1 establishing a time lag on a physical standby database
Tài liệu Concepts and Administration pptx
... the standby database Similar to a primary database, a standby database can be either a single-instance Oracle database or an Oracle Real Application Clusters database A standby database can be ... 10.9 Part II Using a Physical Standby Database with a Time Lag Establishing a Time Lag on a Physical Standby Database Failing Over to a Physical Standby Database with a Time Lag ... Logical Standby Database Create a Physical Standby Database Prepare the Primary Database to Support a Logical Standby Database Prepare to Transition to a Logical Standby Database...
- 474
- 1,318
- 1
báo cáo hóa học: " Onset and persistence of person-perceived participation restriction in older adults: a 3-year follow-up study in the general population" pptx
... conception and design of the study, acquisition of data and analysis and interpretation of data, (ii) drafting of this manuscript and have given final approval of this version for publication ... lost at follow-up had the same likelihood of participation restriction (examining onset and persistence separately), within strata defined by age, gender, educational attainment, occupational class ... judgement, and the nature and timeliness of participation ("as and when I have wanted") Responses are on a five point ordinal scale (All/Most/Some /A little/None of the time) and responders were considered...
- 11
- 498
- 0
Báo cáo lâm nghiệp: "Evaluation of squared timber and log products in the Hyrcanian Forests of Iran" doc
... Located in the northern part of Iran, the study areas are known as the Northern Forests or Hyrcanian Forests and are distributed across three provinces: Golestan, Mazandaran, and Gilan The majority ... mules in such a way that each animal carried two logs per load and one end of timbers was dragged along the ground (Fig. 2) The volume of logs was gauged based on The total squared timber volume ... Iran 63–68 68 03 2005 2007 2007 Anonymous (2006): Timber Products, Consuming in Iran Annual reports of the Forest and Range Organization of Iran Tehran, Forest and Range Organization of Iran:...
- 6
- 366
- 0
Tài liệu Báo cáo Y học: Mutations in the docking site for cytochrome c on the Paracoccus heme aa3 oxidase Electron entry and kinetic phases of the reaction pptx
... exponentials The observed rate constant from the fast phase of this double-exponential decay was plotted against the cytochrome c concentration, and the apparent bimolecular rate constant kon calculated ... ture at 2.8 A resolution of cytochrome c oxidase from Paracoccus denitrificans Nature 376, 660–669 12 Tsukihara, T., Aoyama, H., Yamashita, E., Tomizaki, T., Yamaguchi, H., Shinzawa-Itoh, K., Nakashima, ... kinetics at 15 mM ionic strength Further criteria for manipulating the kinetic phases of reaction Transitions from mono- to biphasic reaction conditions, depending on ionic strength variation, can...
- 9
- 457
- 1
Báo cáo khóa học: Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase docx
... by monitoring product formation Ó FEBS 2003 at four time points for each reaction (product formation was linear for at least 20 min, at all substrate concentrations, at almost all pH values and ... pKa calculations pKa values for Asp140, Asp142, Glu144 and Asp215 were calculated in several ChiB mutants as described in Materials and methods (Table 3) Calculations were primarily based on ... 26 Watanabe, T., Kobori, K., Miyashita, K., Fujii, T., Sakai, H., Uchida, M & Tanaka, H (1993) Identification of glutamic acid 204 and aspartic acid 200 in chitinase A1 of Bacillus circulans WL12...
- 10
- 651
- 0
Báo cáo khoa học: Local changes in the catalytic site of mammalian histidine decarboxylase can affect its global conformation and stability pptx
... conformational change in aspartate aminotransferase after substrate binding, which promotes the catalytic reaction, as it favors maximum imine–pyridine conjugation Aspartate aminotransferase is also a ... I., Nakajima, Y., Hirotsu, K & Kagamiyama, H (2003) Conformational change in aspartate aminotransferase on substrate binding induces strain in the catalytic group and enhances catalysis J Biol ... M., Hara, M., Mai, L., Numayama-Tsuruta, K., Ishigaki-Suzuki, S., Ohuchi, K., Ichikawa, A. , Falus, A. , Watanabe, T & Nagy, A (2001) Mice lacking histidine decarboxylase exhibit abnormal mast cells...
