1 h nmr spectrum of a mixture of common nondeuterated solvents
Báo cáo khoa học: Characterization of oligosaccharides from the chondroitin/dermatan sulfates 1 H-NMR and 13 C-NMR studies of reduced trisaccharides and hexasaccharides doc
... (p.p.m.) DUA (F) H1 H2 H3 H4 H1 H2 H3 H4 H5 H6 H6 ¢ NAc H1 H2 H3 H4 H5 H1 H2 H3 H4 H5 H6 H6 ¢ NAc H1 H2 H3 H4 H5 H1 H1 ¢ H2 H3 H4 H5 H6 H6 ¢ NAc 5 .19 3* 3.796* 4 .10 8* 5.885* 4.593 4.027 3.949 4 .17 6 3.996 ... 4.4 51* 4. 013 * 3.677 3.677 2.037* GalNAc (E) Hexasaccharides Although data from disaccharides, trisaccharides and tetrasaccharides are valuable for the detailed structural characterizations of ... Appearance and fate of a beta- 13 14 15 16 17 18 19 20 21 22 23 galactanase, alpha, beta-galactosidases, heparan sulfate and chondroitin sulfate degrading enzymes during embryonic development of the...
- 11
- 481
- 0
Báo cáo khoa học: Structural function of C-terminal amidation of endomorphin Conformational comparison ofl-selective endomorphin-2 with its C-terminal free acid, studied by 1 H-NMR spectroscopy, molecular calculation, and X-ray crystallography pot
... EM2OH Tyr1 a Tyr1 2, 6H Tyr1 3, 5H Phe3 b2 Phe3 NH Pro2 d1 Pro2 a Phe4 NH Weak Weak Weak Weak Tyr1 b1 Phe3 3, 5H Phe4 a Phe4 a Tyr1 b1 Tyr1 b2 Pro2 c2 Pro2 d2 Phe4 a C-NH1 C-NH2 Pro2 a Pro2 a Phe3 ... Pro2 b1 Pro2 c1 Pro2 c1 Phe3 a Phe3 a Phe3 b2 Phe4 Phe4 Phe4 Phe4 Phe4 Phe4 Phe4 2, 6H 3, 5H 2, 6H 3, 5H b2 2, 6H NH Weak Weak Weak Weak Weak Medium Weak Tyr1 2, 6H Phe3 2, 6H Phe3 2, 6H Phe3 2, 6H Phe3 ... 2 .19 1. 93 2. 01 2 .16 1. 87 1. 90 15 4 15 5 15 4 15 7 14 6 17 4 16 5 15 8 14 8 13 9 13 9 16 7 14 8 16 7 17 3 17 2 16 2 13 8 14 5 16 4 15 6 14 6 17 0 16 4 x,y,z x +1, y,z x +1, y,z 1- x,y +1 ⁄ 2,-z x,y,z x,y,z x,y,z x,y,z x -1, y,z...
- 19
- 314
- 0
Báo cáo khoa học: H NMR study of the molecular structure and magnetic properties of the active site for the cyanomet complex of O2-avid hemoglobin from the trematode Paramphistomum epiclitum pdf
... dDSS(dia) Tyr32(B10) NH CaH CbHÂ CbH CdHs CeHs OH NH CaH CbHs CdHs CeHs CfH NH CaH CbH CdHs CeHs NH CaH CbH CdH NH CaH CbH CdHs CeHs CfH NH CaH CbH CbHÂ CdHs CeHs OH NH CaH CbH3 NH CaH CbH CcH3 NH ... NH CaH CbH CbHÂ NdH NH CaH CbH CcH3 NH CaH CbH CcH3 CcH3Â NH CaH CbH CbH CdHs CfH NH CaH CaHÂ NH CbH CbHÂ CdHs CeHs CfH NH CaH CbH CdHs CeHs CfH NH CaH CbHs CcH CeH3 CaH CbH CcHs CcHÂ CdH3 3.25 ... Thr99(FG1) Val103(FG5) Phe108(G5) Gly 111 (G8) Phe 115 (G12) Phe140 (H1 6) Met143 (H1 9) Ile147 (H2 3) Proton dDSS(obs) dDSS(dia) CbHÂ CdHs CeHs NH CaH CaHÂ NH CaH CbH CcHs CdHs CeHs NH CaH CbH CbHÂ NH...
