17 finding the services a domain controller is advertising
Here’s how to restart the action. A still photo is real life on pause.
... the distance where the reader can’t feel it (Above, right) As big as the card, the image has in-your-face impact and gets the reader’s undivided attention 0622 Unleash the action! Make a field ... sets it in the distance where the reader can’t feel it (Above, right) As big as the card, the image has in-your-face impact and gets the reader’s undivided attention of 10 Unleash the action! ... Problem is, the design he made doesn’t feel like the energetic day The data is there, but that sweaty, bonejarring vitality the fun stuff is missing A still photo is a moment from real life on “pause.”...
- 16
- 339
- 0
Báo cáo khoa học: A region within the C-terminal domain of Ure2p is shown to interact with the molecular chaperone Ssa1p by the use of cross-linkers and mass spectrometry doc
... N-terminal moiety of Ure2p, which is critical for assembly An alternative explanation that can account for this observation is that Ssa1p binds with higher affinity a conformational state of Ure2p as ... The list of light and heavy precursor masses was further used either to analyze the MS ⁄ MS spectra acquired in the data-dependent acquisition analysis or to build an inclusion list with the light ... and an additional internal calibration was performed during mass spectra analysis using nonmodified peptides of both Ure2p and ⁄ or Ssa1p Acquisition and data analysis were performed using the explorer...
- 12
- 510
- 0
Báo cáo khoa học: A hydrophobic segment within the C-terminal domain is essential for both client-binding and dimer formation of the HSP90-family molecular chaperone pptx
... We also thank Mr T Kobayakawa (Nagasaki University, Nagasaki, Japan) for the technical assistance This work was supported by Grants-in-Aid for Scientific Research from the Ministry of Education, ... [26] that they form a dimer in an antiparallel fashion through a pair of the interactions between the middle domain and the C-terminal domain Similarly, the C-terminal 326 amino acids of barley ... C-terminal domains with purified samples in vitro, because HSP9 0a- MC formed a stable dimer; neither the middle domain nor the C-terminal domain added afterwards was replaced (data not shown) Accordingly,...
- 9
- 364
- 0
Tài liệu Module 7: Minimizing the Impact on Network Operations During a Domain Restructure docx
... account, is used to authenticate the application or service in the domain Because these accounts are often defined both within the SAM database and within the application, special care must be taken ... users use their cloned accounts in the target domain, they authenticate against Active Directory rather than the Windows NT 4.0 Security Accounts Manager (SAM) database If your network contains Windows ... When accounts are cloned from a source domain to a Windows 2000 target domain during an inter-forest restructure, user passwords are not maintained Authentication issues can arise due to this fact...
- 36
- 449
- 0
It’s Not You, It’s Your Strategy: The HIAPy Guide to Finding Work in a Tough Job Market
... talk more about that Whereas in Part I, I wrote a lot about your reasonable fears as a job applicant, now let’s talk about the hirer’s reasonable fear of making a bad hire, which can be a catastrophic ... one as quickly and easily as possible so they can get back to all their other work 2) Additionally, many hirers are taught that it’s important to treat every candidate exactly the same way, as a ... Praise the company’s culture That’s a great tactic, both because many companies work hard to establish a certain culture, and because the hirer will naturally assume that if you like his company’s...
- 48
- 560
- 0
Tài liệu Báo cáo khoa học: Evidence for noncooperative metal binding to the a domain of human metallothionein ppt
... indicates that the mechanism may be similar to that of Co2+ The fact that the equilibrium constants for the a domain are greater than those for the b domain may be a factor in explaining the observed ... cooperative pathway Alternatively, the partially filled Cd 1a, Cd 2a and Cd 3a intermediate species will be detected in the case of a noncooperative metallation mechanism The metallation rate of either the ... description of the protein preparation and purification details) Following 2254 isolation and purification, the S-tag fusion peptide was cleaved from the domain, generating the isolated a domain, the sequence...
- 9
- 533
- 0
Tài liệu The Proof is in the Pudding - A Look at the Changing Nature of Mathematical Proof doc
... outlined above Along the way, we are able to acquaint the reader with the culture of mathematics: who mathematicians are, what they care about, and what they We also give indications of why mathematics ... Experimental Mathematics is published by A K Peters, a daring and innovative mathematics publisher Klaus Peters is himself a Ph.D in mathemat16 There is a grand tradition in mathematics of not leaving ... hacking away at a computer Neither of these contentions is incorrect, but they not begin to penetrate all that a mathematician really is Paraphrasing Keith Devlin, we note that a mathematician is...
