of the plant Saponaria officinalis L (Caryophyllaceae) Biochim Biophys Acta 12 16, 31 42 10 Arias FJ, Antolin P, de Torre C, Barriuso B, Iglesias R, Rojo MA, Ferreras JM, ... Moreira RA, Beltramini LM & Araujo APU (2005) Pulchellin, a highly toxic type ribosome-inactivating protein from Abrus pulchellus FEBS J 272, 12 01 12 10 12 Altschul SF, Madden TL, Schaffer AA, Zhang ... (19 94) The CCP4 suite: programs for protein crystallography Acta Crystallogr D Biol Crystallogr 50, 760–763 2692 22 Navaza J (19 94) AmoRe: an automated package for molecular replacement Acta...
- 9
- 424
- 0
Báo cáo y học: "Inhibition of human immunodeficiency virus type-1 by cdk inhibitors" pdf
... of RNA polymerase II: candidate for a Tat cofactor J Virol 19 95, 69 :16 12 -16 20 Baskaran R, Dahmus ME, Wang JY: Tyrosine phosphorylation of mammalian RNA polymerase II carboxyl-terminal domain Proc ... domain Proc Natl Acad Sci USA 19 93, 90 :11 167 -11 1 71 Zhang J, Corden JL: Phosphorylation causes a conformational change in the carboxyl-terminal domain of the mouse RNA polymerase II largest subunit ... immunoprecipitated with anti-cyclin A antibody and the cdk2 activity was examined by in vitro kinase assay using histone H1 as a substrate Alsterpaullone at various concentrations (0. 01, 0 .1, 0.5, 1, 5, and...
- 14
- 335
- 0
Tài liệu Báo cáo khoa học: TMPRSS13, a type II transmembrane serine protease, is inhibited by hepatocyte growth factor activator inhibitor type 1 and activates pro-hepatocyte growth factor pdf
... factor activator Eur J Biochem 229, 257–2 61 Miyazawa K, Tsubouchi H, Naka D, Takahashi K, Okigaki M, Arakaki N, Nakayama H, Hirono S, Sakiyama O, Takahashi K et al (19 89) Molecular cloning and ... (2007) Hepatocyte growth factor activator FEBS Journal 277 (2 010 ) 4888–4900 ª 2 010 The Authors Journal compilation ª 2 010 FEBS T Hashimoto et al 10 11 12 13 14 15 16 17 18 inhibitor -1 (HAI -1) is ... Med 15 , 303– 312 Shimomura T, Denda K, Kitamura A, Kawaguchi T, Kito M, Kondo J, Kagaya S, Qin L, Takata H, Miyazawa K et al (19 97) Hepatocyte growth factor activator inhibitor, a novel Kunitz-type...
- 13
- 641
- 0
Báo cáo khoa học: Plasminogen activator inhibitor type-1 inhibits insulin signaling by competing with avb3 integrin for vitronectin binding pptx
... supported by grants from the European Union (19 99/C3 61/ 06), ´ ´ Fundacio La Marato-TV3, MCyT (SAF20 01- 0482) and FIS ( 01/ 1474), PM 99 011 6 and FIS 01/ 218 We thank A Blanco for technical assistance Y.N ... 13 4, 15 63 15 71 20 Munoz, C., Castellanos, M.C., Alfranca, A. , Vara, A. , Esteban, M .A. , Redondo, J.M & de Landazuri, M.O (19 96) Transcriptional up-regulation of intracellular adhesion molecule -1 ... S., Kawakami, T., Fujimori, H., Yonekura, H., Tanaka, N., Yamamoto, Y., Urayama, H., Watanabe, Y & Yamamoto, H (19 99) Insulin stimulates the growth and tube formation of human microvascular endothelial...
- 8
- 218
- 0
Báo cáo khoa học: Crystal structure of basic 7S globulin, a xyloglucanspecific endo-b-1,4-glucanase inhibitor protein-like protein from soybean lacking inhibitory activity against endo-b-glucanase doc
... De Ranter CJ, Gebruers K, Rabijns A, FEBS Journal 278 (2 011 ) 19 44 19 54 ª 2 011 The Authors Journal compilation ª 2 011 FEBS T Yoshizawa et al 10 11 12 13 14 15 16 17 18 19 20 21 Robben J et al (2005) ... Generously allowed (%) Disallowed (%) ˚ Averaged B-value (A2 ) PDB code 1. 0000 P 212 12 13 5.2 16 1.2 84.8 50.0 1. 90 720 554 13 8 568 6.5 (36.5) 95.6 ( 81. 0) 11 .3 (1. 9) 20 1. 91 130 634 6532 11 297 6 21 21. 1 25.9 ... Okada H, Hara S, Ikenaka T, Murao S & Arai M (19 90) Cloning and sequence analysis of a cDNA for cellulase (FI-CMCase) from Aspergillus aculeatus Curr Genet 18 , 217 –222 Scarafoni A, Ronchi A &...
