To determine whether the DDRT-PCR clones identified and characterized from PRRSV-infected Mø were specific to this pathogen or instead result from a general viral response molecular prog[r]
(1)Molecular Responses of Macrophages to Porcine Reproductive
and Respiratory Syndrome Virus Infection
Xuexian Zhang,* Jinho Shin,† Thomas W Molitor,† Lawrence B Schook,* and Mark S Rutherford*,1 *Department of Veterinary Pathobiology and†Department of Clinical and Population Sciences,
College of Veterinary Medicine, University of Minnesota, St Paul, Minnesota 55108 Received April 1, 1999; returned to author for revision June 29, 1999; accepted July 20, 1999
The detailed mechanism(s) by which porcine reproductive and respiratory syndrome virus (PRRSV) impairs alveolar Mø homeostasis and function remains to be elucidated We used differential display reverse-transcription PCR (DDRT-PCR) to identify molecular genetic changes within PRRSV-infected Mø over a 24 h post infection period From over 4000 DDRT-PCR amplicons examined, 19 porcine-derived DDRT-PCR products induced by PRRSV were identified and cloned Northern blot analysis confirmed that four gene transcripts were induced during PRRSV infection PRRSV attachment and penetration alone did not induce these gene transcripts DNA sequence revealed that one PRRSV-induced expressed sequence tag (EST) encoded porcineMx1, while the remaining clones represented novel ESTs A full-length cDNA clone for EST G3V16 was obtained from a porcine blood cDNA library Sequence data suggests that it encodes an ubiquitin-specific protease (UBP) that regulates protein trafficking and degradation In pigs infectedin vivo, upregulated transcript levels were observed forMx1 andUbpin lung and tonsils, and forMx1 in tracheobronchial lymph node (TBLN) These tissues correspond to sites for PRRSV persistence, suggesting that theMx1 andUbpgenes may play important roles in clinical disease during PRRSV infection © 1999 Academic Press
INTRODUCTION
Porcine reproductive and respiratory syndrome (PRRS) is prevalent in Europe, North America, and Asia, and leads to significant economic losses in the swine indus-try PRRS virus (PRRSV), the causative agent, was iden-tified in 1991 in the Netherlands (Wensvoortet al.,1991) and in 1992 in the United States (Collins et al.,1992). PRRSV infection presents as reproductive failures through premature farrowing and/or interstitial pneumo-nia characterized by alveolar wall thickening with mac-rophage (Mø) and necrotic cell debris PRRSV is a small enveloped RNA virus of the familyArteriviridae (Conzel-mannet al.,1993), orderNidovirales(Cavanaugh, 1997), and contains an approximately 15 kb positive strand RNA genome PRRSV structural proteins encoded from open reading frames (ORF) to were identified as glycopro-tein (GP)2 (29–30 kDa), GP3 (45–50 kDa), GP4 (31–35 kDa), major envelop protein (E; 24–26 kDa), a viral mem-brane protein (M; 18–19 kDa), and a nucleocapsid (N; 15 kDa) (Meulenberget al.,1996; Meulenberg et al.,1995; van Nieuwstadt et al., 1996) The E protein is strongly cytotoxic via induction of apoptosisin vitro(Sua´rezet al., 1996) As yet, the functions for GP2, GP3, and GP4 have not been elucidated
Arteriviridaereplicate primarily within Mø, and porcine alveolar Mø are a primary target cell for PRRSV replica-tionin vivo(Molitoret al.,1996; Wensvoort et al.,1991) PRRSV replication in alveolar Mø is associated with cytopathic effects (CPE; Rossow, 1998) PRRSV infection decreases alveolar Mø release of superoxide anion (Thanawongnuwech et al.,1997) and the number of al-veolar Mø in the lung (Planaet al.,1992) It is presumed that altered alveolar Mø function is linked to the apparent increased incidence of pulmonary bacterial co-infections in PRRSV-infected herds (Kobayashiet al.,1999; Thana-wongnuwech et al.,1997) The high incidence of respi-ratory microbial co-infection in chronically infected herds suggests that PRRSV interferes with host Mø activities used to clear respiratory pathogens However, the mo-lecular pathways by which PRRSV infection disrupts nor-mal Mø homeostasis have not been elucidated
Once an intracellular pathogen such as a virus in-vades a host cell, the interactions become physiological and biochemical as well as immunological Pathogens that replicate within host cells usurp host biological processes for their own benefit In response, the host cell manipulates gene expression to inhibit those path-ways or processes required or induced by the pathogen Viruses in particular subvert host cell metabolism in such a way that viral components can be synthesized via host cell pathways to initiate viral replication Viral particles, viral components, and virus-induced cellular factors all have the potential to alter host cell gene expression
1To whom reprint requests should be addressed at 1988 Fitch
Avenue, Room 295 Fax: (612) 625-0204 E-mail: ruthe003@tc.umn.edu Article ID viro.1999.9914, available online at http://www.idealibrary.com on
0042-6822/99 $30.00
Copyright © 1999 by Academic Press All rights of reproduction in any form reserved
(2)Molecular genetics and cell biology can be implemented to define the specific host cell molecules and cellular components with which virus-encoded molecules inter-act