- 12
- 409
- 0
Báo cáo khoa học: Kinetic and crystallographic analyses of the catalytic domain of chitinase from Pyrococcus furiosus – the role of conserved residues in the active site pdf
... D52 2A, D524N, D52 4A, E526Q, E52 6A and W66 4A mutations were 5¢-GCCACT TACTTGAACTTTGACATAGAAGCCGG-3¢, 5¢-GCCAC TTACTTGGCATTTGACATAGAAGCC-3¢, 5¢-GCCACT TACTTGGACTTTAACATAGAAGCCGG-3¢, 5¢-GCCAC TTACTTGGACTTTGCGATAGAAGCCGG-3¢, ... TTACTTGGACTTTGCGATAGAAGCCGG-3¢, 5¢-GGAC TTTGACATACAAGCCGGTATCGATGC-3¢, 5¢-GGACT TTGACATAGCGGCCGGTATCGATGC-3¢ and 5¢-GGA TCACTAGCCTTCGCGAGTGTAGACAGAG-3¢, respectively, in which the mutated codons are ... B-factor values ˚ All atoms (A2 ) ˚ Main-chain (A2 ) ˚ Side-chain (A2 ) ˚ Substrate (A2 ) ˚ Water (A2 ) R.m.s DB values ˚ Main-chain (A2 ) ˚ Side-chain (A2 ) Ramachandran plot statisticsf Favored (%) Allowed...
- 13
- 514
- 0
Báo cáo khoa học: Post-translational modifications in the active site region of methyl-coenzyme M reductase from methanogenic and methanotrophic archaea potx
... the ANME-1 cluster, there is a codon for a valine, whereas in mcrA from methanogenic archaea, there is a codon for a glutamine [2] 4914 Methanogenic archaea and methanotrophic archaea all belong ... essential in Methanosarcina acetivorans C 2A and allows isolation of mutants with defects in regulation of the methanol utilization pathway J Bacteriol 187, 5552–5559 14 Metcalf WW, Zhang JK, Apolinario ... post-translational modifications can at present only be approached by comparison of MCRs from archaea differing in phylogenetic relationship and ⁄ or growth conditions An early hypothesis was that the...
- 9
- 548
- 0
Báo cáo khoa học: Key substrate recognition residues in the active site of a plant cytochrome P450, CYP73A1 ppt
... 5¢-GTTCGAGAACAATGAATGTTGTGTTC-3¢ 5¢-GAACACAACATTCTCTGTTCTCGAACC-3¢ 5¢-GAAGTTAAAGATACAATGATTCAGCTC 5¢-CATTGTTGAAGACATCAATGTTG-3¢ 5¢-CTTTACATTGTTGAATTCATCAATGTTGCAGC-3¢ 5¢-CATTGTTGAAAACGCTAATGTTGCAG-3¢ ... 5¢-GATACCGATGAGATGGGTGGGCAGTTTAG-3¢ 5¢-CAACATTCCTTGTCATCGAACCAAACTC-3¢ 5¢-GAACACAACATTCATTGTTCTCGAAC-3¢ 5¢-GGTTCGAGAACAGAGAATGTTGTGTTC-3¢ 5¢-GAGCTGAATCATTGTAACTTTAACTTC-3¢ 5¢-CAACATTGATGTCTTCAACAATG-3¢ ... 5¢-CAACATTGATGTCTTCAACAATG-3¢ 5¢-GCTGCAACATTGATGAATTCAACAATGTAAAG-3¢ 5¢-CTGCAACATTAGCGTTTTCAACAATG-3¢ 5¢-CATACGGAGCATGAGGGTTTCCTTG-3¢ 5¢-CGGGATCGCCATTTCGAGACGGAGGG-3¢ 5¢-CGGGATCGCCATAAAGAGACGGAGGG-3¢ 5¢-GACTAGAAGCGGGAACGCCATACGGA-3¢...
- 12
- 380
- 0
Báo cáo Y học: Role of tyrosine 238 in the active site of Rhodotorula gracilis D-amino acid oxidase A site-directed mutagenesis study docx
... D-alanine was measured by mixing anaerobically a solution of each mutant enzyme with solutions containing varying concentrations of D-alanine, such that a pseudo rst-order condition was maintained with ... D-alanine concentration (see Fig 5B) [22]: a saturation is not visible as the reactions at D-alanine concentration > mM develop so rapidly that the reaction rates are at the detection limit of ... Dissociation constants for ligands were measured spectrophotometrically at 15 C The change in absorbance upon adding ligand was plotted as a function of ligand concentration, after correction for any volume...
- 10
- 496
- 0
Report Development Tools Building Custom Reports in the R/3 System
... Coolidge, Ron Giovannelli, and Patrick Zalamea (Ziatech Corporation) Pamela Anderson and Robert Smith (publishing consultants) Werner Aigner, Simone Baeumer, Tami Becker, Randi Bethel, Sylvia Chaudoir, ... of SAP AG SAP AG makes no warranties or representations with respect to the content hereof and specifically disclaims any implied warranties of merchantability or fitness for any particular purpose ... make any such changes without obligation to notify any person of such revision or changes SAP AG makes no commitment to keep the information contained herein up to date Trademarks SAP, the SAP...
- 16
- 657
- 0
Fill in the gaps 3
... such as 'isn't' and 'doesn't' k …materials such as nylon as well as natural materials such as cotton l …it is unlikely that man will be able travel to other galaxies Don't forget to keep a record ... During times of war, governments usually stop / suppress any newspaper reports which contain bad news 10 Examination candidates are not allowed to eat, drink, smoke or talk for the time / duration ... spite of a massive advertising campaign, only a very small proportion of consumers made a permanent change in their buying habits If you look at this second chart, you can see that unemployment...
- 13
- 649
- 1
Tài liệu Personal Web Usage in the Workplace: A Guide to Effective Human Resources Management Part 3 docx
... trustor about a particular person within a specific situation (Gabarro, 1987) Trust is also a mental state which changes as additional data are collected Every interaction is evaluated and judged ... company and other organizational leaders have a common understanding and agreement about the importance of trust, the nature of organizational trust, and an assessment of the climate of trust that ... exploratory factor analysis with varimax rotation was conducted on the 18 measures The factor analysis revealed four factors and explained 64.36% of the variance in the data Table shows the factor loadings...
- 46
- 562
- 0
Tài liệu Color Atlas of Pharmacology (Part 3): Distribution in the Body docx
... order to reach their sites of action, they must leave the bloodstream Drug permeation occurs largely in the capillary bed, where both surface area and time available for exchange are maximal (extensive ... substance and and Solid substance structurally bound water structurally bound water 40% 20% 40% intracellular intracellular water water extra-cellular extracellular water water Potential aqueous ... (effective) concentration of the displaced drug (a form of drug interaction) Elevation of the free concentration of the displaced drug means increased effectiveness and accelerated elimination A decrease...
- 10
- 475
- 0
Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf
... AGTAAGGAAAATAAGCTTGGGCATGATCCC GCTCACTGCCTAAGCTTTGTAGCTAATAAAG CTTTATTAGCTACAAAGCTTAGGCAGTGAGC CTTTGTTATTTATTATGCATTCCTATGGTGAGTT AACTCACCATAGGAATGCATAATAAATAACAAAG CTTTGTTAAAGCTTATGCATTCCTATGGTGAGTT AACTCACCATAGGAATGCATAAGCTTTAACAAAG ... SJS170 ALS030 SJS209 SJS275 SJS276 CGGAAGATCTAACTAAGCGTGCTGCTTC TACGAGATCTGTTGTTTGGAAGCAGGTT CGGAAGATCTGGGATCATGCCCATTTAG TACGAGATCTTAGCTACATTAAATAGGC GGGATCATGCCCAAGCTTATTTTCCTTACT AGTAAGGAAAATAAGCTTGGGCATGATCCC ... AACTCACCATAGGAATGCATAAGCTTTAACAAAG CCTCTTACACTTGCTTTTGAC GCAAAGGTGCCTTTGAGGTTG GACCCCTTCATTGACCTCAACTA CTTGATTTTGGAGGGATCTC TTAGCTACATTAAATAGGCAG GtaatacgactcactataGGGATCATGCCCATTTAG Forward (nt 1281–1298...
- 14
- 635
- 0
Tài liệu Báo cáo khoa học: Neuronal growth-inhibitory factor (metallothionein-3): evaluation of the biological function of growth-inhibitory factor in the injured and neurodegenerative brain pdf
... numerous pathological hallmarks in AD that are commonly accompanied by neuronal alterations These physical alterations include aberrant neurite sprouting and significant neuronal loss One hypothesis ... Asanuma M, Sogawa N, Miyazaki I, Nakanishi T, Furuta H & Ogawa N (2001) Localization, regulation, and function of metallothionein-III ⁄ growth inhibitory factor in the brain Acta Med Okayama 55, 1–9 ... in AD One of the primary pathological hallmarks of AD is the formation of b-amyloid (Ab) plaques, composed primarily of Ab(1–40) and Ab(1–42) peptides, which associate to form abnormal extracellular...
- 9
- 664
- 0
Tài liệu Báo cáo khoa học: Activation loop 3 and the 170 loop interact in the active conformation of coagulation factor VIIa pdf
... same time an unaltered conformational distribution of the N-terminal tail and a normal response to TF Discussion Fig N-terminal pegylation of G37 2A- FVIIa and FVIIa (A) Pegylation of free and TF-bound ... calculated by global tting of binding data to a : model using the software Biaevaluation 4.1 supplied by the manufacturer (Biacore AB) N-terminal pegylation and carbamylation In the pegylation ... by surface plasmon resonance were found to be very similar for G37 2A- FVIIa and FVIIa (Fig 3) The association and dissociation rate constants and the derived equilibrium dissociation constant were...
- 11
- 619
- 0
Tài liệu Báo cáo khoa học: A novel coupled enzyme assay reveals an enzyme responsible for the deamination of a chemically unstable intermediate in the metabolic pathway of 4-amino-3-hydroxybenzoic acid inBordetellasp. strain 10d doc
... 10 Takenaka, S., Asami, T., Orii, C., Murakami, S & Aoki, K (2002) A novel meta-cleavage dioxygenase that cleaves a carboxylgroup-substituted 2-aminophenol: purification and characterization of ... to any other sequences available in FASTA and BLAST database programs at the DNA Data Bank of Japan Recently, we reported the cloning and sequencing of the gene encoding 4-amino-3-hydroxybenzoate ... Bacteriol 183, 5074–5081 Aoki, K., Takenaka, S., Murakami, S & Shinke, R (1997) Partial purification and characterization of a bacterial dioxygenase that catalyzes the ring fission of 2-aminophenol Microbiol...
- 7
- 613
- 1
Tài liệu Báo cáo khoa học: Involvement of two positively charged residues of Chlamydomonas reinhardtii glyceraldehyde-3-phosphate dehydrogenase in the assembly process of a bi-enzyme complex involved in CO2 assimilation doc
... PsativumA SoleraceaA 197 Chlamy 200 Synechocystis 198 Synechococcus 199 R R R R R R R R R R R R R R R R R R R R A A A A A A A A A A R R R R R R R R R R A A A A A A A A A A A A A A A A A A A A A ... T T T T T G G G G G G G G G G A A A A A A A A A A A A A A A A A A A A K K K K K K K K K K A A A A A A A A A A V V V V V V V V V V S S S S A A A S A A L L L L L L L L L L V V V V V V V V V V L ... obtained GAPDH activities measured at constant BPGA concentration and varied concentrations of NAD(P)H were tted to a hyperbola according to MichaelisMenten kinetics Protein concentration was assayed...
- 8
- 494
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008