0

3€ passing data from one screen to another

iOS 5 Programming Cookbook phần 5 pptx

iOS 5 Programming Cookbook phần 5 pptx

Kỹ thuật lập trình

... you will be sent back to the first view controller See Also XXX 4.3 Passing Data From One Screen to Another Problem You want to pass data from one scene to another using storyboards Solution Use ... allow you to drop a button onto a view controller You need to double click on an empty space on your storyboard to zoom into it before Interface Builder allows you to drop UI components onto your ... button and on the button and drag all the way to the second view controller (see Figure 4-20 344 | Chapter 4: Storyboards Figure 4-20 Connecting a button to another view controller in a storyboard...
  • 89
  • 331
  • 0
THE STUDY OF a NOVEL MIXED LINEAGE LEUKEMIA 5 ISOFORM AND ITS ASSOCIATION WITH HUMAN PAPILLOMAVIRUS 16 18   RELATED HUMAN CERVICAL CANCERS

THE STUDY OF a NOVEL MIXED LINEAGE LEUKEMIA 5 ISOFORM AND ITS ASSOCIATION WITH HUMAN PAPILLOMAVIRUS 16 18 RELATED HUMAN CERVICAL CANCERS

Cao đẳng - Đại học

... Histone Histone Hanks Buffered Salt Histone methyltransferase Homeobox Human papillomavirus Hour(s) Human telomerase reverse transcriptase Interferon-α Interleukin-6 Interferon regulatory factor ... found to inhibit apoptosis through p53-independent pathway by inhibiting pro-apoptotic Bax protein (Magal et al, 2005; Vogt et al, 2006) and binding to tumour necrosis factor receptor (TNFR1) to ... NotI sites and cloned into pEF6/V5-His vector (Invitrogen) for FLAGtagged MLL5β expression vector (FLAG-MLL5β); while digested with SalI and BamHI sites and cloned into pEGFP-C1 vector (Clontech)...
  • 140
  • 396
  • 0
Báo cáo y học:

Báo cáo y học: " A Novel Variable Number of Tandem Repeat of the Natriuretic Peptide Precursor B gene’s 5’-Flanking Region is Associated with Essential Hypertension among Japanese Females"

Y học thưởng thức

... other factors [18] Unfortunately, we were not able to obtain samples to measure plasma BNP and ANP levels, due to the difficulty in obtaining written informed consent for blood examinations from ... at 5°C for 80 and then subjected to silver staining (Dai-ichi Kagaku, Tokyo, Japan) The electrophoresis parameters were set according to the manufacturer’s protocol Sequencing analysis Two oligonucleotides ... 5’-AAGGAGGCACTGGGAGAGGGGAAAT-3’ (bases -1323 to -1299) and antisense, 5’CCCCACCAAGCCAACACAGGATGGA -3’ (bases -919 to- 895) were used to amplify a 429-bp product from genomic DNA (Fig 1A) The PCR products...
  • 7
  • 612
  • 1
IIS Web Server - Part 5 - URL Rewrite in IIS7 with URL Rewrite Module

IIS Web Server - Part 5 - URL Rewrite in IIS7 with URL Rewrite Module

Quản trị mạng

... ... http://localhost/article/543/some-other-title Cách cấu hình tương tự có số thay đổi khác chút: Ô Name bạn nhập: "Redirect from blog" Ô Pattern nhập: "^blog/([_0-9a-z-]+)/([0-9]+)" Mục Action chọn là: "Redirect" Ô Redirect ... Web Server vào lại localhost để test xem nhé: Cách 2: chọn Blank rule of Đặt tên cho Rule Rewrite to article.aspx Trong ô "Pattern" bạn nhập vào chuỗi sau: ^article/([0-9]+)/([_0-9a-z-]+) Chuỗi...
  • 9
  • 648
  • 3
Performing a Bulk Insert with SQL Server

Performing a Bulk Insert with SQL Server

Kỹ thuật lập trình

... 12209 Germany 030-0074321 030-0076545 WOLZA Wolski Zajazd ... SQLXMLBULKLOADLib; using System .Data; using System .Data. SqlClient; private const String DATAFILENAME = ConfigurationSettings.AppSettings["Project_Directory"] + @"Chapter 09\Customers.xml"; private const ... MessageBoxButtons.OK, MessageBoxIcon.Error); } finally { bl = null; } Discussion The SQL Server XML Bulk Load component is used through COM interop to bulk insert data contained in a XML document into...
  • 5
  • 395
  • 0
Module 5: Reading and Writing XML with ADO.NET

