200® for the treatment of mastitis caused by staphylococcus aureus and or streptococcus uberis
báo cáo khoa học: " FCR (Fludarabine, Cyclophosphamide, Rituximab) regimen followed by 90yttrium ibritumomab tiuxetan consolidation for the treatment of relapsed grades 1 and 2 follicular lymphoma: a report of 9 cases" pot
... dexamethasone and rituximab, remaining in CR for 48 months He died at 73 years of age for sepsis during support therapy for t-MDS Other two patients have died: one for acute renal failure and one for ictus ... patients, specially at age of 60-75 and earlier in first relapse; further studies will help to clarify the best strategy for incorporating RIT into the treatment algorithm of these patients Abbreviations ... but growth factor support was utilized in the majority of patients during FCR treatment, and in all of them after 90 Y-RIT Despite the high incidence of grade or neutropenia there were no patients...
- 5
- 287
- 0
Báo cáo y học: "Endoscopic Facet Debridement for the treatment of facet arthritic pain – a novel new technique
... median period of pain relief being months The range of relief for the radiofrequency group was from zero days to 16 months for all 26 patients who underwent the radiofrequency procedure Of the 14 patients ... 100% relief of their pain in 86% of the patients with a median relief period of months The range of relief varied from zero days to up to 13 months for the facet injection group None of the lumbar ... within the joint, dorsal root axons should be incapable of re-innervating the joint In this study we investigate the long-term efficacy of facet debridement for the treatment of chronic back pain originating...
- 4
- 599
- 0
Báo cáo y học: "Endoscopic thoracic laminoforaminoplasty for the treatment of thoracic radiculopathy: report of 12 case"
... laminoforaminoplasty, should decrease the risk of major adverse events, allow for same day hospital discharge, and decrease the need for postoperative analgesia and immobility [5] [6] In the current ... period and carries significant risks The anterior approach requires a transthoracic approach with close proximity to the major abdominal and thoracic organs and neurovasculature [4], and posterior ... with thoracic central and foraminal stenosis are more likely to be male, and tend to be of older age than patients with cervical or lumbar disease Also, the stenosis tends to be foraminal and not...
- 3
- 506
- 0
Behavior of Nitrite Oxidizers in the Nitrification/Denitrification Process for the Treatment of Simulated Coke-Oven Wastewater
... laboratory of UT at 4oCstored Then, each of the samples were divided into two One of them was for DNA extraction and was washed with TE buffer at pH8.0, and stored at -20oC Another was for FISH ... analysis and was stored at -80oC The extraction of DNA was performed with Fast DNA SPIN Kit for Soil (Qbuiogene, USA) according to the instruction by the manufacturer In the preliminary step to nawwor ... down the species of NOB, the primer set FGPS872f, CTAAAACTCAAAGGAATTGA and FGPS1269r , TTTTTTGAGATTTGCTAG (Degrange and Bardin, 1995) was employed for the detection of Nitrobacter species, and the...
- 8
- 572
- 0
Contact-Adsorption-Regeneration-Stabilization Process for the Treatment of Municipal Wastewater
... The mixed liquor was centrifuged at 6000 rpm for 10 The supernatant samples were acidified to pH 2.0 by M HCl and stored in a refrigerator at 4°C before they were analyzed The adsorption isotherms ... (2008ZX07103-001 and 2008ZX07316-002), and the Anhui R&D Key Project (07010301022 and 08010302109) for the partial support of this study REFERENCES Standard Methods for the Examination of Water and Wastewater ... results of the CARS process for the municipal wastewater treatment The technical feasibility of this process was demonstrated, and the process optimization was performed In addition, the adsorption...
- 8
- 686
- 0
Tài liệu Bevacizumab and cetuximab for the treatment of metastatic colorectal cancer docx
... assesses the performance of NHS organisations in meeting core and developmental standards set by the Department of Health in ‘Standards for better health’ issued in July 2004 The Secretary of State ... guide for healthcare professionals Information for people with metastatic colorectal cancer and their carers (‘Understanding NICE guidance’) Details of all the evidence that was looked at and other ... 2005 and provides a framework both for self-assessment by healthcare organisations and for external review and investigation by Healthcare Inspectorate Wales Standard 12a requires healthcare organisations...
- 34
- 853
- 0
Tài liệu Báo cáo khoa học: Pathways and products for the metabolism of vitamin D3 by cytochrome P450scc docx
... prerequisite for cleavage of the bond between C20 and C22 [1,14] Another difference between the metabolism of vitamin D3 and cholesterol by P450scc is that the dissociation of intermediates occurs for the ... responsible for the content or functionality of any supplementary materials supplied by the authors Any queries (other than missing material) should be directed to the corresponding author for the article ... identified by purifying them and determining the substrates from which they arose by the action of P450scc, as well as the products that they gave rise to This revealed both the major and minor pathways...