- 11
- 524
- 0
Báo cáo Y học: Interaction of plasminogen activator inhibitor type-1 (PAI-1) with vitronectin Characterization of different PAI-1 mutants pdf
... F109-Q123 vs AAGAGAA F109-Q123 vs homologue PAI-2 sequenceb and E128G F109-Q123 vs AAAA D F109-H 112 F 11 4A and R 11 5A F 114 -R 118 vs AAAAA F 114 -R 118 vs AAAAA and D68G V284-G294 vs homologue PAI-2 ... Mutant (D109 -12 3) Mutant (M2) Mutant (M3) Mutant Mutant Mutant Mutant Mutant Mutant (M4) (D109 -11 2) (A1 14 -11 5) (A1 14 11 8) (M8) (M9) Mutant 10 (P7 3A) Mutant 11 (Q123K) Modi®cationa D F109-Q123 F109-Q123 ... may not be dramatic enough to eliminate the Vn-binding capacity of these PAI -1 variants Padmanabhan and Sane [19 ] located the Vn-binding site on PAI -1 to amino acids 11 5 13 0 employing PAI -1/ PAI-2...
- 9
- 295
- 0
Báo cáo sinh học: " Oligomerization of the human immunodeficiency virus type 1 (HIV-1) Vpu protein – a genetic, biochemical and biophysical analysis" ppt
... CATGGAGATGCAACCTATAATAGTAGCAATAGTAGCATT AGTAGTAGCAATAATAATAGCAATAGCTGTGTGGTCCATAGTAATCATAGAATAGG and NL-TM-R, AATTCCTATTCTATGATTACTATGGACCACACAGCTATT GCTATTATTATTGCTACTACTAATGCTACTATTGCTACTATTATAGGTTGCATCTC; ... GAATTCATGCAACCTATAATAGTAGCAATA and NL-R-GFP, GGATCCGCG CAGATCATCAATATCC; for R5 vpu, R5-X-F, GAATTCATGTTAAATTTAG ATTATAAATTAGGAGTAGG and R5-R-GFP, GGATCCTGCCAAATCATT AACATCCAAAA For colocalization ... GCTATTATTATTGCTACTACTAATGCTACTATTGCTACTATTATAGGTTGCATCTC; for the R5 vpu TM region, R5TM-F, CATGGAGATGTTAAATTTAGATTATAAATTAGGAGTAGG AGCATTGATAGTAGCACTAATCATAGCAATAGTCGTGTGGACCATAGTATATATAGAATAGG and R5-TM-R, AATT CCTATTCTATATATACTATGGTCCACACGACTATTGCTATGATTAGTGCTA...
- 11
- 436
- 0
báo cáo hóa học: " Astrogliosis is delayed in type 1 interleukin-1 receptor-null mice following a penetrating brain injury" pptx
... incubated in rabbit anti-GLT -1 (1: 1000), rabbit anti-GLAST (1: 1000) (Alpha Diagnostic International, San Antonio, TX), mouse anti-GS (Chemicon International, 1: 2000), rabbit anti-PAR1 (Santa Cruz ... astrocytes after traumatic brain injury, we analyzed the expression of two glutamate transporters, glutamate aspartate transporter (GLAST) and glutamate transporter -1 (GLT -1/ EAAT2), the glutamate The ... Immunoblotting for glutamine synthetase (GS), glutamate aspartate transporter (GLAST), glutamate transporter -1 (GLT -1) , S -10 0B and protease-activated receptor (PAR -1) , 10 µg of protein were analyzed Blots...
- 11
- 402
- 0
báo cáo hóa học: " A role for DNA-dependent activator of interferon regulatory factor in the recognition of herpes simplex virus type 1 by glial cells" pot
... [ 21, 23,24] After incubation with a rabbit polyclonal antibody against DAI (Abcam, Cambridge, MA), RIP3 (Abcam, Cambridge, MA), STING (Abcam, Cambridge, MA) or a mouse monoclonal antibody against ... MDA5/MAVSdependent and MDA5/MAVS/RNA polymerase III-independent pathways J Virol 2 010 , 84 :11 350 -11 358 Page 12 of 12 doi :10 .11 86 /17 42-2094-8-99 Cite this article as: Furr et al.: A role for DNA-dependent activator ... Rintahaka J, Søby S, Horan KA, Poltajainen A, Østergaard L, Paludan SR, Matikainen S: Early innate recognition of herpes simplex virus in human primary macrophages is mediated via the MDA5/MAVSdependent...
- 12
- 529
- 0
Báo cáo hóa học: " Identification of a contemporary human parechovirus type 1 by VIDISCA and characterisation of its full genome" pdf
... oligonucleotide linkers for the HinP1I-site (GACGATGAGTCCTGAT and Phosphate-CGATCAGGACTCAT, 1: 1) and the CviII-site (CTCGTAGACTGCGTACG and Phosphate-ATCGTACGCAGTC, 1: 1) were ligated to the complete phenol-purified ... Microarray-based detection and genotyping of viral pathogens Proc Natl Acad Sci U S A 2002, 99 :15 687 -15 692 Allander T, Andreasson K, Gupta S, Bjerkner A, Bogdanovic G, Persson MA, Dalianis T, Ramqvist ... 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 Allander T, Tammi MT, Eriksson M, Bjerkner A, Tiveljung-Lindell A, Andersson B: Cloning of a human parvovirus by molecular screening of respiratory...
- 10
- 432
- 0
Báo cáo khoa học: "Oxcarbazepine as monotherapy of acute mania in insufficiently controlled type-1 diabetes mellitus: a case-report" pdf
... 12 13 14 15 16 17 18 19 20 21 and improving the standard of care J Clin Psychopharmacol 2004, 24(5 Suppl 1) :S7-S14 Hirschfeld RM, Kasper S: A review of the evidence for carbamazepine and oxcarbazepine ... or carbamazepine, possibly with a benzodiazepine as an adjunctive medication However, in the case of our patient, administration of lithium salts was relatively contra-indicated as an anti-manic ... Psychiatric Association (APA): Diagnostic and Statistical Manual of Mental Disorders revised text edition Washington DC: APA; 2000 Young RC, Biggs JT, Ziegler VE, Meyer DA: A rating scale for mania:...
- 4
- 308
- 0
Báo cáo y học: "A comparative study of the inhibitory effects of interleukin-1 receptor antagonist following administration as a recombinant protein or by gene transfer." pps
... efficacy in animal models of RA and OA, and a phase I human trial has recently confirmed that the human IL-1Ra cDNA can be safely transferred to and expressed within human rheumatoid joints [19 ] A ... these situations, such as that reported in Figs and 5, the importance of maintaining the local level of IL-1Ra became dramatically apparent, as were the advantages of gene transfer as a means of ... inhibition was extrapolated to a concentration of approximately 230 ng/ml IL-1Ra and complete inhibition at approximately 800 ng/ml This translated to IL-1Ra : IL -1 ratios of approximately 46 : and 16 0...
- 9
- 421
- 0
báo cáo khoa học: "Bilateral adrenocortical carcinoma in a patient with multiple endocrine neoplasia type 1 (MEN1) and a novel mutation in the MEN1 gene" potx
... neoplasia type J Surg Oncol 2005, 89 :14 3 -15 0 11 Carrasco CA, González AA, Carvajal CA, Campusano C, Oestreicher E, Arteaga E, Wohllk N, Fardella CE: Novel intronic mutation of MEN1 gene causing familial ... JS, Scacheri PC, Ji Y, Novotny EA, Garrett-Beal L, Ward JM, Libutti SK, Richard Alexander H, Cerrato A, Parisi MJ, Santa Anna-AS, Oliver B, Chandrasekharappa SC, Collins FS, Spiegel AM, Marx SJ: ... The variable penetrance and spectrum of manifestations of multiple endocrine neoplasia type Surgery 19 98, 12 4 :11 06 -11 14 17 Skogseid B, Rastad J, Gobl A, Larsson C, Backlin K, Juhlin C, Akerström...
- 7
- 412
- 0
Báo cáo y học: "Differential expression, function and response to inflammatory stimuli of 11β-hydroxysteroid dehydrogenase type 1 in human fibroblasts: a mechanism for tissue-specific regulation of inflammation" pps
... Primers and probes 11 β-HSD1 Forward primer: AGGAAAGCTCATGGGAGGACTAG Reverse primer: ATGGTGAATATCATCATGAAAAAGATTC Probe: CATGCTCATTCTCAACCACATCACCAACA H6PDH Forward primer: CAGGTGTCCTAGTGCACATTGAC ... GTAGCCCACTCTCTCGTCCAA Probe: AAGGCACGCCCTCCCAGCG GRα Forward primer: GCGATGGTCTCAGAAACCAAAC Reverse primer: GAGATTACAGAGGAAGTTATCCTCTGC Probe: TGCAGTGAAGGTTGCTGAGGCTCTGA GRβ Forward primer: AAC ... CAG CGG TTT TAT CAA CT Reverse primer: AACTCTTGGATTCTATGCATGAAAATGTTA TGTGGTTA Probe: TGT GTG AGA TGT GCT TTC TGG TT C/EBPα Forward primer: TGGACAAGAACAGCAACGAG Reverse primer: TTGTCACTGGTCAGCTCCAG...
- 10
- 438
- 0
báo cáo khoa học: "A non-healing corneal ulcer as the presenting feature of type 1 diabetes mellitus: a case report" pps
... analysis Arch Ophthalmol 19 89, 10 7 :15 20 -15 23 Sakamoto A, Sasaki H, Kitagawa K: Successful treatment of diabetic keratopathy with punctal occlusion Acta Ophthalmol Scand 2004, 82 :11 5 -11 7 Klocek MS, Sassani ... appropriate nocturnal padding and lubrication Animal studies have shown that the opioid antagonist naltrexone and insulin used topically can facilitate healing in diabetic rats by enhancing DNA synthesis ... keratopathy and diabetes mellitus Eye 2006, 20:837-839 Ockrim Z, Yorston D: Managing diabetic retinopathy BMJ 2 010 , 3 41: c5400 Akagi Y, Yajima Y, Kador PF, Kuwabara T, Kinoshita JH: Localization...
- 14
- 305
- 0
Báo cáo y học: "Hyperthyroidism from autoimmune thyroiditis in a man with type 1 diabetes mellitus: a case report" pdf
... hypothyroidism appears to increase insulin resistance independently of weight gain [9 ,10 ] and has been associated with an increased risk of symptomatic hypoglycemia [11 ] Protracted hypoglycemia can lead ... Amory and Hirsch Journal of Medical Case Reports 2 011 , 5:277 http://www.jmedicalcasereports.com/content/5 /1/ 277 A1 c (HbA1c) was 7.5% He had no evidence of retinopathy, neuropathy or nephropathy ... 27:728-732 Karavanaki K, Kakleas K, Pashali E: Screening for associated autoimmunity in children and adolescents with type diabetes mellitus Horm Res 2009, 71: 2 01- 206 Michels AW, Gottlieb PA: Autoimmune...
- 4
- 307
- 0
báo cáo khoa học: "A signal amplification assay for HSV type 1 viral DNA detection using nanoparticles and direct acoustic profiling" ppsx
... experimentally, the 15 nm nanoparticle assay have a 89 ± Hz signal at 5.2 × 10 -10 M target concentration and 12 ± Hz signal at 5.2 × 10 -11 M target concentration using 5.25 × 10 10 gold nanoparticles (Figure ... dynamic range and the data variation associated with the signal measurements; where a Z-factor between 0.5 and 1. 0 is an excellent assay; between and 0.5 is marginal, and less than means that ... Fe3O4/Au core/shell nanoparticle and DNA ligase reaction Sensors and Actuators, B: Chemical 2007, 12 7: 311 - 316 14 Liu T, Tang Ja, Jiang L: The enhancement effect of gold nanoparticles as a surface...
- 12
- 394
- 0
Báo cáo y học: " Recurrent spontaneous hip dislocation in a patient with neurofibromatosis type 1: a case report" potx
... Greggi T, Sudanese A: Pathological dislocation of the hip in neurofibromatosis: a case report Chir Organi Mov 2008, 16 3 :16 3 -16 6 10 Haga N, Nakamura S, Taniguchi K, Iwaya T: Pathologic dislocation of ... von Recklinghausen’s disease: a case report RinsyouSeikeigeka (Clinical Orthopaedic Surgery) 19 99, 11 51: 115 1 -11 54 Submit your next manuscript to BioMed Central and take full advantage of: • Convenient ... lateral malleolus She had six cafb-aulait patches on her trunk and bilateral axillary freckling A radiograph of the pelvis revealed a superior dislocation of her left hip with an abnormal appearing...
- 4
- 280
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008