- 14
- 504
- 0
Báo cáo khoa học: Detergent-resistant membrane fractions contribute to the total 1 H NMR-visible lipid signal in cell potx
... there was a marked increase in the amount of 16 :0 and a decrease in the amount of 16 :1 and 17 :1 in the lipid droplet fraction (Table 2) The fatty acid analyses of fractions taken from blank gradients ... of palmitic, stearic and oleic acids (16 :0, 18 :0, 18 :1, respectively) The DSM fractions contained higher levels of 18 :0, 18 :2 + 18 :3 and 18 :1 at the expense of 16 :0, 14 :0 and 16 :1, whereas there ... with
- 10
- 394
- 0
Báo cáo khoa học: Phenylalanine-independent biosynthesis of 1,3,5,8-tetrahydroxyxanthone A retrobiosynthetic NMR study with root cultures of Swertia chirata docx
... coupling satellites in the 1H- NMR spectra As an Fig 13 C -NMR spectrum of 1, 3,5,8-tetrahydroxyxanthone (A) Spectrum of a sample with natural 13 C abundance; (B) spectrum of a sample from the experiment ... 7) 15 .5(5, 7), 45.2(7) 11 .2(8), 56.8(6, 8) 65.8(7) 19 .6(4b), 63.3(4b, 9) 60.2( 4a, 1) 56.4( 8a) 1. 5 6.2d 1. 5 1. 4 7.2 6.0 1. 9 1. 6 1. 2 1. 1 1. 2 1. 2 1. 3 1. 0 1. 2 1. 1 1. 1 4.6 1. 2 5.5 1. 5 1. 0d 1. 1 1. 1 1. 1 ... plants [1, 2] The side chain reflects the labelling pattern of phosphoenolpyruvate from which it is biosynthetically obtained via the shikimate pathway of aromatic amino-acid biosynthesis (Fig 1) ...
- 9
- 464
- 0
Báo cáo khoa học: Total chemical synthesis and NMR characterization of the glycopeptide tx5a, a heavily post-translationally modified conotoxin, reveals that the glycan structure is a-D-Gal-(1fi3)-a-D-GalNAc pot
... GalNAc :H1 GalNAc:CH3 GalNAc :H3 GalNAc :H1 Gal :H2 Gal :H2 4.79 1. 79 3.77 4.79 3.53 3.53 10 ThrcCH3 12 AlaaH 10 ThrcCH3 10 ThrbH 11 AlaßCH3 12 AlaaH 0.98 4.07 0.98 4.04 1. 09 4.07 anomeric proton of Gal, ... Figs and Chemical shift (p.p.m.) Proton ( 1H) Chemical shift (p.p.m.) Disaccharide: Gal-GalNAc Proton ( 1H) GalNAc :H1 GalNAc :H3 GalNAc :H3 Gal :H1 Gal :H1 Gal :H2 GalNAc:CH3 GalNAc:CH3 GalNAc:CH3 4.79 ... 3.53 1. 79 1. 79 1. 79 GalNAc :H2 GalNAc :H2 Gal :H1 Gal :H2 Gal :H3 Gal :H4 Gal :H2 Gal :H3 Gal :H4 3.95 3.95 4.82 3.53 3.43 3.72 3.53 3.43 3.72 Proton ( 1H) Chemical shift (p.p.m.) Proton ( 1H) Chemical shift...
- 11
- 563
- 0
Tài liệu A Mixture of Genius pptx
... the next three years After all, it might have been far worse It might have happened in a campaign year This way he still had a fighting chance Three sessions with a good record might overbalance ... a suit coat from a hanger and left the office with it under his arm A moment later the door opened again and the senator saw the shaggy head of his older son peer into the room The boy was the ... to have evolved a particularly deadly strain of bacteria, which he had been toting around with him in an aspirin bottle," Ambly went on, his thin hands clasped tightly in front of him 14 "Of...
- 22
- 375
- 0
Tài liệu Báo cáo khoa học: Solution NMR structure of five representative glycosylated polyene macrolide antibiotics with a sterol-dependent antifungal activity doc
... H1 4-C14–C15 H1 5 H1 5–C15–C16 H1 6eq H1 6ax.–C16–C17 H1 7 H1 7–C17–C18 H1 8 JH 11- H1 2ax JH17 H1 8eq JH18ax H1 9 JH19 H2 0 JH33 H3 4 JH34 H3 5 JH12ax. H1 3 JH13 H1 4 JH14 H1 5 JH15 H1 6eq JH16ax. H1 7 JH17 H1 8 rimocidin a ... nystatin A1 Angle applied for the calculation H 11 C 11 C12 H1 2ax H1 7–C17–C18 H1 8eq H1 8ax.–C18–C19 H1 9 H1 9–C19–C20 H2 0 H3 3–C33–C34 H3 4 H3 4–C34–C35 H3 5 H1 2ax.–C12–C13 H1 3 H1 3–C13–C14 H1 4 H1 4-C14–C15 H1 5 ... 78.4 13 6.9 13 4.6 13 3.4 13 4.3 13 2.3 39.7 74.8 38.5 19 .7 14 .4 98.9 69.0 57.3 70.8 74.8 17 .9 H1 3e H1 3c H1 5c H1 6axe, H1 6eqc H1 8d, H1 ¢e, H2 ¢e H1 ¢c H1 8d, H1 9c H2 6d, H2 7d H2 6d, H2 7c H2 7¢¢¢e H3 ¢c, H5 ¢c H6 ¢d...
- 9
- 522
- 0
Báo cáo khoa học: Death inducer obliterator protein 1 in the context of DNA regulation Sequence analyses of distant homologues point to a novel functional role docx
... 0.75 are shown Black geometrical shapes are additional domains, as indicated ANOGA, Anopheles gambiae; ASHGOS, Ashbya gossypii; BRARE, Brachydanio rerio; CANDGLA, Candida glabrata; CIONA, Ciona ... Flodin A & Skalnik DG (2000) Cloning of a mammalian transcriptional activator that binds unmethylated CpG motifs and shares a CXXC domain with DNA methyltransferase, human trithorax, and methyl-CpG ... glioblastoma multiforme Oncogene 20, 410 7– 411 4 19 Peters AH, O’Carroll D, Scherthan H, Mechtler K, Sauer S, Schofer C, Weipoltshammer K, Pagani M, Lachner M, Kohlmaier A et al (20 01) Loss of the Suv39h...
- 7
- 658
- 0
Báo cáo khoa học: Specific degradation of H. pylori urease by a catalytic antibody light chain pptx
... Catalytic features of anti-HpU-9 mAb light chain light and ⁄ or heavy chains from mAbs such as i 41 7 [13 ], i41SL1-2 [14 ], and ECL2B [15 ] The light chain of ECL2B mAb was capable of cleaving a ... show any catalytic activity in this analysis, which confirmed the result that had previously been reported [9 ,11 ,13 15 ] The isolated heavy Catalytic features of anti-HpU-9 mAb light chain chain ... the whole antibody However, not all of the isolated heavy or light chains change their specificity In the case of HpU -17 and )20 mAb (a series of mAbs obtained along with HpU-9) [17 ], their heavy...
