... the remuneration on time deposits was decreased Figure Reserve Requirements in Colombia Average reserve requirements (Percentage) Marginal reserve requirements (Percentage) crisis checking accounts ... 2 011. 01 Source: BCRP C Recent Empirical Literature on the Latin America Experience In general, there are only a handful of studies examining the recent experience effectiveness of RRs in the region.20 ... policies operate and their sectoral and market-specific targeted nature Moreover, given that systemic risk is not directly observable, assessing the effectiveness of these measures against credit...
... by EMSA, amplified by PCR, sequenced as a pool and subjected to the next round of EMSA After the second cycle of selection, the sequenceof the pool of selected molecules revealed a significant enrichment ... 5¢-(A/G)(G/T)(A/G)GAA (C/ T)(A/G)TTCTA Fig Comparison of the sequences of Sel0 and Sel4 The semirandom sequence oligonucleotides before selection (Sel0) or after the fourth round of selection (Sel4) were sequenced ... calculating, for each position of the central semi-random sequence, the percentage of selected molecules containing each of the four nucleotides (Fig 8) This consensus sequence was composed of the first...
... entire service experience can be reduced to a single encounter, involving ordering, payment, and execution of service delivery on the spot In other cases, the customer's experience includes a sequence ... People as Part of the Service Product The more involved customers become in the service delivery process, the more visible service personnel and other customers become (this is the people element ... involved in service production and may have preferences for certain methods of service delivery, marketers need to understand the nature of the processes through which services are created and delivered...
... formalin-fixed surgical specimens were prepared and collected for immunohistochemical staining The immunohistochemical score (IHS) based on the German immunoreactive score was used for COX-2 and VEGF -C ... Research 2 011, 30:14 http://www.jeccr.com/content/30/1/14 Page of clinicopathologic characteristics were calculated by Student’s t-test, chi-square correlation test and Spearman’s coefficient of correlation ... study, there was a positive correlation between the expression of VEGF -C and peritumoral LVD The overexpression of COX-2 has been detected in several types of human cancer including colon, lung,...
... defined by the criteria of the American College of Chest Physicians/Society of Critical Care Medicine Consensus Conference [22]; (2) a need for renal-replacement therapy defined as Failure according ... failure and guidelines for the use of innovative therapies in sepsis: The ACCP/SCCM Consensus Conference Committee: American College of Chest Physicians/Society of Critical Care Medicine Chest 1992, ... Biomarkers and treatments received were collected from the start of HD, at the end of HD, andfor hours after the end of HD Arterial line and central venous catheters allowed documentation of mean...
... between cyclohexanone and aldehydes were also examined Low yields and high enantioselectivities were obtained for the reaction of aqueous formaldehyde with cyclohexanone catalyzed by 1-10 (Scheme ... because these reactions eliminate the necessity for vigoroso drying of solvents and substrates, but also because unique reactivity and selectivity are often observed in aqueous reactions Recently, ... consumed in the reaction and does not require parallel regeneration; (b) Organic molecules that form reactive intermediates The chiral catalyst is consumed in the reaction and requires regeneration...
... Date of Manufact -ure GVWR GAWR Completed Vehicle Yes Yes Yes Yes Incomplete Vehicle Yes Yes Yes Intermediate Yes Yes Final-stage Yes Yes Vehicle Type VIN Certification Statement Source Yes Yes ... vehicles and the name and address of the first purchasers of their vehicles for years from the date that the vehicles are sold These requirements are intended to ensure that purchasers receive ... Issuance NHTSA is authorized by the Vehicle Safety Act to issue safety standards that set minimum performance requirementsfor new motor vehicles andfor certain items of motor vehicle equipment...
... lowest value for the tetragonal form of the chagasin–cathepsin B complex and the highest for the chagasin–cathepsin L complex (Table 3) The difference of 9° between these complexes may be correlated ... of various enzyme complexes of chagasin The superpositions of Ca atoms were calculated using ALIGN [31] for the entire complex (c) , for the enzyme molecule only (e) , andfor the chagasin molecule ... crystallographic models of cruzipain and free chagasin (molecules A and B) are also included Where appropriate, a number in square brackets shows the level ofsequence identity (%) between the compared enzymes...