Differential display reverse transcription polymerase chain reaction (DDRT-PCR) is a powerful approach used to directly compare gene expression between cells or tissues at specific physiological states (Bhattacharjeeet al., 1998; Liang et al., 1992) DDRT-PCR provides an unbiased mRNA fingerprint for direct observation of cDNAs PCR amplified to different levels reflective of relative transcript levels within a total RNA sample By using a reverse transcription/PCR primer that anchors on the nucleotide just 59of the poly(A) tail, DDRT-PCR spe-cifically reverse transcribes only a subset of the mRNAs PCR is then performed using the 39-anchor primer and an arbitrary 59primer to amplify 100–400 fragments of the cDNAs generated by reverse transcription Recently, DDRT-PCR has been used to describe host cell genetic responses to infection by pseudorabies virus (Hsianget al.,1996), cytomagolovirus (Zhuet al.,1997), HIV (Sorbara et al.,1996), herpes simplex virus (Tal-Singeret al.,1998) and rhabdovirus (Boudinotet al.,1999) We hypothesized that PRRSV infection alters alveolar Mø homeostatic gene expression, leading to compromised host defenses in the lungs of infected animals The effect of PRRSV infection on alveolar Mø gene expression was therefore observed by monitoring changes in gene expression using DDRT-PCR We identified 19 porcine Mø-derived DDRT-PCR amplicons induced during a 24 h in vitro infection period Many of these transcripts appear to encode previously unknown gene products Further, we confirmed that four of these genes are induced during PRRSV infection, and are induced in vivo in tissues where PRRSV persistently resides, suggesting that they
may provide insight for understanding host cell molecu-lar responses during PRRSV pathogenesis
RESULTS
PRRSV replication and altered gene expression in alveolar Mø
Alveolar Mø were infected using PRRSV strain VR2332 (m.o.i.5 0.1)in vitro CPE was not observed until 16 h post infection and was less than 10% at 24 h post infec-tion At 72 h post infection, CPE was more than 70% (data not shown) To identify differentially expressed mRNAs during PRRSV infection, we collected total cellular RNA from mock- and PRRSV-infected porcine alveolar Mø at 4, 12, 16, and 24 h post infection PRRSV genome replica-tion was confirmed via RT-PCR detecreplica-tion of accumulareplica-tion for ORF sequences of PRRSV genomic RNA (Fig 1) PRRSV ORF transcript levels increased with time, dem-onstrating active viral genomic replication in alveolar Mø Mø mRNAs differentially expressed during PRRSV in-fection were detected by DDRT-PCR comparison against mock-infected alveolar Mø at various times post infec-tion For each DDRT-PCR primer pair, duplicate RNA samples from each time point were reverse-transcribed, PCR amplified, and fractionated on adjacent lanes to ensure DDRT-PCR accuracy and reproducibility Repre-sentative DDRT-PCR reactions are shown in Fig PRRSV infection induced (Fig 2A) or suppressed (data not shown) several alveolar Mø transcripts Using 16 of the possible upstream various septamer H-AP primers (GenHunter), over 4000 DDRT-PCR products were visu-ally compared for band intensity Twenty DDRT-PCR products that were reproducibly induced (.twofold dif-ference compared to mock-infected cultures) in both DDRT-PCR reactions for a given RNA sample during a
FIG 1.PRRSV replication in PRRSV-infected alveolar Mø RT-PCR was performed with 59primer/39primer (PRRSV ORF 7-specific primers) Blank is a negative PCR control without RT mixture M is 100 bp DNA ladder Arrow indicates the PCR product (508 bp)
(3)24 h PRRSV infectionin vitro (Table 1) All differentially expressed DDRT-PCR products were extracted from acrylamide gels, reamplified, and cloned into pBluescript SKII (Stratagene) DDRT-PCR amplicons that showed al-tered levels in only one of two identical samples were not considered further
Amplicon sequence analysis
To determine whether DDRT-PCR clones were derived from porcine cellular genes or from the PRRSV genome, all 20 PRRSV-induced DDRT-PCR amplicons were se-quenced One DDRT-PCR clone encoded a portion of the PRRSV ORF2 (data not shown) and was removed from further study Only of the remaining 19 PRRSV-induced transcripts matched previous GenBank submissions (Ta-ble 1) Our particular DDRT-PCR application utilizes a reverse transcription primer anchored at the last nucle-otide 59to the poly(A) tail, and PCR conditions that favor amplification of 200–400 bp amplicons As expected for short cDNAs derived from the 39 end of mRNAs, no significant open reading frames or known conserved protein functional domains could be detected in the PRRSV-induced, novel cDNAs Clone G12V24
repre-sented the porcine Mx1 cDNA as determined by 99% nucleotide sequence similarity Mx1 is a previously de-scribed interferon-inducible protein with allelic associa-tion to viral resistance/susceptibility phenotypes in mice (Horisberger, 1995)
Confirmation of DDRT-PCR results
DDRT-PCR is a powerful approach to identify and iso-late uniquely expressed genes (Liang and Pardee, 1992), but it is a semi-quantitative technique with a high false positive rate and artifacts Template abundance, primer sequence specificity, primer availability, PCR cycle num-ber, and amplification efficiency can each affect DDRT-PCR amplicon accumulation Therefore, in addition to simultaneously comparing duplicate RNA samples and DDRT-PCR reactions, it was necessary to confirm the expression patterns observed in the DDRT-PCR profiles All 19 PRRSV-induced porcine Mø DDRT-PCR clones were screened by Northern blot analysis against total cellular RNA from mock- and PRRSV-infected porcine alveolar Mø Three clones gave no signal on Northern
TABLE
PRRSV-Induced DDRT-PCR Amplicons
Clone
DDRT-PCR levels (24 H)a
Insert
size (bp) Identity or similarity (%) Mock PRRSV
A2V16-22b 1 11 255 Novel ESTc
A2V16-23 11 188 Novel EST
A4V12-22 11 187 BovineaS1-casein (84%)
A5V12-11 111 214 Novel EST
A12V24-11 111 307 Novel EST
A12V24-21 11 307 Novel EST
C3V16-11 11 188 Novel EST
C3V16-32 11 252 Novel EST
C7V16-11 11 238 Novel EST
C7V16-31 11 259 Human thioredoxin (87%)
C7V16-41 11 341 Bovine NADH-ubiquinone
oxidoreductase (93%)
C7V16-52 111 436 Human galactin-3 (90%)
C12V16-21 11 352 Novel EST
G2V12-11 11 208 Novel EST
G3V16-11 111 240 Novel ESTd
G4V12-11 11 290 Novel EST
G12V24-11 11 316 Novel EST
G12V24-12 111 317 Porcine Mx1 (99%)
G13V16-21 11 264 Novel EST
aThe intensity of the DDRT-PCR products was graded visually from
DDRT-PCR gels exposed to film Relative band intensity is denoted1 to111, and2denotes no DDRT-PCR product
bClones in bold were subsequently confirmed by Northern blotting to
be induced by PRRSV infection of porcine alveolar Mø
cDDRT-PCR amplicons were considered novel ESTs if they had
, 70% identity over a continuous 100-bp sequence
