• establish a mechanism for exchanging a username and password for a token with defined rights
Báo cáo khoa học: Complexes of Thermoactinomyces vulgaris R-47 a-amylase 1 and pullulan model oligossacharides provide new insight into the mechanism for recognizing substrates with a-(1,6) glycosidic linkages docx
... Structure of a- amylase with pullulan model ligand A Abe et al Fig Chemical structures of the repeat units of pullulan, P2 and P5 A solid arrow indicates the main hydrolysing site, and a dashed arrow ... A, Ohtaki A, Kaji A, Tonozuka T & Sakano Y (2002) Crystal structures of Thermoactino˚ myces vulgaris R-47 a- amylase (TVA I) at 1.6 A reso˚ resolution lution and a- amylase (TVA II) at 2.3 A J Mol ... indicates the minor site of pullulan hydrolysed by TVAI (TVAI ⁄ ACA), and complexes of an inactive mutant TVAI (Asp356 to Asn and Glu396 to Gln, D356N ⁄ E396Q) with malto-hexaose (G6) and malto-tridecaose...
- 9
- 342
- 0
A Survey on Network Security and Attack Defense Mechanism For Wireless Sensor Networks pdf
... steam or the creation of a false stream in a WSN Mote-class versus laptop-class attacks: In moteclass (sensor-class) attacks, an adversary attacks a WSN by using a few nodes with similar capabilities ... antenna and hence they can affect much more than an attacker with only ordinary sensor nodes A single laptop-class attacker might be able to eavesdrop on an entire network Availability is an assurance ... ways The inside attacker may have partial key material and the trust of other sensor nodes Inside attacks are much harder to detect External attacks may cause passive eavesdropping on data transmissions,...
- 9
- 676
- 0
Báo cáo khoa học: The benzophenanthridine alkaloid sanguinarine perturbs microtubule assembly dynamics through tubulin binding A possible mechanism for its antiproliferative activity Manu Lopus and Dulal Panda docx
... (13-methyl-[1,3]-benzodioxolo[5,6-c]1,3-dioxolo-[4,5-i]-phenanthridinium chloride) (Fig 1), a benzophenanthridine alkaloid derived from the plant Sanguinaria canadensis, has been shown to have antimicrobial, anti-inflammatory, antioxidant, and anticancer ... Adhami VM, Aziz MH, Reagan-Shaw SR, Nihal M, Mukhtar H & Ahmad N (2004) Sanguinarine causes cell cycle blockade and apoptosis of human prostate carcinoma cells via modulation of cyclin kinase ... versus normal cells Clin Cancer Res 6, 1424–1428 Slaninova J, Taborska E & Bochorakoa & Slanina J (2001) Interaction of benzophenanthridine and protoberberine alkaloids with animal and yeast cells...
- 12
- 429
- 0
A Scalable and Explicit Event Delivery Mechanism for UNIX doc
... A scalable and explicit event delivery mechanism for UNIX Gaurav Banga gaurav@netapp.com Network Appliance Inc., 2770 San Tomas Expressway, Santa Clara, CA 95051 Jeffrey C Mogul mogul@pa.dec.com ... the application reads just a portion of this data, and then calls select() again before more data arrives, select() will again report that the descriptor is ready for reading The state-based approach ... not actually send any requests In essence, we simulate a load with a given arrival rate and duration distribution by breaking it into two pieces: S-Clients for the arrival rate, and load-adding...
- 14
- 453
- 0
Báo cáo y học: "Differential expression, function and response to inflammatory stimuli of 11β-hydroxysteroid dehydrogenase type 1 in human fibroblasts: a mechanism for tissue-specific regulation of inflammation" pps
... Table Probes and primer sequences used Gene Primers and probes 11β-HSD1 Forward primer: AGGAAAGCTCATGGGAGGACTAG Reverse primer: ATGGTGAATATCATCATGAAAAAGATTC Probe: CATGCTCATTCTCAACCACATCACCAACA ... CATGCTCATTCTCAACCACATCACCAACA H6PDH Forward primer: CAGGTGTCCTAGTGCACATTGAC Reverse primer: GTAGCCCACTCTCTCGTCCAA Probe: AAGGCACGCCCTCCCAGCG GRα Forward primer: GCGATGGTCTCAGAAACCAAAC Reverse primer: GAGATTACAGAGGAAGTTATCCTCTGC ... Probe: TGCAGTGAAGGTTGCTGAGGCTCTGA GRβ Forward primer: AAC TGG CAG CGG TTT TAT CAA CT Reverse primer: AACTCTTGGATTCTATGCATGAAAATGTTA TGTGGTTA Probe: TGT GTG AGA TGT GCT TTC TGG TT C/EBPα Forward primer:...
