1 size and position a graphic element
Tài liệu Báo cáo khoa học: Mutational analysis of plasminogen activator inhibitor-1 Interactions of a-helix F and its neighbouring structural elements regulates the activity and the rate of latency transition pdf
... T9 6A F10 0A V12 6A F12 8A S12 9A E13 0A V13 1A E13 2A R13 3A R13 5A F13 6A I13 7A I13 8A N13 9A D14 0A W14 1A V14 2A K14 3A T14 4A H14 5A T14 6A K14 7A M14 9A N15 2A E28 3A E28 5A K32 5A K32 7A PAI-1stab PAI-1stab(E28 5A) ... rate of latency transition expressed as the functional half-life, t½ The averages and standard deviations for at least three independent measurements are given for each variant PAI-1 variant Activity ... indistinguishable results: wild-type, PAI-1(T9 6A) , PAI1(F10 0A) , PAI-1(V12 6A) , PAI-1(F12 8A) , PAI-1(I13 7A) , PAI-1(I13 8A) , PAI-1(N13 9A) , PAI-1(W14 1A) , PAI1(T14 6A) and PAI-1(M149K) Structural analysis...
- 9
- 605
- 0
Báo cáo khoa học: Expression of the Drosophila melanogaster ATP synthase a subunit gene is regulated by a transcriptional element containing GAF and Adf-1 binding sites pptx
... downstream of transcriptional initiation sites in Drosophila promoters include ACGT, ACAA, ACAG, and AACA [32], and these were detected at )17, )18, )36 and )103 positions of the a- F1-ATPase gene (position ... by PCR from total DNA using the primers pADm1 (forward; 5¢-AGCAGTCGACGA AGCGACGAAGTGAAGCTGCGTGA-3¢) and pADm3 (reverse; 5¢-ATCCGTCGACATGCTTTTTAACTGTT CG-3¢) After digestion with SalI (which recognizes ... essential for promoter activity is boxed, and the GAGA and Adf-1 elements in the DNA are underlined The translation start codon and the main transcription start point are larger and in bold (B) Mutations...
- 11
- 532
- 0
Báo cáo khoa học: A structured RNA in hepatitis B virus post-transcriptional regulatory element represses alternative splicing in a sequence-independent and position-dependent manner pot
... unspliced pgRNA and the SP1 splicing variant of HBV, primers SP1 (tgcccctatcctatcaacac), SP2 (actcccataggaattttccgaaa) and U2 (ttccaatgaggattaaagacag) were used Quantification of the splicing ratio by ... analysis of the fragments of the 5¢ end labeled and folded PRE-ISS wild-type RNA, which was cleaved by RNase T1, RNase V1 and RNase A The T1 seq and A seq lanes represent RNase T1 and RNase A ... conservation in 52 HBV genomes was calculated and the graphic representation was created by WebLogo [47] The HP1 and HP2 regions are indicated, with stems being marked by cyan bars and the RNase-accessible...
- 14
- 379
- 0
báo cáo hóa học:" Can medio-lateral baseplate position and load sharing induce asymptomatic local bone resorption of the proximal tibia? A finite element study" pot
... interfacial ROI plotted versus load share (a) and baseplate position (b) Average6 Average VonMises stresses in the interfacial ROI plotted versus load share (a) and baseplate position (b) A 0% lateral ... and positioning (b) Average7 Average VonMises stresses in the lateral ROI plotted versus load share (a) and positioning (b) A 0% lateral share means that the entire load was applied on the medial ... (b) A 0% lateral share means that the entire load was applied on the medial area A negative baseplate positioning means a shift of the component towards the lateral side Page of 15 (page number...
- 15
- 283
- 0
Unit 8 Out and About A 1 -A 3
... book Ask and answer What is she doing? She is driving her car Ask and answer What are they doing? They are driving a car Ask and answer What is he doing? He is riding his motorbike Ask and answer ... Ask and answer What is he doing? He is riding his bike What is she doing? She is waiting for a train Ask and answer What is he doing? He is watching Tv Ask and answer What is he doing? He is reading ... school We are travelling to school by bus They are travelling to school by bus We are waiting for a train They are waiting for a train Ask and answer What is he doing? He is ing… What is she doing?...