- 12
- 704
- 0
Hydroxyurea for the Treatment of Sickle Cell Disease docx
... barriers to the use of this drug for sickle cell disease Therefore, we sought information on barriers to the use of other therapies for treatment of sickle cell disease, including the receipt of routine, ... terms and text words of key articles identified a priori The PubMed strategy formed the basis for the strategies developed for the other electronic databases (see Appendix A∗) Organization and ... reconciled the results of the first two reviewers; for the other study designs, the results of the two reviewers were averaged The overall score was the percentage of the maximum possible score, ranging...
- 298
- 1,113
- 0
TECHNIQUES FOR THE ANALYSIS OF ORGANIC CHEMECALS BY INDUCTIVELY COUPLED PLASMA MASS SPECTROMETRY (ICP-MS) pptx
... used, rather than pure oxygen, avoiding the use of highly flammable or explosive gases in the laboratory The oxygen is added either in the spray chamber or using a T-connector before the torch When ... interferences The Agilent 7500c, featuring the Octopole Reaction System (ORS) works well for the removal of carbon-based interferences The ORS employs simple reaction gases (H2 and He), and therefore does ... Atomic Absorption Spectroscopy For more information on our products and services, visit our Web site at www.agilent.com/chem/icpms Agilent shall not be liable for errors contained herein or for incidental...
- 6
- 610
- 0
Théorie des Fonctions Elliptiques, by Charles Briot and Jean Claude Bouquet This eBook is for the use of anyone anywhere at no cost and with almost no restrictions whatsoever docx
... Produced by Laura Wisewell, Andrew D Hwang, Amy Cunningham, Colin Bell, and the Online Distributed Proofreading Team at http://www.pgdp.net (The original copy of this book was generously ... http://www.pgdp.net (The original copy of this book was generously made available for scanning by the Department of Mathematics at the University of Glasgow.) Ce livre ộlectronique est dộdiộ la mộmoire de Laura ... par la formule u = vz p , v ộtant une fonction holomorphe de z =z p qui ne sannule pas avec z ; chacun deux donne un systốme de p vaq q leurs inniment grandes de u, reprộsentộes par la formule...
- 636
- 823
- 0
Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx
... and fibrilization that Ab forms amyloid plaques As amyloid plaques are prominent in the postmortem AD brain, early research theories placed the accumulation of extracellular, insoluble forms of ... within the physiological ranges that could be expected within the brain The capacity for metals to facilitate this process may therefore be a critical factor in the Ab mediated pathology of the ... crossing the blood–brain barrier, and it was believed that CQ solubilized the Ab plaques by stripping them of their metal content This supported the in vitro work previously reported [53], and was...
- 9
- 634
- 0
Manhood Perfectly Restored, by Unknown This eBook is for the use of anyone anywhere at no cost and with almost no restrictions whatsoever. You may copy it, give it away or re-use it under the terms of the Project Gutenberg pptx
... SPERMATORRHŒA, LOSSES, WEAKNESS AND NERVOUS DEBILITY Also for PROSTATITIS and VARICOCELE [The only standard and officially recognized treatment for these diseases of the Sexual and Urinary Organs, ... outline of the method, with a work somewhat more full and exhaustive Aware of the number of worthless and oftentimes actually injurious remedies that are being advertised and recommended for the ... search for truth and proper remedies of those two great Frenchmen, Professors Claude Lallemand and Jean Civiale The medical as well as civil honors conferred upon them by their country and their...
- 371
- 1,077
- 0
Outlines of Greek and Roman Medicine, by James Sands Elliott This eBook is for the use of anyone anywhere at no cost and with almost no restrictions whatsoever. You may copy it, give it away or re-use it under the terms of docx
... at the present time the visitor may see this ancient work in the Roman Forum, and trace its course to the Tiber In the Forum, too, to the left of the Temple of Castor, is the sacred district of ... happening of the serpent landing from the ship the end of the island on which the Temple of Æsculapius stood was shaped into the form of the bow of a ship, and the serpent of Æsculapius was sculptured ... scope for the cultivation of the peaceful arts and the investigation of science, and life itself was accounted so cheap that little thought was given to improving methods for the treatment of the...
- 425
- 659
- 0
Báo cáo khoa học: A guide to taming a toxin – recombinant immunotoxins constructed from Pseudomonas exotoxin A for the treatment of cancer ppt
... system for transport across the ER membrane to the cytosol [91,92] To date, we are unaware of direct evidence for transport of PE through the Sec61p translocon Additional support for the hypothesis ... that the entirety of domain II exists simply to provide a site for the separation of the A and B fragments Work on PE-based RITs has shown that the majority of domain II is not essential for activity, ... variety of ways, from changing the number of receptor sites per cell to altering the rate of internalization of the receptor or influencing the intracellular trafficking The proteome of the target...