- 10
- 438
- 0
Effect of cyclooxygenase inhibition on cholesterol efflux proteins and atheromatous foam cell transformation in THP-1 human macrophages: a possible mechanism for increased cardiovascular risk pot
... Chicago, IL, USA) Data was analyzed using the Kruskal-Wallis one-way analysis of variance on ranks Pairwise multiple comparison was made with the Holm-Sidak method Foam cell formation and staining ... leukemia virus) reverse transcriptase primed with oligo dT cDNA was amplified with specific primers (48 pmol/reaction) for ABCA1 (forward primer 5'-GAAGTACATCAGAACATGGGC-3' and reverse primer 5'GATCAAAGCCATGGCTGTAG-3' ... Adams K, Adams JM: Indomethacin therapy for patent ductus arteriosus in premature infants: efficacy of a dosing strategy based on a seconddose peak plasma indomethacin level and estimated plasma...
- 11
- 223
- 0
Báo cáo y học: "Diacerein inhibits the synthesis of resorptive enzymes and reduces osteoclastic differentiation/survival in osteoarthritic subchondral bone: a possible mechanism for a protective effect against subchondral bone remodelling" ppsx
... interpretation of data, manuscript preparation, and statistical analysis SKT participated in acquisition of data, analysis and interpretation of data, and manuscript preparation SC participated in acquisition ... preparation, and statistical analysis J-PP participated in study design, analysis and interpretation of data, and manuscript preparation JM-P participated in study design, analysis and interpretation ... data and manuscript preparation All authors read and approved the final manuscript 13 14 15 16 Acknowledgements The authors thank Virginia Wallis for her assistance in manuscript preparation and...
- 10
- 536
- 0
báo cáo khoa học: " Subcellular localisation of Medicago truncatula 9/13-hydroperoxide lyase reveals a new localisation pattern and activation mechanism for CYP74C enzymes" doc
... the first 11 amino acids was tagged with YFP using the following two primers: 5'-CGCGCCATGGCTTCCTCATCAGAAACCTCCTCA ACCAACGGC-3' (forward) and 5'-GGCCGCCGTTGGTTGAGGAGGTTTCTGATGAGGAAGCCATGG-3' (reverse) ... construct and 5'-TAGGCGCGCCATGCTCCCCTTGAAACCAATCCCAG-3' for pG2HPLF2-YFP construct and a common reverse primer: 5'-TGCGGCCGCCGACGGTGGATGAAGCCTTAACAAGTG-3' The 5' end of M truncatula HPLF encoding ... illumination For root observation and easy removal before staining, seedlings were grown on vertically oriented MS plates for days [25] Tobacco and A thaliana protoplasts were isolated as previously...
- 13
- 272
- 0
Tài liệu Nutritional care and support for people living with HIV/AIDS A training course pptx
... look approachable For example, not read other material or talk constantly with other facilitators Talk to participants rather than facilitators during breaks, and be available after a session has ... management of anaemia Prepare a handout if needed Gather examples of any local materials for mothers on nutrition during pregnancy and breastfeeding Find out local foods available (and affordable) ... Child and Adolescent Health (CAH) Special thanks go to Food and Agriculture Organization (FAO) in Rome (Brian Thompson) and South Africa (Margaret McEwan and Mercy Chikoko) and FAO Regional office...