- 334
- 515
- 0
Báo cáo khoa học: The A domain of fibronectin-binding protein B of Staphylococcus aureus contains a novel fibronectin binding site pdf
... CGGGGATCCGCATCGGAACAAAACAATAC AATCCCGGGTTACTTTAGTTTATCTTTGCCG GGGGGATCCGGTACAGATGTAACAAATAAAG ATTCCCGGGTAATTTTTCCAAGTTAAATTACTTG GGGGGATCCGGTACAGATGTAACAAATAAAG CTCCCCGGGCTATTGAATATTAAATATTTTGCTAA ... CCCGGATCCTATTTAGGTGGAGTTAGAGATAAT AATCCCGGGTTACTTTAGTTTATCTTTGCCG GAATTATCTTTAGCTCTAGCTATTGATCC GGATCAATAGCTAGAGCTAAAGATAATTC GCAGAATTCGTCGGCTTGAAATACGCTG AATGGATCCTTACTTTAGTTTATCTTTGCCG CCCAAGCTTGATGATGTCAGC ... identical KD values, indicating that the N1 subdomain does not have any role in Fg binding This is in accordance with the A domains of ClfA and FnBPA, the N2N3 subdomains of which contain the minimal...
- 13
- 514
- 0
Báo cáo khoa học: The SWI⁄SNF protein BAF60b is ubiquitinated through a signalling process involving Rac GTPase and the RING finger protein Unkempt doc
... support the idea that Rac and Unkempt can translocate in the nuclear compartment and activate BAF60b ubiquitination; how these processes are co-ordinated remains to be analysed Discussion Although the ... cellular mRNA levels were monitored by RT-PCR (Access RT-PCR system; Promega, Madison, WI, USA) using Unkempt-specific primers 5¢TCTTCGAGTG CAAGTCCAAA and 5¢AAGATCACCTGTGCCTCCAC, and normalized against ... UNK-C-ter as bait allowed the isolation of several independent cDNA clones encoding the C-terminal part of BAF60b ⁄ SMARCD2 (see Materials and methods, and Fig 4A) ; BAF proteins are constitutive of the...
- 12
- 432
- 0
Costing the Banking Services: A Management Accounting Approach potx
... With this approach the bank calculates the unit cost of the services the operational and/or discretional centres perform for the branches and these are then debited to the profit and loss account ... total assets Similarly, Gadner and Lammers (1988) carried out a survey on the application of management accounting between banks and saving and loans associations They selected the 50 largest banks ... approaches, the partial costs system, which allocates only a part of the company's costs and the full cost systems, which allocates all the costs (Amat and Soldevila, 1997, p.46) In any of these alternative...
- 20
- 755
- 0
Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf
... TGGACGGATATTGAAGCTGATCTCACCATAAAGGAT ATCCTTTATGGTGAGATCAGCTTCAATATCCGTCCA TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA TCTAGTGAACTGTTCTTGCGATTTGATAGCCTTTAA GAAGCAAGAACAGTTCACTTAGTCAATTGATTAACGTG CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTC ... However, the majority of these proteins are likely to be other meiotic clade AAA ATPases and have the AAA domain helix and the C-terminal helix, but not the b domain The distinguishing feature of ... of the AAA superfamily typically contain one or two ATPase domains that assemble into one or two stacked hexameric rings The ATPase catalytic site is located at the interface between adjacent ATPase...
- 23
- 490
- 0
Báo cáo khoa học: The catalysis of the SARS 3C-like protease is under extensive regulation by its extra domain doc
... material The following supplementary material is available online: Table S1 DNA oligos used to generate mutated and deleted SARS 3C-like protease constructs This material is available as part of the ... super-active mutant had an SARS 3C-like protease regulation by its extra domain Fig The apparent molecular mass (m) of the wild-type and mutated SARS 3C-like protease (SARS 3CLp) The apparent ... activity had a small apparent molecular mass (32.6 kDa), indicating that Asn214Ala had a dominant tendency to form a monomer Therefore, at least four regions of the SARS 3CLp might be significantly associated...
- 11
- 265
- 0
Báo cáo khoa học: Expression of the Drosophila melanogaster ATP synthase a subunit gene is regulated by a transcriptional element containing GAF and Adf-1 binding sites pptx
... indicate the a- F1-ATPase GAF/Adf-1 binding cassette has enhancer properties (A) The basal promoter activity of b-F1-ATPase is greatly increased when the a- F1-ATPase GAF/Adf-1 binding cassette is ... 5¢-CCGTCGACATTAATTTGAGAAATTATAT TGCGTCGCccgccggcCgcCacgGAGGGTGAC-3¢ (again the SalI recognition site is in bold, the location of the Adf-1 element is underlined, and nucleotides in lowercase have ... this reason, ATP synthase and in particular the a- F1-ATPase and b-F1-ATPase catalytic subunits have been often used as markers for mitochondrial biogenesis [6,31,44,45] The Drosophila a- F1-ATPase...
- 11
- 532
- 0
Báo cáo khoa học: Characterization of the dimerization process of a domain-swapped dimeric variant of human pancreatic ribonuclease pdf
... existing monomers Although an increasing number of structures of domain- swapped dimers are already available [2], experimental data on the thermodynamics and the mechanism of domain swapping have, ... this covalent variant, nearly all the molecules have exchanged the N-terminal domain (Fig 7) A B Fig Scheme for the putative mechanism of domain- swapping dimerization of RNase A and the human ... observing changes in UV absorbance and in the DSC thermogram (Fig 5); (b) the His12 catalytic residue is located at the N-terminal exchanged domain, so a decrease of the enzymatic activity of the protein...
