once a dangerous contaminant caroline smith dewaal playing chicken the human cost of inadequate regulation of the poultry industry center for science in the public interest cspi 1996 http www cspinet org reports polt html accessed july 11 2009
... Games game design awards In 2009, her game Train won the coveted Vanguard Award at IndieCade for “pushing the boundaries of game design and showing us what games can do.” She was named one of ... International Centerforthe History of Electronic Games at the Strong Museum of Play She was named Woman ofthe Year by Charisma+2 Magazine in 2010 and also was a nominee in Microsoft’s 2010 Women in ... the top 20 most in uential women inthe game industry by vi About the Authors Gamasutra.com in 2008 and one ofthe 100 most in uential women inthe game industry by Next Generation magazine in...
... were informed that participation inthe study was voluntary, that there was no payment for participation, and that they were free to withdraw from participating at any time They were assured ofthe ... Library Cataloguing-inPublication Data, Geneva, Switzerland; 2002 20 Sevick MA, Bradham DD, Winston-Salem NC, Baltimore MD: Economic value of caregiver effort in maintaining long-term ventilator-assisted ... consistency The Cronbach alpha was calculated as 0.89 Data collection The questionnaire was administered to the sampled caregivers by trained research assistants at their homes or at the community...
... history of mankind, space travel, continues to hold theinterestofthe general public As one ofthe greatest adventures inthe history of mankind, space travel continues to hold theinterestofthe ... frontrunner inscience communication Astronomy has a natural ability to fascinate and enthral, and can open young people’s minds to the beauty ofscience Astronomy can lead the way for other natural sciences ... information is passed through two other communication actors: thepublic information of cer and the journalist The narrowing ofthe funnel also indicates that a simplification ofthe information takes...
... said automatically, and dispatched a message to Harkaway with the information that the thor'glitch appeared to be metamorphosing again and that his presence was requested inthe captain's cabin The ... yourself again while we make ready for blastoff." "For shame," said the first officer as Harkaway stamped off "For shame!" "The captain's a hard man," observed the chief petty officer, who was lounging ... time they finally arrived on Flimbot, Harkaway had already gone native He appeared at the airlock wearing nothing but a brief, colorful loincloth of alien fabric and a wreath of flowers in his hair...
... "We are of opinion that the use of alcoholic liquor as a beverage is productive ofa large amount of physical disease." The publication of these later declarations was the beginning ofa marked ... menstruums of other active drugs when they are called for I also follow the plan of having the medicines administered with a free quantity of water, and with as accurate a dosage as can be obtained, for ... use glycerine for making what may be called our tinctures, and in my clinique I am introducing a series of 'waters' aqua ferri, aqua chloroformi, aqua opii, aqua quinæ, and so on to form the menstruums...
... Pachuca-Tulancingo, Mineral de la Reforma, Hidalgo 2Laboratory of Food Safety, University Centerof Exact Sciences and Engineering University of Guadalajara, Marcelino Garc a Barragán, Guadalajara, ... Exactly this chain of events led to a major outbreak affecting an international airline in 1984 A total of 631 passengers were infected after eating food containing an aspic glaze prepared by a ... contact with other poultryThe gastrointestinal tract of one or more birds may harbor Salmonella-and, if damaged during slaughter, may contaminate other carcasses Crosscontamination can also...
... regarding the spread of Salmonella among farm animals, we can find out that the importance of Salmonella as a cause ofhuman foodborne disease is decreasing, also thanks to the decline inthe spread of ... refrigeration is another safety measure together with other steps taken on the farm and during the processing as part of an integrated approach Interruption ofthe cold chain is a factor that increases ... tested a strain of adapted to acid S Typhimurium by constantly lowering the pH, finding out that the adaptation was not only due to the rebalance of intracellular pH, but also to a change in membrane...
... reported (Altuğ and Balkıs 2009) 2.1.3 The Sea of Marmara The Istanbul Strait connects the Sea of Marmara to the Black Sea and the Canakkale Strait to the Aegean Sea The Sea of Marmara separates Turkey’s ... (coastal areas) Northern Aegean Sea Southern part ofthe Sea of Marmara Northern Aegean Sea (0ffshore) Eastern Mediterranean Eastern Mediterranean (offshore) The Sea of Marmara 94 835 The Sea of Marmara ... L-LACTATE alkalinisation; AGLU: ALPHAGLUCOSIDASE; SUCT: SUCCINATE alkalinisation; NAGA: Beta-N-NCETYL-GALACTOSAMINIDASE; AGAL: ALPHA-GALACTOSIDASE; PHOS: PHOSPHATASE; GlyA: Glycine ARYLAMIDASE; ODC:...
... Hariyadi, R D.; Nuraida, S L & Fardiaz S (2005) Determination of contamination profiles ofhuman bacterial pathogens in shrimp obtained from Java, Indonesia Determination ofhuman pathogen profiles ... facilities may also contribute to the product contaminant load (Gecan et al., 1988) As a result, many factors including inadequate supplies of clean water, inadequate sanitary measures, lack of food ... literature indicates that the principal sources of Salmonella contamination are culture ponds, coastal water used for handling and processing of seafood (Hariyadi et al., 2005; Shabarinath et al.,...