- 102
- 492
- 0
Tài liệu Báo cáo khoa học: "A COMPUTATIONAL MECHANISM FOR PRONOMINAL REFERENCE" pot
... anaphors are short-distance anaphors and require their antecedents to be c-commanding NPs within a minimal domain Ordinary personal pronouns, on the other hand, are long-distance anaphors, and ... those that are internal to the current minimal domain and those that are external As each node is processed, a subroutine is called that dispatches on the category of the node and performs any actions ... person and number, s For bound anaphors, this is straightforward: a bound anaphor and its antecedent must agree in person and number For personal pronouns, on the other hand, eCuwently,NPs are not...
- 10
- 513
- 0
A new mechanism for modulation of schottky barrier heights on silicon nanowires
... and drain and the silicon substrate as a back-gate, a transistor configuration can be defined as shown in Fig 5 (a) Transfer characteristics at different temperatures for a constant drain voltage ... surface concentration taking this depth as a reasonable value for substantial tunneling This gives an energy lowering similar to the experimental data as given in Ref [10] Schottky barriers at nanowire ... The values in regime A are found in the range of 0.15 eV, while regime B has a sharp maximum at 0.55 eV and regime C again decreases the activation energy to about 0.25 eV All these values are...
- 5
- 398
- 0
Báo cáo khoa học: Kinetic mechanism for p38 MAP kinase a A partial rapid-equilibrium random-order ternary-complex mechanism for the phosphorylation of a protein substrate potx
... EÆMgATP complex is not a deadend complex with respect to the binding and phos4633 Kinetic mechanism for p38 MAP kinase a A E Szafranska and K N Dalby Fig Preparation of activated p38 MAPKa and ATF2D115 ... observations and our data support a partial rapid-equilibrium random-order ternary-complex mechanism (Scheme 1A) , where both substrates (MgATP and ATF2D115) bind to p38 MAPKa with moderate affinities ... obtained from Sigma NiSO4 and Ni-NTA agarose for His6-p38 MAPKa purification were provided by Qiagen Inc (Santa Clarita, CA, USA) and Sigma, respectively The His6 tag was removed from p38 MAPKa...
- 15
- 554
- 0
ELDERLY SERVICES IN HEALTH CENTERS: A Guide to Address Unique Challenges of Caring for Elderly People with Disabilities, Frailty, and Other Special Needs pot
... urban areas and rural areas served by health centers and increasing numbers will be minorities such as African Americans, Latinos and AsianAmericans • Many will be adult patients of our health ... placement to remain in the community PACE is usually based in adult day health centers and operates as a small Medicare Advantage capitated managed care plan at risk for providing all Medicare ... 41 states, as does TRICARE and many private insurance plans, HMO’s and other managed care organizations As with palliative care, hospice involves a team-oriented approach Ideally primary care...
- 105
- 526
- 0
Báo cáo khoa học: Neuroglobin and cytoglobin expression in mice Evidence for a correlation with reactive oxygen species scavenging doc
... using a LumiImager (Roche Diagnostics) image quant (Molecular Dynamics, Amersham Biosciences, NJ, USA) was used for quantitation, using b-actin for normalization Statistics Statistical analysis ... Proc Natl Acad Sci USA 99, 6252–6256 Liu Y, Takahashi S, Ogasawara H, Seo HG, Kawagoe M, Hirasawa F, Guo N, Ueno Y, Kameda T & Sugiyama T (2005) Protection of hepatocytes from apoptosis by a novel ... RNA extraction and real-time quantitative PCR For RNA extraction, the TriZol method (Invitrogen, Carlsbad, CA, USA) was used, followed by LiCl precipitation (Ambion, Austin, TX, USA) cDNA was...
- 6
- 391
- 0
Báo cáo khoa học: "A Combination of Active Learning and Semi-supervised Learning Starting with Positive and Unlabeled Examples for Word Sense Disambiguation: An Empirical Study on Japanese Web Search Query" pdf
... unlabeled examples is effective The accuracies of with- EM, random and without-EM are gradually increasing according to the percentage of added hand labeled examples and catch up that of human and converge ... in table Human labeling, abbreviated as human, is an active learning approach starting with human labeled negative examples The number of hu- 63 man labeled negative examples in initial training ... S., and Mitchell, T 2000 Text Classification from Labeled and Unlabeled Documents using EM, Machine Learning, 39, 103-134 Takayama, Y., Imamura, M., Kaji N., Toyoda, M and Kitsuregawa, M 2009 Active...