- 18
- 528
- 0
The Eugenic Marriage, Vol 2 (of 4), by W. Grant Hague This eBook is for the use of anyone anywhere at no cost and with almost no restrictions whatsoever. You may copy it, give it away or re-use it under the terms of the Pro pptx
... miscarriage The tendency to miscarriage Page 187 The Baby CHAPTER XVI HYGIENE AND DEVELOPMENT OF THE BABY What to prepare for the coming baby— Care of the newly-born baby The first bath—Dressing the cord Treatment ... cord Treatment after the cord falls off—A pouting navel —Bathing baby—Clothing the baby— Baby's night clothes—Care of the eyes —Care of the mouth and first teeth— Care of the skin—Care of the ... significance of socalled vomiting after feedings— Mother's milk that is unfit for baby— Fresh air for baby—Air baths for baby Page 223 CHAPTER XVIII BABY'S GOOD AND BAD HABITS —FOOD FORMULAS Baby's bed—The...
- 634
- 1,044
- 0
Charles Darwin, by Grant Allen1Charles Darwin, by Grant AllenThe Project Gutenberg EBook of Charles Darwin, by Grant Allen This eBook is for the use of anyone anywhere at no cost and with almost no restrictions whatsoever. You may copy it, give it aw potx
... broachers of new theories for the extraordinary candour and openness of his method He acknowledged beforehand all the difficulties in the way of his theory, and though he himself confessed that some of ... another for the food-supply of the moment; plants are perpetually battling with one another for their share of the soil, the rainfall, and the sunshine The case of the plant is a very important ... with the interpretation of the Egyptian hieroglyphics, and of the cuneiform inscriptions; with the undulatory theory of light, with the mechanical equivalent of heat, with the doctrine of the correlation...
- 80
- 597
- 0
Charles Darwin: His Life in an1Charles Darwin: His Life in anAutobiographical Chapter, and in a Selected Series of His Published Letters, by Charles Darwin, Edited by Sir Francis Darwin This eBook is for the use of anyone anywhere at no cost and with potx
... preparing the MS for my Geological Observations, and arranged for the publication of the Zoology of the Voyage of the Beagle In July I opened my first note-book for facts in relation to the Origin of ... on the effects of subsidence, and it was easy to replace in imagination the continued deposition of sediment by the upward growth of corals To this was to form my theory of the formation of barrier-reefs ... I therefore became almost convinced that the common cowslip and primrose were on the high-road to become dioecious; that the short pistil in the one form, and the short stamens in the other form...
- 245
- 605
- 0
Pelvic floor muscle training and adjunctive therapies for the treatment of stress urinary incontinence in women: a systematic review doc
... is the evidence for the optimal period of treatment and number of treatments? We found evidence for the efficacy of shorter treatment protocols than the 4–6 months recommended by the ICS The ... important information for consumers not only because of the implications for their time commitment and motivation but also because of the cost More precise information about the length of treatment ... exercise dosage is the critical factor is unclear The optimal length of treatment and the number of treatment episodes could be useful information for the marketing of physical therapy for SUI Some...
- 28
- 738
- 0
Best Practice Policy Statement on Cryosurgery for the Treatment of Localized Prostate Cancer pptx
... upon the peer review comments, the best practice statement was submitted to and approved by the PGC and the Board of Directors of the AUA Funding of the Panel and of the PGC was provided by the ... want or are not good candidates for RP because of comorbidities, including obesity or a prior history of pelvic surgery The latter is based on the opinion and experience of the Panel Cryosurgery ... potential of thermal injury to this muscle The thermosensor is introduced through the perineal skin and advanced until the impression of the tip of the thermocouple can be seen in the sphincter The placement...
- 51
- 417
- 0
Báo cáo khoa học: Mechanism for the hydrolysis of hyaluronan oligosaccharides by bovine testicular hyaluronidase docx
... optimal for hydrolysis The optimal conditions for the hydrolysis of HA by commercial BTH are pH 4.0 and the presence of NaCl, whereas for transglycosylation they are pH 7.0 and the absence of NaCl ... and 19570119) for Scientific Research from the Ministry of Education, Culture, Sports, Science, and Technology of Japan, and by the Fund for Cooperation for Innovative Technology and Advanced Research ... experiments, the buffers were glycine ⁄ HCl for pH 2.0–3.0, citrate ⁄ NaOH for pH 3.5–4.0, acetate ⁄ NaOH for pH 4.5–5.5, Mes ⁄ NaOH for pH 6.0–6.5, phosphate ⁄ NaOH for pH 7.0–7.5, and Tris ⁄ HCl for...
- 11
- 480
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25