... for channel estimation are a ected by the noise at the relay, and of the back-off Thus we can not estimate the relay -to- destination propagation channel at the destination For this reason we have ... though), and therefore we can calculate the BER also based on this data When we calculate the duty cycle we assume that these symbols were actually carrying payload data The results should be the same ... should be the same as in a case where synchronisation had occurred in a dedicated synchronisation phase The air interface employed for payload data is the same as for AF and DF, that is, 48 symbols,...
... A Real- Time Model -Based Human Motion Tracking and Analysis It can only track the restricted movement of walking human parallel to the image plane Another realtime system, Pfinder [11], starts ... integrator, and one animator Each viewer estimates the partial BDPs from the extracted foreground image and sends the results to the BDP integrator The BDP integrator creates a universal 3D model ... Update partial BDP BAP integrator 1D position identification BDP perspective scaling Human body 2D position estimation 1D position identification BDP perspective scaling Facade/flank arbitrator BAP...
... conventional PCR and real- timePCR for unknown samples Conventional PCRRealtimePCR + Subtotal - + 29 29 - Total +, positive; -, negative 37 Abbreviations bp: base pair; cDNA: complementary DNA; LOD: ... plasmid copy number LOD and LOQ of the assay TaqMan real- timePCR Real- timePCR was carried out on an ABI 7500 thermocycler (Applied Biosystems, CA, USA) with a final volume of 25 μL The real- time ... Primer-1 5’-CGGATATTGTAKTCCTGGTCGTA-3’ Primer-2 5’-CCTGTCCTAGATTCCCCTATTGATT-3’ Probe FAM-5’-CTAGGCCTACGTGGTCTACATTTC-3’-TAMRA Three PCV2-positive samples and 37 serum and tissue unknown samples were...
... likely to produce a false positive than a conventional PCR assay or the SYBR Green I -based real- timePCR TaqMan -based real- timePCR may be more specific than SYBR Green I -based real- timePCR because ... clinical samples by real- timePCR vs conventional PCR Conventional PCR Positive Negative 1 1a 0b 21c 9d Real- timePCR Positive Negative a, d indicate the number of samples that generated similar data ... primers and probe were: NS1-FP (forward primer): 5’-GAAGACTGGATGATGACAGATCCA-3’, NS1-RP (reverse primer): 5’-TGCTGTTTTTGTTCT TGCTAGAGTAA-3’ NS1-P (probe): FAM-AATGATGGCTCAAACCGGAGGAGA-BHQ1 The...
... attachment to CAR, a 46-kDa transmembrane protein that also serves as a receptor for many adenoviruses [17] In addition, some strains of CVB1, and can interact with an additional receptor, DAF, ... viral attachment capacity In this article, we demonstrate that RT -PCR is an alternative, rapid and efficient methodto study viral interaction with the cell surface RTPCR can complement or replace ... be due to the fact that DAF is ten times more abundant than CAR on HeLa cells [38], and that CVB2O previously has been shown to have a significantly slower attachment rate to cells than CVB5...
... D., Sasaki Y., Maruyama T., Yanagisawa E., Hiraishi A and Kato K (2001) Degradation of the cyanobacterial hepatotoxin microcystin by a new bacterium isolated from a hypertrophic lake Environ Toxicol., ... blue-green algae, Microcystis, Anabaena, Oscillatoria and in lake Kasumigaura Environ.Tech., 14, 433-442 Park H.-D., Iwami C., Watanabe M F., Harada K.-I., Okino T and Hayashi H (1998) Temporal variabilities ... Table - Primers and TaqMan Probes used Primer and Probe Sequence (5’-3’) Reference MF MR gacccgatgttcaagatact ctcctcccacaaatcaggac Saito et al., 2003b QMF QMR QMT (Probe) agacgcacgctcacctcaa...
... viral culture and PCR assays are largely negative [15] Several commercially available HSV-type specific serological assays are available, but a test such as a HSV-2 Western blot is expensive and ... directed against λ DNA The performance of the PCR was monitored by quantitative real- timePCR (qPCR) The mean cycle threshold (Ct) and the standard deviation of the controls were calculated Samples ... by EANA, MJH and AN; interpretation and laboratory work was conducted by MJH, EANA, AN, SK and RB; EANA, RLB, SK and MJH were responsible for analysis of results and preparation of the manuscript...
... viral culture and PCR assays are largely negative [15] Several commercially available HSV-type specific serological assays are available, but a test such as a HSV-2 Western blot is expensive and ... directed against λ DNA The performance of the PCR was monitored by quantitative real- timePCR (qPCR) The mean cycle threshold (Ct) and the standard deviation of the controls were calculated Samples ... by EANA, MJH and AN; interpretation and laboratory work was conducted by MJH, EANA, AN, SK and RB; EANA, RLB, SK and MJH were responsible for analysis of results and preparation of the manuscript...
... chiếu: PCR Standard Curve Report with PCR Amp Cycle Graph PCR Base Line Subtracted Data Current Date: Data generated on: 19-Aug-05 12:22 PM 16-Aug-05 at 04:58 PM Optical data file name: Plate Setup ... 35S: PCR Standard Curve Report with PCR Amp Cycle Graph PCR Base Line Subtracted Curve Fit Data Current Date: Data generated on: 19-Aug-05 12:17 PM 16-Aug-05 at 04:58 PM Optical data file name: ... 35S: PCR Standard Curve Report with PCR Amp Cycle Graph PCR Base Line Subtracted Curve Fit Data Current Date: Data generated on: 11-Aug-05 05:04 PM 03-Aug-05 at 09:21 PM Optical data file name:...
... aggccttcgggttgtaaagt gttagccggtgcttcttctg FAM-aaccgcagcaattgacgttaccc-BHQ 1a tgcagaaaattgatgctgct ttgcccaggttggtaatagc JOE-acctgggtgcggtacagaaccgt-BHQ 1a ggtaaaggggcttcggtatc tattggctccctgaatacgc Cy5-tggtggtgtagccactgtcccgt-BHQ 1a ... Although the multiplex real- timePCR assay was demonstrated as an applicable assay in artificially inoculated meats, it needs further research for natural meat cases and other types of food and ... distilled water (Gibco, USA) was then added to adjust toa final volume of 200 μl An aliquot of μl of the supernatant was used as the template DNA in the multiplex real- timePCR iii) QIAamp DNA Mini...
... extracted DNA samples were used for quantitative PCR assays 10 RealTimePCR Assay Real- timePCR targeting the morphologically transforming region mtr II sequence was applied onto the DNA extracted ... Christmas SE, Halliday D, Lawton N, Wang H, Abdalla I, Masters J, Hassan RL, Hart IJ, Khan N, Smith J, Hammad A, Bakran A: Cytomegalovirus -specific CD8+ T cells not develop in all renal transplant ... renal transplant patients was higher (20-60%) compared to western literature [14] A study carried out in southern part of India among renal transplant patients by application of the quantitative...
... 5’-GCCAAAATTCGCAGTCCC-3’, 0.5 μM primer hbv460 (antisense) 5’-GATAGTCCAGAAGAACCAACAAGAAG-3’, 0.4 μM molecular beacon 5’-CG CGCGATGAGGCATAGCAGCAGGATGAAGAACG CGCG-3’ labelled with FAM and Dabcyl at ... RTQ -PCR against the WHO 1st International Standard for HBV -DNA The calibration of the in-house assay was done against the WHO st International Standard for HBV -DNA (OptiQuant® HBV -DNA Quantification ... The calibration of the HBV -DNA values was performed against the WHO 1st International Standard for HBVDNA (OptiQuant® HBV -DNA Quantification Panel, Accrometrix Europe B.V.) Specifically, serial...
... detection and quantification The additional advantage of utilizing SYBR Greenbased real- time RT -PCR is that it is relatively easy to design and test primer pairs that are suitable for RT -PCR analysis ... quantitative measurement, lower contamination rate, higher sensitivity, higher specificity, and easy standardization Thus, quantitative RT -PCR assay might eventually replace virus isolation and ... Level facilities Supernatants were obtained days after virus inoculation and stored at -80°C Viral RNA was extracted (Qiamp viral RNA kit; Qiagen, Germany) from the virus supernatant, titrated...
... 5’-TTGGTTACCATGCAAACAAYT-3’ 91-111 Antisense 5’-TRTCTTGGGCRTGTGTAACA-3 152-171 Probe 119-143 5’-FAM-CAGGTTGACACAATAATGGAAAAGBHQ3-3’ a Y = T or C, R = A or G LNA residues in the probe are indicated ... assay failed to detect virus in a nasal swab and a throat swab (Table 1) This may be due to RNA degradation during long-term storage and multiple freezethaw cycles Tran Tan et al Virology Journal ... influenza virus in Asia: implications for pandemic control Proc Natl Acad Sci USA 2006, 103(8):2845-2850 Li KS, Guan Y, Wang J, Smith GJ, Xu KM, Duan L, Rahardjo AP, Puthavathana P, Buranathai C,...
... CCGGCCCCTGAATGC-3' Genbank: NC_002058.3 (447–461) Reverse primer 5'-ATTGTCACCATAAGCAGCCA-3' Genbank: NC_002058.3 (596–577) 5' CACCGGATGGCCAATCCA-3' Genbank: NC_002058.3 (639–622) Probe FAM 5' AACCGACTACTTTGGGTGTCCGTGTTTC-3' ... AACCGACTACTTTGGGTGTCCGTGTTTC-3' TAMRA Genbank: NC_002058.3 (535–562) ml From each concentration replicates were extracted with both extraction methods and each RNA extract was analysed on both real- timePCR instruments Additionally, ... Poelstra E, Hooghiemstra M, Brandenburg AH: Clinical validation of a new real- timePCR assay for detection of enteroviruses and parechoviruses, and implications for diagnostic procedures Journal...
... CCGGCCCCTGAATGC-3' Genbank: NC_002058.3 (447–461) Reverse primer 5'-ATTGTCACCATAAGCAGCCA-3' Genbank: NC_002058.3 (596–577) 5' CACCGGATGGCCAATCCA-3' Genbank: NC_002058.3 (639–622) Probe FAM 5' AACCGACTACTTTGGGTGTCCGTGTTTC-3' ... AACCGACTACTTTGGGTGTCCGTGTTTC-3' TAMRA Genbank: NC_002058.3 (535–562) ml From each concentration replicates were extracted with both extraction methods and each RNA extract was analysed on both real- timePCR instruments Additionally, ... Poelstra E, Hooghiemstra M, Brandenburg AH: Clinical validation of a new real- timePCR assay for detection of enteroviruses and parechoviruses, and implications for diagnostic procedures Journal...