- 4
- 441
- 1
Báo cáo khoa học: Investigations of the supercoil-selective DNA binding of wild type p53 suggest a novel mechanism for controlling p53 function doc
... lanes and 7, no mAb; lanes and 8, DO-1; lanes and 9, ICA-9; lanes and 10, Bp53-6.1; lanes and 11, Bp53-10.1 Bands denoted as ÔscÕ and ÔocÕ correspond to free monomeric scDNA and open circular ... scDNA (B) Ethidium stained agarose gel: lane 1, scDNA only; lane 2, no mAb; lanes 3–6, Bp53-10.1; lanes 7–10, ICA-9 mAb/p53 tetramer molar ratios: lanes and 7, 0.5; lanes and 8, 1.25; lanes and ... 0831, IGA MH CR NC/7574-3 and NC7131-3, and by grants S 5004009 and Z 5004920 The authors thank Prof Emil Palecek and Dr Phil Coates for their helpful advice and critical reading of the manuscript...
- 12
- 265
- 0
báo cáo hóa học: " Construction and validation of a short-form Quality-Of-Life Scale for Chinese Patients with Benign Prostatic Hyperplasia" pptx
... physical; 0.515 for physical and social; 0.777 for social and psychological; and 0.612 for psychological and satisfaction Criterion validity of the short-form of BPH-QLS is summarized in table ... significant difference in score for the physical and social domain, while inpatients had a lower score For the satisfaction domain, outpatients and For discriminatory validity of the new scale, paired ... and he was the soul of this article All authors read and approved the final manuscript Page of (page number not for citation purposes) Health and Quality of Life Outcomes 2009, 7:24 Additional...
- 7
- 642
- 0
Báo cáo hóa học: " Sliding and pressure evaluation on conventional and V-shaped seats of reclining wheelchairs for stroke patients with flaccid hemiplegia: a crossover trial" potx
... physical therapist Geometric and mechanical parameters The geometric parameters include the degrees of sliding along the backrest (BS) and sliding along the seat (SS), which are standard measures also ... indicate that stroke patients with flaccid hemiplegia are more vulnerable to forward sliding along the seat plane and are, therefore, subject to higher sacral peak pressures (SPP) than able-bodied ... this article as: Huang et al.: Sliding and pressure evaluation on conventional and V-shaped seats of reclining wheelchairs for stroke patients with flaccid hemiplegia: a crossover trial Journal...
- 8
- 375
- 0
báo cáo hóa học:" Replicative Homeostasis: A fundamental mechanism mediating selective viral replication and escape mutation" ppt
... type) and variant viral RNAs will rapidly predominate (Figure 1) Mutations progressively accumulate in RNA viruses [17] and ultimately variant RNAs and proteins, if variant RNAs are translated, ... predominates early, replication (and intracellular accumulation) of variant virus and viral proteins will accelerate (in a ratio of ([RNAwt](t-1 )• + [RNAmt](t-1))/ [RNAwt](t-1 )•( 1-ρ) compared to ... MA, Gabr AH, De La Rosa A, Glock JA, Jayaweera D, Miller N, Dickinson GM: Genotypic analysis of plasma HIV-1 RNA after influenza vaccination of patients with previously undetectable viral loads...
- 14
- 290
- 0
báo cáo hóa học:" Estimating the cost of care giving on caregivers for people living with HIV and AIDS in Botswana: a cross-sectional study" doc
... incentives, such as mealie meal and food baskets and loans for Page of income-generating activities, and lending a sympathetic ear to their plight will help boost the morale of caregivers and attract others ... administration The caregivers were informed that participation in the study was voluntary, that there was no payment for participation, and that they were free to withdraw from participating at any ... quality and internal consistency The Cronbach alpha was calculated as 0.89 Data collection The questionnaire was administered to the sampled caregivers by trained research assistants at their...
- 8
- 384
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose