1 preparing to use rman to create a standby database
Tài liệu Concepts and Administration pptx
... Similar to a primary database, a standby database can be either a single-instance Oracle database or an Oracle Real Application Clusters database A standby database can be either a physical standby ... Primary Database and a Logical Standby Database 10-4 Primary and Logical Standby Databases After a Role Transition 10-6 Configuring a Primary Database with Physical and Logical Standby Databases ... or standby databases See Also: Oracle Data Guard Broker s Dynamically Add Standby Databases to Real Applications Clusters It is now possible to dynamically add a standby database to a Data Guard...
- 474
- 1,318
- 1
Tài liệu Module 5: Creating a Security Design for Physical Resources pdf
... natural disasters such as tornados and hurricanes, and disasters caused by people such as unintentional or accidental acts, and intentional acts like vandalism and terrorism To plan for disaster ... the room and extract an account database from a server by using a boot startup disk or CD The attacker could then perform a brute force attack on the password hashes in the database and access ... using or maintaining: Off-site storage of backup media Storing backups of your critical data offsite protects your data if a disaster damages or destroys the data at your primary facility Spare servers...
- 24
- 417
- 0
4 Creating a Configuration and Physical Standby Database by Using Enterprise Manager
... primary database: SQL> ALTER DATABASE FORCE LOGGING; 4-3 Copyright © 2006, Oracle All rights reserved Using Enterprise Manager to Create a Broker Configuration • Use the Add Standby Database ... Wizard to: – Create a broker configuration – Add a database to a broker configuration • Primary database must be started with an SPFILE 4-5 Copyright © 2006, Oracle All rights reserved Creating ... Creating a Configuration Click “Add Standby Database to start the wizard 4-6 Copyright © 2006, Oracle All rights reserved Using the Add Standby Database Wizard 4-8 Copyright © 2006, Oracle All rights...
- 24
- 397
- 0
Tài liệu Creating a Logical Standby Database by Using Enterprise Manager ppt
... Logical Standby Database • Configure the database guard to control user access to tables • ALTER DATABASE GUARD command keywords: – ALL: prevents users from making changes to any data in the database ... VIEW LOG ALTER SYSTEM CREATE CONTROL FILE CREATE DATABASE CREATE DATABASE LINK CREATE PFILE FROM SPFILE CREATE SCHEMA AUTHORIZATION CREATE MATERIALIZED VIEW CREATE MATERIALIZED VIEW LOG CREATE SPFILE ... set to ALL by broker automatically on the logical standby database • Database guard level applies to all users except SYS 7-5 Copyright © 2006, Oracle All rights reserved Preparing to Create a...
- 29
- 496
- 0
Báo cáo y học: " A Novel Variable Number of Tandem Repeat of the Natriuretic Peptide Precursor B gene’s 5’-Flanking Region is Associated with Essential Hypertension among Japanese Females"
... 5’-AAGGAGGCACTGGGAGAGGGGAAAT-3’ (bases -1323 to -1299) and antisense, 5’CCCCACCAAGCCAACACAGGATGGA -3’ (bases -919 to- 895) were used to amplify a 429-bp product from genomic DNA (Fig 1A) The PCR products ... 1145-9 Tamura N, Ogawa Y, Chusho H, et al Cardiac fibrosis in mice lacking brain natriuretic peptide Proc Natl Acad Sci USA 2000; 97: 4239-44 Mukoyama M, Nakao K, Saito Y, et al Human brain natriuretic ... like to thank Dr Y Watanabe and Dr Y Izumi for collecting the samples, and Ms H Tobe, M Nakamura, and K Sugama for their technical assistance This work was supported financially by a grant from...
- 7
- 612
- 1
Tài liệu Creating a New Access Database pptx
... Access database " + fileName + " created.", "Create Access Database" , MessageBoxButtons.OK, MessageBoxIcon.Information); } catch (System.Exception ex) { MessageBox.Show("Could not create database ... @"Provider=Microsoft.Jet.OLEDB.4.0;Data Source=" + fileName + ";"; // Use ADOX to create the Access database ADOX.Catalog cat = new ADOX.Catalog( ); try { cat .Create( connectString); } finally { cat = null; } } Discussion ADO ... the objects in a database You can use ADOX from NET through COM interop to create a new Microsoft Access database Use the Create( ) method of the ADOX.Catalog object, passing a connection string...