- 46
- 477
- 0
Implementing and Administering a Microsoft Windows 2000 Network Infrastructure Exam 70-216 Edition 1
... organization should install a stand-alone CA As with Enterprise CAs, there can be only one standalone CA per hierarchy, but multiple Stand-Alone CAs can exist All other CAs in a hierarchy are ... stand-alone subordinate CAs or enterprise subordinate CAs A stand-alone CA has a simple default policy module It does not store any information remotely Installing a Stand-Alone Subordinate CA ... Local Area Connection 51 Your company has a main office in Orlando and branch office locations in Miami, Tampa and Jacksonville The branch offices are connected to Orlando by Windows 2000 based...
- 69
- 469
- 0
iec 60298 a.c. metal-enclosed switchgear and controlgear for rated voltages above 1 kv and up to
... Sub-clauses 4.2 and 4.2.1 of I E C 694 For metal-enclosed switchgear and controlgear the rated withstand voltage values, based on current practice in Canada and the United States of America, are ... the relevant standard The nameplates of eachfunctionalunitshall belegible duringnormal service The removable parts, if any, shallhaveaseparatenameplatewiththe data relating to the functional units ... and also in any intermediate position Add at the end the following new paragraph: The metallic parts of a removable part which are normally earthedshall remain earthconnected until the removable...
- 139
- 465
- 0
Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf
... AGTAAGGAAAATAAGCTTGGGCATGATCCC GCTCACTGCCTAAGCTTTGTAGCTAATAAAG CTTTATTAGCTACAAAGCTTAGGCAGTGAGC CTTTGTTATTTATTATGCATTCCTATGGTGAGTT AACTCACCATAGGAATGCATAATAAATAACAAAG CTTTGTTAAAGCTTATGCATTCCTATGGTGAGTT AACTCACCATAGGAATGCATAAGCTTTAACAAAG ... SJS170 ALS030 SJS209 SJS275 SJS276 CGGAAGATCTAACTAAGCGTGCTGCTTC TACGAGATCTGTTGTTTGGAAGCAGGTT CGGAAGATCTGGGATCATGCCCATTTAG TACGAGATCTTAGCTACATTAAATAGGC GGGATCATGCCCAAGCTTATTTTCCTTACT AGTAAGGAAAATAAGCTTGGGCATGATCCC ... AACTCACCATAGGAATGCATAAGCTTTAACAAAG CCTCTTACACTTGCTTTTGAC GCAAAGGTGCCTTTGAGGTTG GACCCCTTCATTGACCTCAACTA CTTGATTTTGGAGGGATCTC TTAGCTACATTAAATAGGCAG GtaatacgactcactataGGGATCATGCCCATTTAG Forward (nt 1281–1298...
- 14
- 635
- 0
Tài liệu Báo cáo khoa học: Golgi reassembly stacking protein 55 interacts with membrane-type (MT) 1-matrix metalloprotease (MMP) and furin and plays a role in the activation of the MT1-MMP zymogen pdf
... transfected with pCDNA3.1 Zeo+ and MT1/MYC (lane 2), pCDNA3.1 Zeo+ and GRASP55F (lane 3) and MT1/MYC and GRASP55F (lane 4) were immunoprecipitated with the FLAG M2 monoclonal antibody and the associated ... Zeo+ and MT1/ MYC (lane 1), pCDNA3.1 Zeo+ and GRASP55F (lane 2), pCDNA3.1 Zeo+ and MT1 LLY/MYC (lane 3), GRASP55F and MT1 LLY/MYC (lane 4) and GRASP55F and MT1/MYC (lane 5) were immunoprecipitated ... permeabilized and stained with polyclonal antibodies against furin and GRASP55 Arrows show examples of membrane compartment containing GRASP55 and furin Scale bar = 10 lm C GRASP55 Furin contrast,...
- 18
- 603
- 0
Tài liệu Báo cáo khoa học: The crystal structure of human a-amino-b-carboxymuconatee-semialdehyde decarboxylase in complex with 1,3-dihydroxyacetonephosphate suggests a regulatory link between NAD synthesis and glycolysis ppt
... a- amino-b-carboxymuconate-e-semialdehyde decarboxylase J Am Chem Soc 129, 9278–9279 Fukuoka SI, Ishiguro K, Yanagihara K, Tanabe A, Egashira Y, Sanada H & Shibata K (2002) Identification and expression of a cDNA encoding human 6622 ... potential interest to reduce life-threatening complications of cerebral malaria, and as an important tool in validating our proposal of hACMSD as a novel drug target for the treatment of diabetes and ... tryptophan catabolism along the kynurenine pathway, and is a medically relevant enzyme in light of the important roles played by QA and PA in physiological and pathological conditions Indeed, QA is...
- 9
- 796
- 0
Báo cáo khoa học: Estrogen-related receptor a and PGC-1-related coactivator constitute a novel complex mediating the biogenesis of functional mitochondria potx
... synthase subunit b: 5¢-CCTTCTGCTGTGGGCTATCA-3¢ and 5¢TCAAGTCATCAGCAGGCACA-3¢; ND5: 5¢-TAACCCC ACCCTACTAAACC-3¢ and 5¢-GATTATGGGCGTTGA TTAGTAG-3¢; b-globin: 5¢-CAACTTCATCCACGTTCA CC-3¢ and 5¢-ACACAACTGTGTTCACTAGC-3¢ ... 5¢-AAGACAGCAGCCCCAGTGAA-3¢ and 5¢-ACACCCAGCACCAGCACCT-3¢; PRC: 5¢-CACTGG TTGACCCTGTTCCT-3¢ and 5¢-GTGTTTCAGGGCTTC TCTGC-3¢; Cyt c: 5¢-CCAGTGCCACACCGTTGAA-3¢ and 5¢-TCCCCAGATGATGCCTTTGTT-3¢; ATP ... quantification was performed by nonsaturating picture scanning by a gel Doc 1000 Molecular Analyst apparatus (Biorad) Respiratory parameters and respiratory ratio in intact cells Respiratory parameters and...
- 13
- 503
- 0
MICROECONOMICSPrinciples and AnalysisFrank A. CowellSTICERD and Department of Economics London School of Economics December 2004.ii.ContentsContents List of Tables List of Figures Preface 1 Introduction 1.1 The rôle of microeconomic principles . potx
... are a lot of rules-of-thumb, standard analytical procedures and simple theorems that can be applied again and again to apparently dissimilar economic problems The student of microeconomics can ... mathematics as well as brushing up on particular technical points Take an ordinary pencil with a sharpened point and place it on a ‡at table How many equilibria does it have? Which of them are ... that leave a trace of a process The comparative statics method is sometimes incorporated into speci…c relationships that are used as a shorthand to characterise the behaviour of an economic agent...
- 668
- 5,134
- 0
Sexual and reproductive health and rights: A position paper pptx
... strategies, protocols and curricula for safe abortion services and postabortion care, and adapting communication and monitoring and evaluation strategies Policy analysis has been an essential ... Sexual and reproductive ill health has major social, cultural, political and legal determinants and consequences that also need to be addressed in other ways Taboos and norms about sexuality and ... for sexual and reproductive health through our country programmes and partnerships and through support to international agencies Our annual bilateral investment in HIV and AIDS and sexual and reproductive...