... be decreasing Because, if sufficient number of hand labeled negative examples exist, a classifier does not need pseudo negative examples The control of τ depending on the number of hand labeled ... the number of its senses, the number of its data instances, the number of feature, and the percentage of positive sense instances for each data set Assigning the correct labels of data instances ... binary classification where desired texts are positive examplesand other texts are negative examples This setting is practical, because ambiguous senses other than the expected sense are difficult...
... compete with imported paper either for quality or price Recently, new investments have enabled purchase of new technology but product quality hasn’t met the export requirementsand other factors ... 2006, Vietnam’s government has reclassified the national forest land There are 16.24 million that have been categorized as forest land Moreover, area for production forest has received a priority ... the converted area However, there is no document recorded about the harvested volumes In this report, estimated volumes of logs taken from the converted area are given below Table Converted area...
... proved the following theorem for a sequenceof metric projections in a Banach space Theorem 2.3 Tsukada 19 Let E be a reflexive and strictly convex Banach space and let {Cn } be a sequenceof ... We have the following theorem 11, Theorem for a uniformly convex Banach space Theorem 2.1 Xu 11E is a uniformly convex Banach space if and only if, for every bounded subset B of E, there exists ... theorem for a sequenceof generalized projections in a Banach space Theorem 2.4 Ibaraki et al 20 Let E be a strictly convex, smooth, and reflexive Banach space M-limn Cn exists andand let {Cn...
... practical situations The correspondence matching-based techniques detect optic flows by searching for correspondence points between consecutive images These are, therefore, more suitable for dynamic ... discontinuities are used to predict and enforce the preservation of stereo correspondences through the motion estimates They presented the computed optical flow and stereo disparity on some tailored images ... multiple measures for stereo matching As well as the normalized cross correlation coefficient, two other measures are defined as the differences of the horizontal and vertical displacements of two...
... GAAGGCTCGAGTACTGGCAGAAGCCATGAAAGAG (sense) and GGCTTCTGCCAGTACTCGAGCCTTC (antisense) Primers used to produce SIVm3 were: GAAGGCTCGAGTACTGGCAGAAGCCATGAAAGAG (sense) and TGGCTTCTGCCAGTACTCGAGCCTTTC ... also exhibited efficient cleavage of CA-SP1 junction in the presence or absence of DSB Mutations at the CA-SP1 junction render SIV sensitive to DSB To determine whether sequences at the CA-SP1 ... HIV-1 isolates, together with the specific differences in the corresponding SIV sequence, suggested that these sequences might fully account for the differential sensitivity of HIV-1 and SIV to...
... tags) revealed preference data alone cannot identify the effect of CWD on site choice Therefore, a set of stated preference questions about site choice was included in the survey of hunters The stated ... stated preference data are included with the revealed preference data Using these data we model site choice, availability (choice set formation) and scale The effect of time on preferences, availability ... decisions, whether these are objective measures of attributes collected by the researcher or attributes as presented to the respondent by the researcher in an experiment or stated preference task This...
... et al Genetic models of human cancer as a multistep process Paradigm models of colorectal cancer, breast cancer, and chronic myelogenous and acute lymphoblastic leukaemia J Exp Clin Cancer Res.2005; ... differentially expressed proteins as potential biomarkers in colorectal cancer patients by MALDI-TOF MS We used WCX magnetic beads to screen potential serum biomarkers for colorectal cancer detection ... Total mesorectal excision for rectal cancer: difference in outcome for low and high rectal cancer Dis Colon Rectum.2005; 48: 2224-2231 Fletcher RH Carcinoembryonic antigen Ann Intern Med.1986;...
... "the degree to which test scores for a group of test takers are consistent over repeated applications of a measurement procedure and hence are inferred to be dependable and repeatable for an ... unsystematically and not be repeatable or dependable Test reliability refers to the consistency of scores students would receive on alternate forms of the same test Due to differences in the exact ... test characteristics and he summarized in the form of the table called A checklist for Test Evaluation The checklist is for rating of the adequacy of a test for any given purpose -8- Table 2.1...
... choice criteria Based on the evaluation, the consumer 18 forms a degree of preference for the store If preference exceeds a certain threshold level, the consumer will patronize the store (Naresh, ... perceived characteristics of stores, (3) comparison process, and (4) acceptable and unacceptable stores (figure 2.1) Determinants of store-choice decision vary by market segment and by product class ... variety and return policy The heavy-users held much more favorable assessment on supermarkets, they seemed to accept the high prices to trade off for more convenience, better atmosphere and services...