dClone G3V16 was subsequently determined to encode a ubiquitin
protease
(4)blot analysis (data not shown), suggesting that they were either cloning artifacts or represented sequences ex-pressed at levels too low to detect by this technique Our previous experience has shown that as many as 40% of DDRT-PCR clones require more sensitive RT-PCR or ri-bonuclease protection assays (RPA) for quantification (Bhattacharjee et al., 1998) An additional 12 PRRSV-induced DDRT-PCR clones showed less than twofold induced expression on Northern blots (data not shown) and their expression was not further investigated The four remaining DDRT-PCR clones were confirmed by Northern blot analysis to be induced by PRRSV infection (Fig 3) All transcripts were induced by PRRSV infec-tion, exhibited distinct expression levels, and were of different sizes (data not shown) These data support that each clone was derived from a transcript representing a unique amplicon
Temporal accumulation of the molecular markers iden-tified by DDRT-PCR during PRRSV infection was deter-mined Total cellular RNA was isolated from alveolar Mø from to 36 h after treatment with medium alone, con-ditioned medium from CL2621 cells used to generate infectious PRRSV preparations, UV-irradiated PRRSV, and PRRSV Transcripts detected by DDRT-PCR clones A5V12, G3V16, G2V12, and G12V24 increased concomi-tant with PRRSV replication (Fig 3) Transcripts detected by A5V12, G2V12, and G3V16 were not detected until 16 h post infection, whereas G12V24 transcripts were induced as early as h post infection (Fig 3) Gene transcripts were not induced in medium control cultures or in Mø treated with CL2621 cell-conditioned medium Impor-tantly, Mø infected with UV-irradiated PRRSV, which can bind to and penetrate Mø but not replicate, did not
express detectable levels for any of the transcripts ex-amined (Fig 3) Together, these data indicate that active PRRSV genomic replication within Mø is required for induction of gene expression for these selected ampli-cons
Common molecular responses of porcine alveolar Mø
To determine whether the DDRT-PCR clones identified and characterized from PRRSV-infected Mø were specific to this pathogen or instead result from a general viral response molecular program, transcript expression was determined for porcine alveolar Mø infected with pseu-dorabies virus (PRV)in vitro As was observed for PRRSV, all transcripts were induced by PRV infection (Fig 4) However, the kinetics of expression were different Tran-scripts appeared sooner and peak expression levels were higher compared to PRRSV-infected cultures, per-haps reflecting the more severe disruption of Mø ho-meostasis and CPE for PRV (data not shown) Further, transcripts for G2V12 dissipated by 24 h in PRV-infected cultures, suggesting that it is only transiently expressed by virally-infected cells Thus, induction of these tran-scripts appears to reflect a generalized Mø molecular response to intracellular viral replication
Identification of a full-length cDNA clone
To further characterize PRRSV-induced porcine Mø genes, a porcine peripheral blood cell cDNA library was screened using clone G3V16 as a probe A phage clone was isolated via plaque lift hybridization and contained an insert (1.7 kb) of approximately the same size as the mRNA (data not shown), suggesting that it contained a
FIG 3.Temporal transcript expression in PRRSV-infected Mø determined by Northern blot Total cellular RNAs (10mg per lane) were collected from mock- and PRRSV-infected Mø at - 36 h post infection, and hybridized against DDRT-PCR cDNAs as shown Medium indicates cultures treated with RPMI 1640 with 10% fetal bovine serum CL2621 denotes cultures receiving only supernatant from mock-infected CL2621 cells UV-PRRSV denotes cultures receiving UV-inactivated PRRSV infection GAPDH transcripts were quantitated to normalize for RNA loading
(5)full-length cDNA DNA sequence determination (Acces-sion number AF134195) of the isolated cDNA clone con-firmed that it contained a full-length coding sequence, which included a 39 untranslated region (UTR, 572bp), coding sequence (966 bp), and a 59 UTR (172bp) De-duced amino acid sequence identified a conserved Cys domain (block entry, BL00972A) and a His domain (block entry, BL00972D) (Fig 5A), which are thought to act as active sites for ubiquitin-specific proteases (UBPs; Wilkinson, 1997) Further, a GenBank data search and analyses by Blast (NCBI, NIH) and FEX (Find exon pro-gram, Sanger Center, UK) indicated that a putative hu-man homolog is located at chromosome 22q11.2 The putative human UBP has eight ORFs derived from ap-proximately 15 kb of genomic DNA (Fig 6) The amino acid similarity and identity of porcine UBP with the pu-tative human UBP were 81% and 75%, respectively (Fig 5B) These results indicate that porcine UBP is a novel member of an UBP superfamily, and suggest that intra-cellular protein trafficking, turnover or degradation may be altered during PRRSV infection of porcine alveolar Mø The identities or putative function for PRRSV-induced ESTs A5V12 and G2V12 have not yet been established
Tissue specific expression inin vivoPRRSV-infected
animals
To determine whether expression of DDRT-PCR prod-ucts identified in vitro reflected events during PRRSV infectionin vivo, we examined tissue-specific expression of DDRT-PCR amplicons in PRRSV-infected pigs Whole tissues were collected at 14 days post infection from
PRRSV-infected pigs and mock-infected pigs Quanti-tative RT-PCR demonstrated the presence of PRRSV genomic RNA in lungs, lymph nodes, and tonsils (data not shown) Tissue RNAs from identically treated animals were pooled to minimize animal-to-animal variation, and RT-PCR was performed for 14 and 17 cycles, which we have determined is in the linear range of amplification (data not shown) Products were transferred onto mem-branes for Southern blot analysis via hybridization to cDNA probes for porcine Mx1 and Ubp (Fig 7) PCR amplicon levels for each tissue sample were normalized to HPRT amplicon levels, and normalized values for each tissue were compared between mock- and PRRSV-in-fected animal (Fig 7) Porcine Ubp transcripts were greatly upregulated during PRRSV infection in the lungs (4.5-fold) and tonsils (11.4-fold), but were reduced 30% in TBLN from PRRSV-infected animals In contrast, Mx1 transcripts were greatly induced in all three tissues (Fig 7) Taken together, these data show (1) constitutive ex-pression for these genesin vivo; (2) tissue-specific reg-ulation of gene expression; and (3) PRRSV-induced up-regulation of transcript levels in tissues where PRRSV is persistent
DISCUSSION
PRRSV infection causes significant losses in the swine industry, in part due to poor growth associated with interstitial pneumonia (Rossow, 1998) PRRSV infectionin vivois thought to be a contributing factor that results in increased secondary pulmonary bacterial infections fol-lowing impairment of Mø function in the lungs Toward
(6)this end, recent evidence describes slightly impaired killing ofHaemophilus parasuisandStaphylococcus au-reusby PRRSV-infected alveolar Mø (Solanoet al.,1998; Thanawongnuwech et al., 1997) However, conflicting data exists While PRRSV-infected Mø demonstrate re-duced reactive oxygen product formation (Done and Pa-ton, 1995; Thanawongnuwechet al.,1997) and late-stage inhibition of bacterial phagocytosis (Solanoet al.,1998), phagocytosis of opsonized S aureus (Thanawongnu-wechet al.,1997) orH parasuis(Segale´set al.,1998) is
not impaired Pro-inflammatory cytokine gene expres-sion, including TNF-a, IL-8, IFN-a and IL-1b does not appear to be significantly altered (Buddaertet al.,1998; Trebichavsky and Valicek, 1998; Zhang and Rutherford, 1997) Further, a systemic impairment of host immunity during persistent PRRSV infection is not supported (Al-bina et al., 1998) Hence, we have used a DDRT-PCR mRNA fingerprinting approach to identify molecular re-sponses during PRRSV infection of porcine alveolar Mø We now report that PRRSV infection alters host Mø gene FIG 5.Conserved domains and human homology of porcine UBP amino acids (A) Positions of the conserved amino acid sequence domains that contains Cys residue and His residue in ubiquitin-specific protease (UBP) superfamily are shown in standard single letter code Bold letters indicate identity with porcine UBP with other members in these two domains The aligned gene accession numbers are: UBPH-human, Q93009; FAFX-human, Q93008; UBP41-human, AF079564; UBPY-human, P40818; UBP41-mouse, AF079565; UBP41-chicken, AF016107; FAF-flies, A49132; UBPE-flies, Q24574; UBP8-yeast, P50102; UBPF-yeast, P50101; UBPB-schpo, Q09738; UCH-putative, AL021889 Numbers in parentheses are the amino terminus position of conserved domain in UBPs (B) Alignment of porcine UBP amino acid and a putative human UBP homolog with Gap program (GCG) Blast search (NCBI, NIH) was performed for the entire G3V16 cDNA sequence Further, FEX (find exon, http://genomic sanger.ac.uk/) was used to find the human homolog Human sequence was derived from genomic DNA sequence (AC005500) Letters in bold denote the conserved Cys and His domains Asterisks denote translational stop
(7)expression programs, including a ubiquitinated protein degradation pathway and the induction of novel genes of unknown function
Molecular characterization of PRRSV infection will per-mit us to identify and isolate important host cell molec-ular responses associated with PRRSV infection How-ever, it is clear from ourin vivostudies (Fig 7) that factors within individual tissues can impact the molecular phe-notype of the tissues and the infected cells therein Further, temporal effectsin vivoare difficult to gauge on a per cell basis due to the continuous influx of immune cells through secondary lymphoid organs and inflamma-tory sites, leading to asynchronous infection times The in vivomolecular status of a tissue reflects a wide range of effects, particularly for tissue Mø that display signifi-cant functional and molecular heterogeneity between tissues and stages of differentiation (Rutherford et al., 1993) Consistent with this premise, PRRSV tropism for
Mø is greatly dependent on Mø origin, state of differen-tiation, and level of activation (Duanet al.,1995; Molitor et al.,1996) Thus, tissue-specific regulation of Mx1 and Ubpgene expression is not unexpected, and may reflect changes in the number of tissue macrophages Further, while these gene transcripts were identified in Mø cul-tures, the cell(s) that express these transcripts in vivo and their spatial distribution in relation to virus-contain-ing cells await elucidation
Initial experiments used both cell culture medium and CL2621 cell-conditioned medium as control treatments for confirming DDRT-PCR results This was necessary in that PRRSV viral stocks were propagated using the CL2621 cell line Our results showing that CL2621 con-ditioned medium or UV-inactivated PRRSV stocks did not induce Mø expression of these genes suggests that components within the CL2621 cell culture supernatant itself not account for our DDRT-PCR findings On the
FIG 6.Putative humanUbpgene structure Eight exons were mapped in human genomic DNA from to Each solid box indicates an exon ATG is the start codon and TGA is the stop codon
(8)other hand, PRRSV attachment and penetration also likely impacts host cell gene expression Again, our data suggest that PRRSV attachment and penetration alone was not sufficient to induce expression of the four genes examined here (Fig 3) This is in contrast to Zhuet al., (1997) who reported that human cytomegalovirus in-duces host cell mRNA accumulation via original viral particles and not viral replication in host cells Recently, Boudinotet al.,(1999) reported that a glycoprotein from hemorrhagic septicemia virus (VHSV) in fish directly in-ducedvig-1 gene expression Failure to observe attach-ment-induced transcripts may be due to the fact that, compared to actively infected cultures, a lower percent-age of host cells experience viral attachment and pene-tration in cultures treated with UV-inactivated PRRSV (m.o.i is 0.1), with subsequently fewer attachment-in-duced transcripts being present in these cultures A higher titer infection may help identify viral attachment effects on host cell transcripts We are also incorporating a more sensitive RT-PCR screening for DDRT-PCR clones that not detect transcripts by Northern blot screening Finally, we have used only 16 of the possible 80 DDRT-PCR primer pairs, and further characterization of addi-tional DDRT-PCR clones may also reveal transcripts al-tered as a direct result of PRRSV attachment
Interferons (IFN) play an important role in host defense against viruses, in part via the induction of cellular genes (Staeheli, 1990; Zhuet al.,1997) that includeMxgenes The Mx1 gene was originally isolated as a viral resis-tance gene from mice (Lindenmann, 1964) having two alleles, Mx1 (resistant, dominant) and Mx- (susceptible, recessive).Mx1 gene homologues have been described in other mammalian species, including pigs (Horisberger and Gunst, 1991) Mx1 inhibits primary transcription of parental influenza viral genomes in mice (Krug et al., 1985) In humans, the Mx1-encoded MxA protein is in-duced by type I IFNs, double-stranded RNA, and several viruses, including influenza virus and Newcastle disease virus in human embryonic cells (Aebiet al.,1989) and HIV in monocytes (Baca et al., 1994) We now report that PRRSV infection of Mø induces porcineMx1 expression, either directly or subsequent to PRRSV-induced IFN pro-duction in infected cultures
The kinetics ofMx1 gene activation are very fast, and MxA accumulation is detectable within h post infection (Horisberger, 1995), consistent with our observations The functional significance for porcineMx1 gene expres-sion in PRRSV infection is unknown Based on Mx1 activities in other species and PRV induction of Mx1 expression in porcine Mø, this gene product is likely to be involved in host cell protection against viruses in general, either following infection directly or via IFN released by neighboring cells which harbor the virus However, Mx1 mRNA accumulation did not prevent PRRSV or PRV replication in porcine alveolar Mø Thus, its importance during PRRSV infection, maintenance of
Mø homeostasis, and development of CPE is unclear It is interesting to note a recent report that describes pig breed differences in tissue lesions to a high virulence strain of PRRSV (Halbur et al., 1998) It is presently unknown whetherMx1 alleles exist in pigs and whether they associate with viral resistance/susceptibility pheno-types as observed in mice (Lindenmann, 1964)
UBP comprises a protein superfamily in which more than 60 UBPs have been identified in different species (Wilkinson, 1997) Identification of a PRRSV-induced UBP is the first such protein described in pigs UBPs specif-ically hydrolyze ester, thiol ester, and amide bonds to the carboxyl group of G76 of ubiquitin in which ubiquitin conjugates with target proteins that will be degraded by proteasome 26 (Hochstrasser, 1995; Goldberg, 1995; Pickart, 1997) Ubiquitin modification and deubiquitina-tion by UBPs is increasingly recognized as important protein regulatory strategies that impact cell cycle regu-lation (Pagano, 1997), cellular growth moduregu-lation (Zhuet al.,1996), transcription activation (Trier et al., 1994), an-tigen presentation by MHC class I (Rocket al.,1994), and DNA repair and differentiation (Hochstrasser, 1995) Por-cine Ubp gene expression induced by PRRSV may be involved in regulating protein metabolism via a ubiquitin-conjugated pathway This could benefit the host cell in that removing ubiquitin from host proteins prevents them from being moved to the proteasome, helping to maintain Mø protein levels in the face of viral disruption of host translation Conversely, the virus may induce UBP to prevent newly synthesized viral proteins from being de-graded Finally, Ubp gene induction may disrupt Mø antigen presentation, thereby compromising host im-mune responses to subsequent bacterial challenge
By sequence data analysis, we determined that por-cineUbpis homologous to a putative humanUbpthat is located at the DiGeorge critical region (DGCR) on chro-mosome 22q11 (Fig 6) The recently identifiedUfd1 gene encodes a protein involved in degradation of ubiquiti-nated proteins (Yamagishi et al.,1999), suggesting that regulation of ubiquitinated protein degradation contrib-utes to congenital heart and craniofacial defects in the mouse embryo (Yamagishi et al., 1999) The detailed molecular mechanism by which PRRSV infection leads to sow abortion is unknown and porcine Ubp may play a role in fetal death However, similar cardiac and cranio-facial defects in PRRSV-aborted fetuses have not been reported
(9)ruses and host cells can be delineated via DDRT-PCR cloning of novel genes and subsequent characterization of gene expression involved in the altered host cell homeostasis
MATERIALS AND METHODS Cells, viruses, and pigs
Six- to eight-week old pigs were selected from healthy and PRRSV-negative pig populations Alveolar Mø were collected by lung lavage (Leeet al., 1996) Lungs were washed 2–4 times with phosphate-buffered saline (PBS, pH 7.2) Each wash was centrifuged at 1200 rpm at 4°C for 10 Cell pellets were mixed, washed again in PBS, and then resuspended in 20–50 ml of RPMI 1640 Mø were incubated overnight at 37°C, 5% CO2in RPMI 1640 medium supplemented with 10% fetal bovine serum, mM L-glutamine, 0.1 mM nonessential amino acids, 25 mM HEPES, and antibiotics before viral infection
ATCC PRRSV strain VR2332 (passage 9, 53106PFU/ ml) and CL2621 cell culture supernatant were obtained from Dr K S Faaberg (University of Minnesota) PRRSV suspension (m.o.i.50.1) or medium was inoculated after washing Mø monolayers For UV inactivation, PRRSV stock placed in a 10 cm-diameter petri dish was irradi-ated using an UV-Crosslinker (Stratagene Corp., La Jolla, CA) with 120mJ/cm2for 15 Pseudorabies virus (PRV) strain 086 was used to infect porcine alveolar Mø (m.o.i
50.1)in vitro.
Forin vivoinfection, six-week-old pigs obtained from a PRRSV seronegative farm were infected intranasally with 105 TCID50of PRRSV strain VR2332 or PBS as a control. Serum samples were collected at Day 0, 2, 5, 7, 10, and 14 post-infection, and stored at -80°C (data not shown) Tissues were collected at 14 days post-infection and immediately placed into TRIzol (Life Technologies, Grand Island, NY) reagent and frozen in dry ice/ethanol All tissues were stored at280°C until used
Total cellular RNA isolation and Northern blot analysis
Total cellular RNA was extracted from alveolar Mø cultures and tissues using TRIzol Reagent (Life Technol-ogies) according to the manufacturer’s protocol RNA integrity was evaluated on 1% agarose gels with formal-dehyde (0.4 M) after staining with ethidium bromide For DDRT-PCR analyses, trace genomic DNA contamination was removed with MessageClean (GenHunter Corp., Nashville, TN) before performing reverse transcription For Northern blots, total cellular RNAs (10mg per lane) were fractionated on 1% agarose-0.4 M formaldehyde gels, transferred to nylon membranes (Schleicher & Schuell, Keene, NH), and cross-linked using a UV-Crosslinker (Stratagene) The cDNA probe was labeled by random primer labeling (Life Technologies) following
the manufacturer’s protocol Hybridization was carried out at 42°C in 10 ml of solution containing x SSPE, 50% formamide, 0.5% SDS, x Denhardt’s reagent, and 100
mg/ml sonicated salmon sperm DNA overnight The hy-bridized membrane was washed twice with x SSC/0.1% SDS for 15 at room temperature, followed by 0.1 x SSC/0.1% SDS at 55°C for 20 Blots were exposed to film overnight at -80°C or quantitated by phosphorimag-ery (Molecular Dynamics, Sunnyvale, CA)
Differential display assays
DDRT-PCR was performed as previously described (Bhattacharjee et al., 1998) First-strand cDNAs (20 ml) were synthesized for each RNA sample separately using one of three H-T11M anchor primers (where M is G, A, or C, GenHunter Corp.), 0.2–0.4mg total cellular RNA, 4ml x RT buffer, 20mM dNTPs, and 200 U of Superscript II reverse transcriptase (Life Technologies) at 42°C for h PCR reactions (10ml) were performed using the RNAim-age Kit (GenHunter) and contained x PCR buffer, 2mM dNTPs, 0.2 mM 59 H-AP primer/39 H-T11M anchored primer, 0.15ml [a-33P] dATP (2500 Ci/mM, Amersham), 1
ml reverse transcription product, and U AmpliTaq DNA polymerase (Perkin–Elmer) The PCR cycling profile was 94°C for min, [94°C for 30 s, 40°C for min, 72°C for 30 s] for 40 cycles, then 72°C for Denatured DDRT-PCR products were loaded onto a 6% denaturing polyacrylamide DNA sequencing gel, and run for 3.5 h The gel was blotted onto filter paper, dried under vacuum on a gel dryer at 80°C for h, and then exposed to film at room temperature for 16–24 h Amplicon intensities were compared visually for each infection time across duplicate samples, and differentially expressed ampli-cons were prepared as described (Bhattacharjeeet al., 1997) Briefly, bands were excised from acrylamide gels, placed in 100ml of dH2O for 10 min, and then boiled for 15 DDRT-PCR products were collected by centrifug-ing for and stored at220°C Reamplified cDNAs were purified from the 2% agarose gel using the QIAEX II kit (Qiagen Corp., Chatsworth, CA), and then stored at
220°C for cloning and hybridizing analysis
DDRT-PCR Amplicon cloning and sequencing
(10)Plasmid DNA from clones with insert was prepared by miniprep (Qiagen) DNA sequencing was performed on an Applied Biosystem 377 Automatic DNA sequencer (Perkin–Elmer) in the Advanced Genetic Analysis Center, College of Veterinary Medicine, University of Minnesota Sequences were analyzed by a BLAST search (NCBI, NIH) The accession numbers are: AF102503 for clone A5V12, AF102504 for clone G3V16, AF102505 for clone G2V12, AF102506 for clone G12V24 and AF134195 for porcineUbp.
Reverse transcription PCR assay
Reverse transcription (20ml) was performed as above using total cellular RNA (2mg) The reaction was stopped by heating to 70°C for 10 min, and RT products were treated with RNase H (Promega Corp., Madison, WI) for 20 at 37°C PCR reactions (25ml) were performed with RT product (1ml), 10 x PCR buffer, 25mM dNTPs, 0.2
mM each of 59primer and 39primers, and U of Ampli-Taq DNA polymerase (Perkin–Elmer) The primer pairs used were:Mx1: 59primer GCTTGAGTGCTGTGGTTG/39 primer GGACTTGGCAGTTCTGTGGAG; Ubp: 59 primer
AGGGGCCAAGCTCATGTGAC/39 primer
GTGGCCAG-CATACCATCTCC Primer sequences and PCR profile for porcine hypoxanthine phosphoribosyltransferase (HPRT) have been described (Fosset al.,1998) Each cDNA was amplified for 14 cycles and 17 cycles (linear range, data not shown) Amplicons were analyzed by Southern blot hybridization against DDRT-PCR probes Signals were quantified by phosphorimagery (Molecular Dynamics)
Isolation of cDNA clones
A pig cDNA library (kindly provided by Dr C W Beat-tie, University of Minnesota) prepared from peripheral blood cells and cloned in Uni-ZAP XR Vector (Stratagene) was screened with DDRT-PCR clone G3V16 The probe was labeled with [a232P] dATP by the random priming (Life Technologies), and hybridization was performed as described for Northern blots A total of 3 106 phage plaques were screened using G3V16 cDNA, and a single positive clone was identified By sequence analysis, the clone identified by G3V16 probe was found to contain a full-length coding sequence
ACKNOWLEDGMENTS
This research was supported by the National Pork and Producers Council (M.S.R), the Minnesota Pork Producers Association (T.W.M), the U.S.D.A grant 95–3205-3846 (L.B.S.), and the University of Minnesota Agricultural Experiment Station (M.S.R.) The authors thank Drs M P Murtaugh and K S Faaberg for supplying the PRRSV VR2332 strain, ORF7 PCR primers, and CL2621 cell culture, and Dr C W Beattie for porcine cDNA library The authors further acknowledge Dr J E Collins for assistance with experimental design, and Drs A Bhattacharjee and A Rink for technical advice on the DDRT-PCR assays and cDNA library screening
REFERENCES
Aebi, M., Fah, J., Hurt, N., Samuel, C E., Thomis, D., Bazzigher, L., Pavlovic, J., Haller, O., and Staeheli, P (1989) cDNA structures and regulation of two interferon-induced human Mx proteins.Mol Cell. Biol.9, 5062–5072
Albina, E., Piriou, L., Hutet, E., Cariolet, R., and L’Hospitalier, R (1998) Immune responses in pigs infected with porcine reproductive and respiratory syndrome virus (PRRSV).Vet Immunol Immunopathol.61,
49–66
Baca, L M., Genis, P., Kalvakolanu, D., Sen, G., Meltzer, M S., Zhou, A., Silvermann, R., and Gendelman, H E (1994) Regulation of interferon-a-inducible cellular genes in human immunodeficiency virus-in-fected monocytes.J Leukoc Biol.55,299–309
Bhattacharjee, A., Lappi, V R., Rutherford, M S., and Schook, L B (1998) Molecular dissection of dimethylnitrosamine (DMN)-induced hepatotoxicity by mRNA differential display.Toxicol Appl Pharmacol.
150,186–195
Bhattacharjee, A., Rutherford, M S., Abrahamsen, M S., Lappi, V R., and Schook, L B (1997) Refinements in re-amplification and cloning of DDRT-PCR products.BioTechniques22,1048–1051
Boudinot, P., Massin, P., Blanco, M., Riffault, S., and Benmansour, A (1999).vig-1, a new fish gene induced by the Rhabdovirus glycopro-tein, has a virus-induced homologue in humans and shares con-served motifs with the MoaA family.J Virol.73,1846–1852 Buddaert, W., van Reeth, K., and Pensaert, M (1998).In vivoandin vitro
interferon (IFN) studies with the porcine reproductive and respiratory syndrome virus (PRRSV).Adv Exp Med Biol.440,461–467 Cavanagh, D (1997).Nidovirales: a new order comprising
coronaviri-daeandarteriviridae Arch Virol.142,629–633
Collins, J E., Benfield, D A., Christianson, W T., Harris, L., Christopher-Hennings, J., Shaw, D P., Goyal, S M., McCullough, S., Morrison, R B., Joo, H S., Gorcyca, D., and Chladek, D (1992) Isolation of swine infertility and respiratory syndrome virus (isolate ATCC VR-2332) in North America and experimental reproduction of disease in gnotobiotic pigs.J Vet Diagn Invest.4,117–126
Conzelmann, K K., Visser, N., Van Woensel, P., and Thiel, H J (1993) Molecular characterization of porcine reproductive and respiratory syndrome virus, a member of the arterivirus group.Virology 193,
329–339
Done, S H., and Paton, D J (1995) Porcine reproductive and respira-tory syndrome: clinical disease, pathology and immunosuppression Vet Rec.136,32–35
Duan X., Nauwynck, H J., and Pensaert, M B (1997) Effects of origin and state of differentiation and activation of monocytes/macro-phages on their susceptibility to porcine reproductive and respiratory syndrome virus (PRRSV).Arch Virol.142,2483–2497
Foss, D L., Baarsch, M J., and Murtaugh, M P (1998) Regulation of hypoxanthine phosphoribosyl transferase, glyceraldehyde-3-phos-phate dehydrogenase and b actin mRNA expression in porcine immune cells and tissues.Anim BioTechnol.9,67–78
Goldberg, A L (1995) Functions of the proteasome: the lysis at the end of the tunnel.Science268,522–523
Halbur, P G., Rothschild, M F., Thacker, B J., Meng, X.-J., Paul, P S and Bruna, J D (1998) Differences in susceptibility of Duroc, Hampshire, and Meishan pigs to infection with a high virulence strain (VR2385) of porcine reproductive and respiratory syndrome virus (PRRSV).J. Anim Breed Genet.115,181–189
Hochstrasser, M (1995) Ubiquitin, proteasomes, and the regulation of intracellular protein degradation.Cur Opinion Cell Biol.7,215–223 Horisberger, M A (1995) Interferons,Mxgenes, and resistance to
influenza virus.Am J Respir Crit Care Med.152,S67–S71 Horisberger, M A., and Gunst, M C (1991) Interferon-induced proteins:
identification of Mx proteins in various mammalian species.Virology
180,185–190
(11)Analysis of upregulated cellular genes in pseudorabies virus infec-tion: use of mRNA differential display.J Virol Methods62,11–19 Kobayashi, H., Morozumi, T., Miyamoto, C., Shimizu, M., Yamada, S.,
Ohashi, S., Kubo, M., Kimura, K., Mitani, K., Ito, N., and Yamamoto, K (1996).Mycoplasma hyorhinisinfection levels in lungs of piglets with porcine reproductive and respiratory syndrome (PRRS).J Vet Med. Sci.58,109–113
Krug, R M., Shaw, M., Broni, B., Shapiro, G., and Haller, O (1985) Inhibition of influenza viral mRNA synthesis in cells expressing the interferon-inducedMxgene product.J Virol.56,201–206
Lee, J.-K., Schook, L B and Rutherford, M.S (1996) Molecular cloning and characterization of the porcine CD18 leukocyte adhesion mole-cule.Xenotransplantation3,222–230
Liang, P., and Pardee, A B (1992) Differential display of eukaryotic messenger RNA by means of the polymerase chain reaction. Sci-ence257,967–971
Lindenmann, J (1964) Inheritance of resistance to influenza virus in mice.Proc Soc Exp Biol Med.116,506–509
Meulenberg, J J M., and Petersen-den Besten, A (1996) Identification and characterization of a sixth structural protein of Lelystad virus: the glycoprotein GP2 encoded by ORF2 is incorporated in virus particles Virology225,44–51
Meulenberg, J J M., Petersen-den Besten, A., de Kluyve, E P., Moor-mann, R J M., Schaaper, W M M., and Wensvoort, G (1995) Characterization of proteins encoded by ORFs to of Lelystad virus.Virology206,155–163
Molitor, T W., Xiao, J., and Choi, C S (1996) PRRS virus infection of macrophages: regulation by matuation and activation state Proc. Annu Meet Am Assoc Swine Pract.27,563–569
Pagano, M (1997) Cell cycle regulation by the ubiquitin pathway FASEB J.11,1067–1075
Pickart, C M (1997) Targeting of substrates to the 26 S proteasome FASEB J.11,1055–1066
Plana, D J., Vayreda, M., Vilarrasa, J., Bastons, M., Porquet, L., and Urniza, A (1992) PEARS (mystery swine disease)- summary of the work conducted by our group Am Assoc Swine Pract News 4,
16–18
Rock, K L., Gramm, C., Rothstein, L., Clark, K., Stein, R., Dick, L., Hwang, D., and Goldberg, A L (1994) Inhibitors of the proteasome block the degradation of most cell proteins and the generation of peptides presented on MHC class I molecules.Cell78,761–771
Rossow, K D (1998) Porcine reproductive and respiratory syndrome Vet Pathol.35,1–20
Rutherford, M S., Witsell, A L., and Schook, L B (1993) Mechanisms generating macrophage functionally heterogeneous macrophages: chaos revisited.J Leukoc Biol.53,602–618
Segale´s, J., Domingo, M., Balasch, M., Solano, G I., and Pijoan, C (1998) Ultrastructural study of porcine alveolar macrophages in-fectedin vitrowith porcine reproductive and respiratory syndrome (PRRS) virus, with and without Haemophilus parasuis J Comp. Pathol.118,231–243
Solano, G I., Bautista, E., Molitor, T W., Segales, J., and Pijoan, C (1998) Effect of porcine reproductive and respiratory virus infection on the clearance ofHaemophilus parasuisby porcine alveolar mac-rophages.Can J Vet Res.62,251–256
Sorbara, L R., Maldarelli, F., Chamoun, G., Schilling, B.,
Chokekij-cahi, S., Staudt, L., Mitsuya, H., Simpson, I A., and Zeichner, S L (1996) Human immunodeficiency virus type I infection of H9 cells induces increased glucose transporter expression J Virol. 70,
7275–7279
Staeheli, P (1990) Interferon-induced proteins and the antiviral state Adv Virus Res.38,147–200
Sua´rez, P., Dı´az-Guerra, M., Prieto, C., Esteban, M., Castro, J M., Nieto, A., and Ortin, J (1996) Open reading frame of porcine reproductive and respiratory syndrome virus as a cause of virus-induced apopto-sis.J Virol.70,2876–2882
Tal-Singer, R., Podrzucki, W., Lasner, T M., Skokotas, A., Leary, J J., Fraser, N W., and Berger, S L (1998) Use of differential display reverse transcription-PCR to reveal cellular changes during stimuli that result in herpes simplex virus type I reactivation from latency: upregulation of immediate-early cellular response genes TIS7, inter-feron, and interferon regulatory factor-1.J Virol.72,1252–1261 Thanawongnuwech, R., Thacker, E L., and Halbur, P G (1997) Effect of
porcine reproductive and respiratory syndrome virus (PRRSV) (iso-late ATCC VR-2385) infection on bactericidal activity of porcine pul-monary intravascular Mø (PIMs):in vitrocomparisons with pulmo-nary alveolar macrophages (PAMs).Vet Immunol Immunopathol.59,
323–335
Trebichavsky, I., and Valicek, L (1998) Immunoreactivity of interleukin-8 and absence of interferon-alpha in porcine bronchoalveolar lavage cells infected with PRRS virus.Vet Medicina43,7–10
Treier, M., Staszewski, L M., and Bohmann, D (1994) Ubiquitin-depen-dent c-Jun degradationin vivois mediated by theddomain.Cell78,
787–798
van Nieuwstadt, A P., Meulenberg, J J M., van Essen-Zandbergen, A., Petersen-den Besten, A., Bende, R J., Moormann, R J M., and Wensvoort, G (1996) Proteins encoded by open reading frames and of the genome of Lelystad virus (Arteriviridae) are structural proteins of the virion.J Virol.70,4767–4772
Wensvoort, G., Terpstra, C., Pol, J M A., ter Lack, E A., Bloemaraad, M., de Kluyver, E P., Kragten, C., van Buiten, L., den Besten, A., Wa-genaar, F., Broăekhuijsen, J M., Moonen, P L J M., Zetstra, T., de Boer, E A., Tibben, H J., de Jong, M F., van’t Veld, P., Groenland, G J R., van Gennep, J A., Voets, M T H., Verheijden, J H M., and Braamskamp, J (1991) Mystery swine disease in the Netherlands: the isolation of Lelystad virus.Vet Q.13,121–130
Wilkinson, K D (1997) Regulation of ubiquitin-dependent processes by deubiquitinating enzymes.FASEB J.11,1245–1256
Yamagishi, H., Garg, V., Matsuoka, R., Thomas, T., and Srivastava, D (1999) A molecular pathway revealing a genetic basis for human cardiac and craniofacial defects.Science283,1158–1161
Zhang, X., and Rutherford, M S (1997) Gene expression in PRRSV-infected alveolar Mø,In Proc 78th Conference of Research Workers Animal Disease 1997 Chicago, IL pp 94.
Zhu, H., Cong, J.-P., and Shenk, T (1997) Use of differential display analysis to assess the effect of human cytomegalovirus infection on the accumulation of cellular RNAs: induction of interferon-responsive RNAs.Proc Natl Acad Sci USA94,13985–13990