- 3
- 412
- 0
Tài liệu Updating a Data Source with Data from a Different Data Source doc
... DataSet tracks changes made to data by maintaining multiple versions of each row allowing the data to be reconciled later to a data source using a DataAdapter The data source to which the DataSet ... modification to create an audit trail of changes made to a DataSet Instead of using the update logic generated by the CommandBuilder for the destination DataAdapter, create custom update logic to ... source database server, so an Oracle table could be synchronized to reflect all changes made to a SQL Server table In fact, the data sources not even have to be databases If the destination data is...
- 4
- 326
- 0
Tài liệu Creating a New SQL Server Database doc
... executes a DDL CREATE DATABASE statement to create a new database on a SQL Server You can programmatically drop the database by using the DROP DATABASE statement in a similar way To drop the database ... Oracle databases and other databases is similar to that shown for SQL Server although the DDL syntax for each database varies slightly because of differences in database server capabilities and ... statements generally require DBA permissions to execute Database Management Language (DML) Used to manipulate—select, insert, update, and delete—data in the database objects Database objects are...
- 3
- 410
- 1
Tài liệu Creating a Table in the Database from a DataTable Schema docx
... command If you have a number of tables in a DataSet that you want to create in a database, you can iterate through the collection of DataRelation objects for the DataSet and use the ALTER TABLE ... query to the calling application and use that to control whether the new table is created The second DDL command uses the CREATE TABLE statement to create the table in the database The code iterates ... ConfigurationSettings.AppSettings["Sql_ConnectString"]); MessageBox.Show("Table " + TABLENAME + " created.", "Create DataTable from schema.", MessageBoxButtons.OK, MessageBoxIcon.Information); } private void CreateTableFromSchema(DataTable dt,...
- 6
- 493
- 0
Creating a Database ppt
... Creating a Database Manually • • • • • • Choose a unique instance and database name Choose a database character set Set operating system variables Create the initialization parameter file Start ... specific ways of creating a database: – Use the Database Configuration Assistant to create a database using graphical steps Launched by: Start > Programs > Oracle-OraHome90 > Configuration and Migration ... Database Configuration Assistant you can: • Create a database • Configure database options • Delete a database • Manage templates – Create new templates using predefined template settings – Create...
- 21
- 242
- 0
DATABASE DESIGN PRIMER A BEGINNERS GUIDE TO CREATING A DATABASE doc
... hoc data management tasks are performed on data that is already in the database Most of the analyses for LCTA are based on the data that are found in the installation database, thus, this task ... database, and the type discussed here, is a relational database A relational database is a collection of tables with relationships A database is designed to describe a situation A situation is a well-defined ... Microsoft Access Concepts of Creating a Database A database is a collection of information typically stored on a computer A database can be thought of as an electronic filing system One type of database, ...
- 19
- 412
- 0
CREATING A SUPPORTIVE ENVIRONMENT FOR ELDERLY WITH CHRONIC ILLNESS potx
... demand a multidisciplinary collaborative approach among different professionals and organizations in the community Overseas experiences have shown that community-based, and coordinated medical and ... Health Services Among Older Adults Journal of Gerontology, 50B(5), S330-S339 Roemer, M.I (1985) National Strategies for Health Care Organization: A World Overview Ann Arbor: Health Administration ... only a small percentage of the elderly are able to receive community-based geriatric care (Census and statistics Department, 1996) Although many community-based social services are generally well...
- 7
- 507
- 0
Creating a glass object with max and vray
... lighting I have used an Omni light, V-ray shadows cheked and on V-ray shadows parameters check Transparent shadows and area shadow Use a plane for the scene and assign a white color to this It ... not really :) The glass need something to reflect To this use a HDRI map You can find some HDRI images at this address http://athens.ict.usc.edu/Probes/ and assign this to V-ray Environment and ... (is available only for Max as I know), and adjust the thickness of the object how you like Now to make the special for of the glass we need to cut a little of the top, using booleans We will use...