- 9
- 388
- 0
Báo cáo khoa học: In situ proton NMR analysis of a-alkynoate biotransformations ppt
... to acetaldehyde The latter was dehydrogenated to acetate, whereas the 3-ketopropanoate was hydrated to 3-hydroxypropanoate Fig Selected 1H- NMR spectra from propynoate metabolism (A) Spectrum of ... with a 5-mm broadband probe head For a lock a D2O vortex capillary was added to the NMR tube to avoid 1H/ D exchange reactions During measurements the tube was rotated at 20 rev.Æs )1 The huge water ... mM acetaldehyde to this biotransformation in 50% D2O caused an 10 % higher amount of hydrogen in the acetate, as it is formed directly from the acetaldehyde The incorporation of a higher hydrogen...
- 6
- 360
- 0
Báo cáo Y học: Mechanism of 1,4-dehydrogenation catalyzed by a fatty acid (1,4)-desaturase of Calendula officinalis pptx
... 11 (Z)- tetradecenoate to 10 (E) ,12 (E)-tetradecadienoate by initial H- abstraction at C10 and 11 (E)-tetradecenoate to 9(Z) ,11 (E)-tetradecadienoate by initial oxidative attack at C9 [39] Whether these ... and methyl esterification The overall yields of [8,8 2H2 ] -1 and [11 ,11 - 2H2 ] -1 obtained via these procedures was 5% and 14 %, respectively Purification of substrates was carried out by flash chromatography ... mL) of the pYJ/DTY1 0a2 strain of S cerevisiae incubated at 20 °C for days to permit relatively rapid growth and then at 15 °C for a further days to reach saturation at a temperature which has been...
- 6
- 341
- 0
Báo cáo khoa học: NMR investigations of subunit c of the ATP synthase from Propionigenium modestum in chloroform/methanol/water (4 : 4 : 1) pot
... resonances of aliphatic side chains were achieved by 3D 15 N-resolved [ 1H, 1H] -TOCSY and 3D 15 Nresolved [ 1H, 1H] -NOESY Furthermore, homonuclear 2D [ 1H, 1H] -TOCSY and 2D [ 1H, 1H] -NOESY spectra were used to assign ... S.W., Torchia, D .A & Bax, A (19 89) Three-dimensional heteronuclear NMR of 15 N-labeled proteins J Am Chem Soc 11 1, 15 15 15 17 Bax, A. , Clore, G.M & Gronenborn, A. M (19 90) 1H- 1H correlation via isotropic ... if d is a part of the stator that links the F1 and F0 parts of the Escherichia coli ATP synthase J Biol Chem 272, 16 652 16 656 18 Bottcher, B., Schwarz, L & Graber, P (19 98) Direct indication for...
- 5
- 462
- 0
Báo cáo khoa học: Solution structure of long neurotoxin NTX-1 from the venom of Naja naja oxiana by 2D-NMR spectroscopy pot
... A & Saenger, W (19 91) The refined crystal structure of a- cobratoxin 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 ˚ from Naja naja siamensis at the 2.4 A resolution J Biol Chem 266, 215 30– 215 36 ... to that of the a- cobratoxin crystal The superposition of these two ˚ structures shows an RMSD value of 3.00 A for all ˚ backbone atoms which reduces to 1. 4 A when the C-terminal tail and the tip ... [42] have found that the overall net charge of neurotoxins affects the toxin–receptor interactions Particularly, it should be noted that NTX -1 and LSIII have a net charge of +1 in comparison with...
- 8
- 411
- 0
Báo cáo khoa học: The C-terminal region of the proprotein convertase 1⁄ 3 (PC1⁄ 3) exerts a bimodal regulation of the enzyme activity in vitro pdf
... virus capsid protein Biochemistry 43, 9989–9998 3490 30 Matsuura K, Tamada Y, Deyashiki Y, Miyabe Y, Nakanishi M, Ohya I & Hara A (19 96) Activation of human liver alpha-hydroxysteroid dehydrogenase ... sulphobromophthalein Biochem J 313 , 17 9– 18 4 31 Noriega GO, Juknat AA & Batlle AM (19 92) Non-essential activation of rat liver porphobilinogendeaminase by folic acid Z Naturforsch [C] 47, 416 – 419 ... activation may thus be the consequence of an enhanced stability of the 66 kDa form The CT-peptide is not cleaved by enzymatically active PC1 ⁄ Another important feature of an enzymatic activator...
- 10
- 305
- 0
Báo cáo Y học: Conformational analysis by CD and NMR spectroscopy of a peptide encompassing the amphipathic domain of YopD from Yersinia potx
... fragment using the primer combination of plcrH10: 5¢-CGAGGTACATATGCAACAAGAGACG-3¢ and plcrH 11: 5¢-ACGTACAGATCTCCTTGTCGTCGTCGT CTGGGTTATCAACGCACTC-3¢ This fragment was then cloned into the expression ... nickel-nitrilotriacetic acid slurry (Qiagen) was added, followed by a 1- h incubation at °C on a rotary shaker The sample was then loaded on a Poly Prep chromatography column (Bio-Rad, CA, USA) and each subsequent ... molar ratio of : The appropriate pH was corrected by the addition of small aliquots of HCl and NaOH NMR Ó FEBS 2002 Tertiary structure of the YopD amphipathic domain (Eur J Biochem 269) 36 61 experiments...
- 10
- 447
- 0
Báo cáo Y học: NMR structure of the HIV-1 regulatory protein Vpr in H2O/trifluoroethanol Comparison with the Vpr N-terminal (1–51) and C-terminal (52–96) domains pot
... [36,37] The first a helix (Asp17–His33) has the characteristics of an amphipathic helix (Fig 7I) Its hydrophilic face is formed by the amino acid side chains: Asp17, Glu 21, Glu24, Glu25, Lys27, Asn28, ... 2. 6H Tyr50 3. 5H Tyr50 b1 Tyr50 b2 Tyr50 b1 Tyr50 b2 Tyr50 b1 Tyr47 b2 Tyr47 3. 5H Tyr47 3. 5H Tyr47 cH Thr55 cH Thr55 a1 Gly56 a1 Gly56 a2 Gly56 a2 Gly56 a Ala59 a Ala59 b Ala59 b Ala59 a1 Gly56 a1 ... maxima at 19 0 and 212 nm (Fig 1) This result suggests that Vpr possess a high a helical content [34,36,42] It is also important to note that TFE can stabilize a helices in regions that have already...
- 10
- 475
- 0
báo cáo hóa học: " A case study on co-exposure to a mixture of organic solvents in a Tunisian adhesive-producing company" potx
... on the main modifications which had been taking place overtime, both at the technical level (change of machines, aspiration and ventilation of the buildings, ) and regarding the nature of solvents ... solvented Adhesive Page of Workshop of the Natural Adhesive Surface: 12 9.37 m2 Number of workers: Number of stations: - Manufacture of the Natural adhesive - Conditioning of Natural adhesive Surface: ... workshop of the dissolved adhesive, in the control laboratory and in the storage halls of the finished products were greater than the TLVs (indexes are above 1; Table 4) Higher concentrations of hexane...
- 8
- 641
- 0
Báo cáo hóa học: " The product of the Herpes simplex virus 1 UL7 gene interacts with a mitochondrial protein, adenine nucleotide translocator 2" pot
... AGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTCGACAGCAAGCGAACCGGAAT-3' GAAGTTCCTATACTTTCTAGAGAATAGGAACTTCCGGAAATGTTGAATACTCA TACTCTTCCTTTTTC-3' The linear PCR-generated fragments were electroporated into YEbac102, an E coli DH10B ... for UL8; and 18 S rRNA-f (5'-actcaacacgggaaacctca-3') and 18 S rRNA-r (5'-aaccagacaaatcgctccac-3') for 18 S rRNA Reactions were performed using SYBER Premix Ex Taq II (Takara) with the Thermal Cycler ... (B) Autoradiographic images of electrophoretically separated BamHI and HindIII digests of YK304 (lane 1) , MT102 (lane 2), and MT103 (lane 3) DNAs hybridized to the radiolabeled DNA fragment of HSV(F)...
- 13
- 463
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008