- 30
- 267
- 0
Báo cáo khoa học: Ki-1⁄57 interacts with PRMT1 and is a substrate for arginine methylation pptx
... Functional association of Ki-1 ⁄ 57 and PRMT1 D O Passos et al Preparation of cytoplasmic and nuclear extracts, methylation assays with cellular Ki-1 ⁄ 57 and metabolic labeling Carlos H I Ramos and ... Identification and characterization of two putative human arginine methyltransferases (HRMT1L1 and HRMT1L2) Genomics 48, 330–340 Yanagida M, Hayano T, Yamauchi Y, Shinkawa T, Natsume T, Isobe T & Takahashi ... lyzed and fractionated in nuclear (lanes and 4) and cytoplasmic (lanes and 3) fractions Ki-1 ⁄ 57 was immunoprecipitated (lanes 1–4) and then submitted to methylation by PRMT1 in vitro As a negative...
- 16
- 367
- 0
Family Life, Reproductive Health, and Population Education: Key Elements of a Health-Promoting School docx
... the availability of trained staff, and the capacity to plan and evaluate efforts Knowing this information allows the team to draw on available personnel and financial resources and set reachable ... (CDC), Atlanta, USA Paula Morgan Centers for Disease Control and Prevention (CDC), Atlanta, USA Naomi Nhiwatiwa World Health Organization (WHO)/Regional Office for Africa, Harare, Zimbabwe Shanti ... for family life, reproductive health, and population education are many and the benefits are great, advocates may still have to explain the background and advantage of these programs For example:...
- 90
- 469
- 0
Báo cáo khoa học: Theoretical study of lipid biosynthesis in wild-type Escherichia coli and in a protoplast-type L-form using elementary flux mode analysis potx
... FabD, FabH_2, FabB_3, and AccACD In this cycle, acetyl-CoA is carboxylated (driven by ATP hydrolysis) and decarboxylated again (Fig 2) The remaining EFMs are capable of producing all of the main ... knockouts, and comparison with in vivo viability data from the Keio collection Deficiency AccACD CdsA Cls FabA FabB FabD FabF FabG FabH FabI FabZ GpsA GutQ KdsA KdsB KdsC KdsD Lipid A Lipid A (ca) x ... elongation of unsaturated fatty acids, and a knockout might result in overproduction of saturated fatty acids and reduced production of unsaturated fatty acids by FabA, leading to the lethality...
- 12
- 553
- 0
Báo cáo khoa học: Platination of telomeric sequences and nuclease hypersensitive elements of human c-myc and PDGF-A promoters and their ability to form G-quadruplexes Viktor Viglasky potx
... whereas antiparallel G4 structures, such as basket and chair forms, show two positive bands at approximately 295 and 240 nm and a negative band at approximately 260 nm These spectral features are ... to three averaged scans taken at 20 °C and is baseline corrected for signal contribution due to the buffer give a positive band at approximately 263 nm and a negative band at approximately 240 ... Slovaˇ (Fisher Slovakia, Levoca, Slovakia) T4 polynucleotide kinase was purchased from Promega (Madison, WI, USA) [c-32P]ATP was purchased from Amersham (Arlington Heights, IL, USA) Cisplatin and...
- 9
- 324
- 0
Báo cáo khoa học: Barley polyamine oxidase isoforms 1 and 2, a peculiar case of gene duplication docx
... RPS12 -A, reverse 5¢-ATTCTTCACCATAGTCCT-3¢, RPS12-B, forward 5¢-GTGAGCCAATGGACTTGATG-3¢ and RPS12-C, reverse 5¢-ATGCAAGAGCAGCCTAC AAC-3¢ [4] HvPAO2 promoter isolation Barley DNA was extracted and ... HvPAO1 cDNA: HvPAO1cdna-DIR, 5¢-CATATGGCCGGCCCCAGGGTCATCATC-3¢ and HvPAO1cdna-REV, 5¢-CTGGAACTCGAGCTAGTCAA ACTTGCCCGG-3¢, respectively The amplified PCR product was restricted by NdeI and XhoI and ... Cerealicoltura, Sezione di Fiorenzuola d’Arda, Italy’ Seeds of barley cultivar Aura and of maize (Z mays) cultivar Corona (Monsanto Agricoltura, Italy) were soaked for 12 h in aerated tap water,...
- 13
- 413
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25