- 14
- 279
- 0
delphi - creating a database application using delphi
... component adding a database connection to an application a grid to an application a menu to an application to 11 a title to an application 12 an image to an application 12 an Update Now button to an application ... and save it The Data Controls page provides data-aware controls that work with data in a database and build a user interface You’ll display the database in a grid and add a few commands and a ... application 11 unidirectional dataset component applying edits to database 11 database applications accessing to overview database sample, employee.gdb database user name and password DataSetProvider...
- 22
- 762
- 0
delphi 7 - tutorial - creating a clx database application
... database application Other database applications have a similar architecture The user interface includes data-aware controls such as a grid so that users can edit and post data to the database The data ... functional File|Exit command 16 Tutorial Index A ActionList component adding a grid to an application a title to an application 12 an image to an application 12 database connection to an application ... component to have data to display and manipulate Similarly, all datasets must be associated with a data source component for their data to be displayed and manipulated in data-aware controls on a form...
- 22
- 374
- 0
![picture yourself building a website with joomla! 1.6[electronic resource] step-by-step instruction for creating a high-quality, professional-looking site with ease](https://media.store123doc.com/images/document/14/y/ob/small_oby1401382455.jpg)
picture yourself building a website with joomla! 1.6[electronic resource] step-by-step instruction for creating a high-quality, professional-looking site with ease
... use it After you create a database, you must associate a user with a username and password with the database Joomla! asks you for that information during the installation process so, again, write ... no additional page space will be devoted to describing the variety of server control panels Assigning a User to the Database Every database must have a user assigned to it or authorized to use ... PHP and MYSQL to allow a proper install to be performed They should be PHP 5.2.x and MySQL 5.0.4 Username and Password for Database After you have created the database, you must assign a username...
- 320
- 858
- 0
Báo cáo sinh học: " Genetically distant American Canine distemper virus lineages have recently caused epizootics with somewhat different characteristics in raccoons living around a large suburban zoo in the USA" doc
... (Taiwan) Dog Hamam (Japan) (15) Dog Hamam (Japan) Dog KDK1 (Japan) (16) Dog KDK1 Dog Ueno (Japan) (17) Dog Ueno (Japan) Dog Yanaka (Japan) (18) Dog Yanaka (Japan) Giant panda (China) (19) Giant ... USA) (9) Raccoon (Michigan, USA) A7 5/17 (10) A7 5/17 Dog (Colorado, USA) (11) Dog (Colorado, USA) Javelina (12) Javelina Raccoon dog T dog Tanu (13) Raccoon anu (Japan) (Japan) Dog (T aiwan) (14) ... mortality in large felids [2], fresh-water seals (Phoca sibirica) [3], and various other animals CDV killed more than 10,000 Caspian seals (Phoca caspica) in year 2000 [4], and decimated an African...
- 14
- 346
- 0
báo cáo hóa học:" Genetically distant American Canine distemper virus lineages have recently caused epizootics with somewhat different characteristics in raccoons living around a large suburban zoo in the USA" pot
... (Taiwan) Dog Hamam (Japan) (15) Dog Hamam (Japan) Dog KDK1 (Japan) (16) Dog KDK1 Dog Ueno (Japan) (17) Dog Ueno (Japan) Dog Yanaka (Japan) (18) Dog Yanaka (Japan) Giant panda (China) (19) Giant ... USA) (9) Raccoon (Michigan, USA) A7 5/17 (10) A7 5/17 Dog (Colorado, USA) (11) Dog (Colorado, USA) Javelina (12) Javelina Raccoon dog T dog Tanu (13) Raccoon anu (Japan) (Japan) Dog (T aiwan) (14) ... mortality in large felids [2], fresh-water seals (Phoca sibirica) [3], and various other animals CDV killed more than 10,000 Caspian seals (Phoca caspica) in year 2000 [4], and decimated an African...
- 14
- 397
- 0
5 Tips for Creating a Team Building Culture at Work pdf
... individual achievements are great, collaborative ideas and practices are what create a team-building culture Encourage team members to work together to come up with the very best ideas, and reward ... your managers to use this data, you will accelerate performance and build your employee brand loyalty It’s also important to remember that team building isn’t just an activity you once a month ... team works together directly affects the productivity of the company With an overall understanding of where strengths and weaknesses vary, managers are now able to make appropriate adjustments...
- 2
- 338
- 0
Tìm thêm: xác định các mục tiêu của chương trình khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008