... containing these bacteria means that the water was contaminated with the stool an this may contain typhoid germ Coliform bacteria shows the contamination with the stool with the safest manner The ... important of them is Escherichia coli which is main commensal bacteria ofthe intestine Existence of spore forming anaerobe bacteria inthe absence of other bacteria shows an old contamination ... are harmless Some of them may infect humans and animals These bacteria may reproduce only under certain circumstances Dissemination may be from human to human, from animal to human or from human...
... precipitated area (Figure 5) Fig Appearance of typical Salmonella colonies in Mac Conkey agar 5.1.3.3 Appearance of Salmonella colonies in Salmonella Shigella agar (SS) Typical Salmonella colonies are ... in our country Salmonella paratyphi A is added for many times Bacteria such as Salmonella paratyphi C are also important in another countries Both O and H antigens of bacteria are used separately ... Agglutinins may exist normally inthe serum H agglutinins of Salmonella typhi and Salmonella paratyphi B may be 1/40 titration and O agglutinins may be as 1/50 titration Therefore, reaction is started...
... past years both inthepoultryindustry and in humans (Nógrády et al., 2008) National and international regulations determine the absence of Salmonella spp in 25 grams of sample, including poultry ... Brazil, Chile, Argentina, Peru, Uruguay, Paraguay and Ecuador (Franco et al., 2003) According to the National Health Surveillance Agency in Brazil [ANVISA; Agência Nacional de Vigilância Sanitária], ... Jesudhasan, P.; Jayaprakasha, G.K.; Pillai, S.D & Patil, B.S (2008) Grapefruit juice and its furocoumarins inhibits autoinducer signaling and biofilm formation in bacteria International Journal of...
... Curitiba, PR Anais , Campinas: FACTA, 1996 p.57 Nakamura, M.; Nagamine, N.; Takashi, T.; Suzuki, S.; Sato, S (1994) Evaluation ofthe efficacy ofa bacterin against Salmonella Enteritidis infection ... on the final product (SAGARPA, 2 011) 1.1 Fresh produce production inthe state of Sinaloa One ofthe main activities in Sinaloa is the agriculture Sinaloa state is located at the northwest of ... the problem, and resistance rates vary from place to place, depending on the local use of antibiotics One ofthe major concerns ofthepoultryindustry is maintaining the sanitary status of the...
... significant role in transmitting AMR to Salmonella in humans and that the occurrence of resistance in animal isolates may not translate directly into resistance inhuman isolates in this area Acknowledgements ... metropolitan area In that study, Salmonella was isolated from 3.0% ofthe 825 meat samples, and chicken had a Salmonella contamination rate of 4.2% Furthermore, the percentage of Salmonella recovered in ... retail stores may occasionally be contaminated with Salmonella possessing a varied spectrum of antimicrobial resistance The contamination was dependent on the type of meat and the time of sampling...
... Yokoyama, T Honda, and K Mizuno, 2009 Efficacyof a novel trivalent inactivated vaccine against the sheddingof Salmonella inachicken challenge model.Avian Dis53:281–286 Di Giacinto, C., Marinaro, ... greatly reduce mortality and reduce the duration and magnitude of disease Inthe intestinal lumen, host pressures against the infection may not be as severe and many Enterobacteriaceae are capable ... mucosal surface ofthe gastrointestinal tract is a promising area of work Several such molecules may enhance the response to these recombinant vaccines (Layton et al., 2009; O’Meara et al., 2010;...
... dried, the agar plate was incubated at 37°C for 18 h At the end ofthe incubation, the agar plate was read using a magnifying glass through the bottom ofthe plate (Ward et al., 1987) Phage susceptibilities ... the ability to acquire and analyze the data as a gel image, electrophorogram or ina tabular data format will allow comparison of patterns among different laboratories or within databanks (Savelkoul ... Salaberria, A. E.; Maldonado Garcia, A. ; Valdezate Jimenez, S.; Carbonero Martinez, A. ; Aladuena Garcia, A. , & Casas, A. A (2007) Surveillance Inhibitory Effect of Plant Extracts on Salmonella...
... I) 1: CATTGATGCCATGGGTGACART McCarthy et al., 2009 2: CGTGACGATAATCCGTGTAC 3: TACACGAGTCACTAAATCCTTCAGT (Set II) Table Detection of Salmonella using real-time PCR.increase ofthe released dye ... have been presented Taking samples for tests The first stage of microbiological analysis of food consists in taking and preparing a sample for analyses Incorrect sampling can lead to obtaining ... species-specific Salmonella PCR assays is the invasion protein invA gene, and several invA-based PCR assays have been already developed and validated (Malorny et al 200 3a; b) 402 Salmonella – A Dangerous...