Module 5: Reading and Writing XML with ADO.NET

Cơ sở dữ liệu

... structure of the data that you are reading ! To describe the structure of data that you are exporting to another consumer When you want to send data from a DataSet and put it into an XML data document, ... and Data into DataSets ! Loading a Schema into a DataSet ! Loading XSD Information from a File ! Examining Metadata ! Demonstration: Examining DataSet Structure ! Loading XML Data into a DataSet ... from an XML data file into a DataSet object Before you load the data, you must create a relational data structure in the DataSet Ways to load a schema into a DataSet You can load a schema into...
  • 54
  • 1,365
  • 8
Tài liệu IELTS Speaking Part Two Tasks with unusual or difficult topics ppt

Tài liệu IELTS Speaking Part Two Tasks with unusual or difficult topics ppt

TOEFL - IELTS - TOEIC

... should say: - When that season is from and to - What the weather is like - How it is different from the other seasons in your country And say what you are planning to when that season next comes ... house You should mention: - What the chore is - Why it needs to be done - How often you it And say if you get a feeling of satisfaction from doing this chore or not, and why Describe your typical ... reading it - If you would like to read something else by the same writer And say what kind of person might like to read the same thing Describe a famous painting or photo you have seen or know about...
  • 3
  • 1,164
  • 5
Dreamweaver CS5.5 Mobile and Web Development with HTML5, CSS3, and jQuery doc

Dreamweaver CS5.5 Mobile and Web Development with HTML5, CSS3, and jQuery doc

Kỹ thuật lập trình

... Design view You can toggle between these views from the View menu, or by using buttons in the Document toolbar (if the buttons are not visible, choose View | Toolbars | Document to display it) Code ... for a basic -to- intermediate book like this However, we will work hard to make those forays in the Code view as effortless as possible Moreover, I promise to leave "no stone unturned" to utilize ... Setup dialog to connect your local site to the remote site In order to upload files from your local site to your remote site, choose Site | Synchronize Sitewide, and choose upload options from the...
  • 284
  • 817
  • 0
Dreamweaver CS5.5 Mobile and Web Development with HTML5, CSS3, and jQuery pptx

Dreamweaver CS5.5 Mobile and Web Development with HTML5, CSS3, and jQuery pptx

Kỹ thuật lập trình

... Design view You can toggle between these views from the View menu, or by using buttons in the Document toolbar (if the buttons are not visible, choose View | Toolbars | Document to display it) Code ... for a basic -to- intermediate book like this However, we will work hard to make those forays in the Code view as effortless as possible Moreover, I promise to leave "no stone unturned" to utilize ... Setup dialog to connect your local site to the remote site In order to upload files from your local site to your remote site, choose Site | Synchronize Sitewide, and choose upload options from the...
  • 284
  • 2,658
  • 0
Dreamweaver CS5.5 Mobile and Web Development with HTML5, CSS3, and jQuery ppt

Dreamweaver CS5.5 Mobile and Web Development with HTML5, CSS3, and jQuery ppt

Quản trị Web

... Design view You can toggle between these views from the View menu, or by using buttons in the Document toolbar (if the buttons are not visible, choose View | Toolbars | Document to display it) Code ... for a basic -to- intermediate book like this However, we will work hard to make those forays in the Code view as effortless as possible Moreover, I promise to leave "no stone unturned" to utilize ... Setup dialog to connect your local site to the remote site In order to upload files from your local site to your remote site, choose Site | Synchronize Sitewide, and choose upload options from the...
  • 284
  • 1,139
  • 0
automatic tasks with visual basic

automatic tasks with visual basic

Luật thương mại

... The Visual Basic Editor  Visual Basic code is stored in database, but it need a different tool to view and edit it, called the Visual Basic editor  Open the Visual Basic editor:  In the Access ... choose Database Tools➝ Macro ➝ Visual Basic The Visual Basic Editor  The Visual Basic editor window is divided into three main regions − Project window: shows all the modules in your database ... modules A module consists of one or more procedures Variable: is nothing more than a name applied to represent a data value Variable is used to hold values such as customer names, dates, and numeric...
  • 32
  • 328
  • 0
automating tasks with macros

automating tasks with macros

Luật thương mại

... steps to use single-step debugging: − Open macro in Design view − Choose Macro Tools | Design ➝ Tools  Single Step − Choose Macro Tools | Design ➝ Tools ➝ Run − Click Step, Continue, or Stop All ... operators: =, , = − Logical operator: And & Or − Functions:  IsNull()  Len()  … Data Macros  Data Macros is a macro run when an event occurs in a table  Data macros respond to ... edit a record, and send an email  Data macros support a different set of actions  Data macros can stick with database even when transfer it to another platform Data Macros  Table Events: Event...
  • 21
  • 298
  • 0
IIS Web Server - Part 5 - URL Rewrite in IIS7 with URL Rewrite Module pdf

IIS Web Server - Part 5 - URL Rewrite in IIS7 with URL Rewrite Module pdf

Quản trị mạng

... ... http://localhost/article/543/some-other-title Cách cấu hình tương tự có số thay đổi khác chút:     Ô Name bạn nhập: "Redirect from blog" Ô Pattern nhập: "^blog/([_0-9a-z-]+)/([0-9]+)" Mục Action chọn là: "Redirect" Ô Redirect ... Web Server vào lại localhost để test xem nhé: Cách 2: chọn Blank rule Đặt tên cho Rule Rewrite to article.aspx Trong ô "Pattern" bạn nhập vào chuỗi sau: ^article/([0-9]+)/([_0-9a-z-]+) Chuỗi...
  • 16
  • 330
  • 0
Báo cáo y học:

Báo cáo y học: " Aripiprazole Augmentation in the Treatment of Military-Related PTSD with Major Depression: a retrospective chart review" docx

Báo cáo khoa học

... decrease from baseline (mean = 99.25 kg, SD = 13.35) to the final visit is 1.05 kg (SD = 4.95) Only two patients discontinued the aripiprazole; one patient due to non-response and one due to intolerable ... noradrenergic specific serotonergic antidepressants (NaSSA) (n = 12, 44.4%); serotonin norepinephrine reuptake inhibitor (SNRI) (n = 11, 41.7%), and selective serotonin reuptake inhibitor (SSRI) (n = 10, ... 20.6 10 t1 t2 t3 t4 PTSD Checklist (PCL) Total Score Beck Depression Inventory (BDI) Total Score Figure Change in PCL and BDI total score from baseline (t1) to months (t4) for patients receiving...
  • 7
  • 298
  • 0
Báo cáo y học:

Báo cáo y học: " No association of xenotropic murine leukemia virus-related virus with prostate cancer or chronic fatigue syndrome in Japa" doc

Báo cáo khoa học

... for anti-Env pAb (data not shown) To examine the specificity of the screening-positive plasma samples, we performed an additional immunoblot assay against proteins from Moloney murine leukemia ... highly susceptible to XMRV [17], gave rise to devastating LNCap-FGC cell death (data not shown), and we were unable to detect XMRV genes in the cell culture (Figure 5A) Our data suggest that P24 ... times higher than that used in the screening assay (Figure 3A, 1:5,120,000 dilution corresponding to 0.78 ng/ml R187 mAb) All screening-positive plasma, but not screening-negative plasma, tested...
  • 12
  • 310
  • 0
DEVELOPING PRE­READING TASKS WITH FIRST­YEAR STUDENTS OF ENGLISH­MAFOR DIVISION, DEPARTMENT OF SOCIAL SCIENCE, VINH PHUC COLLEGE AN ACTION RESEARCH

DEVELOPING PRE­READING TASKS WITH FIRST­YEAR STUDENTS OF ENGLISH­MAFOR DIVISION, DEPARTMENT OF SOCIAL SCIENCE, VINH PHUC COLLEGE AN ACTION RESEARCH

Tổng hợp

... just to understand a text but to convey the implication to someone” From this point of view, oral reading is not only the simple way of reading the text aloud, but it also is an effective way to ... story with the topic related to the reading text The story is regarded as a brief introduction to the text In addition, students also feel excited with the content of the text, which relates to ... are asked to list all words related to key words either orally or written down the paper Hence, brainstorming can encourage students to remind of their prior background knowledge to the topic of...
  • 159
  • 244
  • 0
Extreme value and related models with applications in engineering and science

Extreme value and related models with applications in engineering and science

Cơ khí - Chế tạo máy

... in Sweden Data 1.4.5 Houmb's Data 1.4.6 Telephone Calls Data 1.4.7 Epicenter Data 1.4.8 Chain Strength Data ... to allow for realistic safety margins in structural design, on one hand, and for economical solutions, on the other Design engineers also need to extrapolate from small laboratory specimens to ... Sweden Data (Women) Table 1.5: Oldest Ages at Death in Sweden Data (Men) 1.4.6 Telephone Calls Data The tirnes between 41 (in seconds) and 48 (in minutes) consecutive telephone calls to a company's...
  • 367
  • 905
  • 0

Xem thêm

Tìm thêm: xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008