- 11
- 411
- 0
Báo cáo khoa học: R120G aB-crystallin promotes the unfolding of reduced a-lactalbumin and is inherently unstable ppt
... [11], and closely followed the discovery that a naturally occurring mutation at the equivalent position in aA-crystallin, R116C, caused congenital cataract in humans [12] In aA-crystallin and aB-crystallin, ... Structural and functional changes in the aA-crystallin R116C mutant in hereditary cataracts Biochemistry 39, 15791– 15798 Bera S & Abraham EC (2002) The aA-crystallin R116C mutant has a higher affinity ... (where aA-crystallin is mainly located), but, because aB-crystallin also has considerable extralenticular distribution, it is perhaps not surprising that the R120G aB-crystallin mutant is responsible...
- 14
- 366
- 0
The HIAPy Guide to Finding Work in a Tough Job Market by Hillary Rettig
... talk more about that Whereas in Part I, I wrote a lot about your reasonable fears as a job applicant, now let’s talk about the hirer’s reasonable fear of making a bad hire, which can be a catastrophic ... one as quickly and easily as possible so they can get back to all their other work 2) Additionally, many hirers are taught that it’s important to treat every candidate exactly the same way, as a ... Praise the company’s culture That’s a great tactic, both because many companies work hard to establish a certain culture, and because the hirer will naturally assume that if you like his company’s...
- 48
- 614
- 0
Báo cáo khoa học: The ‘pair of sugar tongs’ site on the non-catalytic domain C of barley a-amylase participates in substrate binding and activity potx
... secondary carbohydrate-binding sites that are not part of the active site area but which are situated on the surface of the catalytic domain or an intimately associated domain rather than on a CBM, ... of an N-terminal catalytic (b a) 8-barrel (domain A) , a domain B, protruding between b-strand and a- helix 3, and a C-terminal antiparallel b-sheet domain- C [3,4] The isozymes show functional and ... primer Mutant cDNA was amplied using 5Â-TTTGAATTCCATGGGGAAGAACG GCAGC-3Â as sense orientation primer and a puried megaprimer Pfu DNA polymerase (Stratagene, La Jolla, CA) was used for PCR and products...
- 13
- 385
- 0
Báo cáo khoa học: The unique pharmacology of the scorpion a-like toxin Lqh3 is associated with its flexible C-tail pdf
... vector as template DNA Primer 1, 5Â- GGCAGCCATATGTGTAATTGTAAGGCA CCAGAAACTGCACTTTGCGC-3Â, was designed to add a sequence encoding Apamin and a linker cleavable by thrombin and Fx proteases at an ... mutagenesis and comparison of bioactive surfaces and overall structures of pharmacologically distinct toxins These analyses were based on available crystal structures of a- toxins and their mutants ... this toxin on insect as well as mammalian peripheral and brain Navs [5,16,18] A similar explanation might hold for the slow effect on toxicity and a broad range of activity of the site-3 sea anemone...
- 14
- 206
- 0
World Transport, Policy & Practice Volume 17.4 January 2012: A Future Beyond the Car? potx
... What
are the main
arrival
and
exit
points
to the area?
Are
they
connected
via
walkways?
How
easy is it
to
walk
through the area?
(Do
test
walks
to
establish
this.)
How
adequate
are
footpaths/sidewalks
in the area?(Some
possible
problems:
no
footpaths,
... desertification No other aggregation of human behaviour in in Africa and China; flooding in Bangladesh; recorded history can begin to match the heat waves in Australia; methane release appalling legacy ... global carbon emissions in to the on the low-carbon form of a massive lifestyles Personal Carbon Allowance (PCA), that is an equal per capita annual phased reduction to a way out? It is often argued...
- 64
- 396
- 0
Báo cáo khoa học: The calcium-binding domain of the stress protein SEP53 is required for survival in response to deoxycholic acid-mediated injury pdf
... the primers: (a) full-length SEP53, forward 5¢)3¢ CAGTC AAGCTTATGCCTCAGTTACTGCAAAAC and reverse 5¢)3¢ CATAGCTCGAGTCATGGCTTGGTGCTTCTC; (b) DCa–SEP53, forward 5¢)3¢ TGCTAGAATTCAGATC TATGAGCGAGAGTGCTGAGGGA ... GCTCCATGCCTCAGTTACTGCAAAACATTAATGGG ATCATCGAGGCC-3¢; reverse 5¢-GGGGACCACTTTGT ACAAGAAAGCTGGGTCGGCCAGCGGCTTAAGGTT TTATTGATGCATTAGGGTAGATGGGGC-3¢ Human SEP53 gene was subcloned into the Gateway entry vector ... PCR amplification of this SEP53 fragment to introduce attB sequences for cloning into the Gateway cloning system (Invitrogen) were: forward 5¢-GGGGACAAGTTTGTACAAAAAAGCAG GCTCCATGCCTCAGTTACTGCAAAACATTAATGGG...
- 18
- 370
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25