Nghiên cứu nhân dòng và biểu hiện trên bề mặt bào từ bacillus subtilis gen mã hoá kháng nguyên VP28 của virus gây bệnh đốm trắng ở tôm

ĐẠI HỌC QUỐC GIA HÀ NÔI TRƯỜNG ĐAI HỌC KHOA HỌC Tự NHIÊN Phạm Kiên Cường NHÂN DÒNG VÀ BIỂU HIỆN TRÊN BỀ MẶT BÀO TỬ Bacillus subtilis GEN MÃ HÓA KHÁNG NGUYÊN VP28 CỦA VIRUS GÂY BỆNH ĐỐM TRẮNG Ở TÔM LUẬN ÁN TIẾN SĨ SINH HỌC Hà Nội, 2015 ĐẠI HỌC QUỐC GIA HÀ NÔI TRƯỜNG ĐAI HỌC KHOA HỌC Tự NHIÊN Phạm Kiên Cường NHÂN DÒNG VÀ BIỂU HIỆN TRÊN BỀ MẶT BÀO TỬ Bacillus subtilis GEN MÃ HÓA KHÁNG NGUYÊN VP28 CỦA VIRUS GÂY BỆNH ĐỐM TRẮNG Ở TƠM Chun ngành: Hóa sinh học Mã số: 62 42 01 16 LUẬN ÁN TIẾN SĨ SINH HỌC NGƯỜI HƯỚNG DẪN KHOA HỌC: GS.TS Phan Tuấn Nghĩa PGS.TS Nguyễn Thị Vân Anh Hà Nội, 2015 LỜI CAM ĐOAN Tôi xin cam đoan công trinh nghiên cúm mà th ực hướng dẫn GS.TS Phan Tuấn Nghĩa PGS.TS Nguyễn Thị Vân Anh Các số liêu kêt quà nêu luân àn trung thực va chư tưng cơng bơ bât kỳ cơng trình khác NCS Phạm Kiên Cường LỜI CAM ƠN Lời đầu tiên, tơi xin bày tỏ lịng kính trọng biết ơn sâu sắc đến GS.TS Phan Tuấn Nghĩa, PGS.TS Nguyễn Thi Vân Anh, người thầy tận tình dìu dắt, hướng dẫn, động viên khích lệ tạo điều kiện tốt cho suốt trình làm luận án nghiên cứu sinh Tơi xin chân thành cảm ơn đến tồn thể q thầy, Bộ mơn Sinh lý thực vật Hóa sinh, Khoa Sinh học, Trường Đại học Khoa học Tự nhiên truyền đạt cho kiến thức quý báu suốt thời gian học tập nghiên cứu Tôi xin chân thành cảm ơn giúp đỡ tạo điều kiện thuận lợi Cấp ủy thủ trưởng Viện Công nghệ mới, Viện Khoa học Công nghệ Quân sự, anh chị bạn bè đồng nghiệp Viện Công nghệ mới, thành viên nhóm nghiên cứu Phịng Protein tái tổ hợp Phòng Sinh học nano ứng dụng, thc Phịng Thí nghi ệm trọng điêm Cơng nghê Enzym Protein, Trương Đai hoc Khoa hoc Tư nhiên Tôi xin gửi lơi cam ơn đ ến Ban Giám hiệu, Phòng Sau Đại học , Ban Chủ nhiệm Khoa Sinh học va Phong ch ức Trương Đai hoc Khoa hoc Tư nhiên, Đại học Quốc gia Hà Nội đa tao điêu kiên cho h ọc tập, hoàn thành thủ tục cần thiết nghiên cứu sinh Tôi xin chân thành cám ơn đến TS Đặng Thị Lụa, Viện nghiên cứu nuôi trồng thủy sản I TS Trần Thị Tuyết Hoa, Khoa Thủy sản Trường Đại học Cần Thơ nhiệt tình giúp đỡ, cung cấp chia se thơng tin trình thư ng hiêm ứng dụng thực tế sản phẩm đề tài luận án Luận án thực với tài trợ kinh phí đề tài thuộc chương trình Trọng điểm cấp nhà nước Bộ Khoa học Công nghệ tài trợ, mã số KC.04.09/11-15 thân hỗ trợ kính phí làm thực nghiệm với tư cách nghiên cứu sinh đề tài Tôi xin chân thành bày tỏ lòng biết ơn tơi bổ, mẹ, vợ, con, gia đĩnh, người bên tôi, cổ vũ, đông viên va tạo điêu kiên thuân lơi cho tơi có thời gian học tập, nghiên cứu hoan ihanh luân an NCS Phạm Kiên Cường DANH MỤC CÁC KY HIÊU VÁ CHỮ VIẾT TẮT BCIP 5-bromo-4-chloro-3-indolyl phosphate BSA Albumin huyết bò (Bovine Serum Albumin) Cm Chloramphenicol dNTP Deoxyribonucleoside triphosphate DSM Môi trường tạo bào tử Difco (Difco Sporulation medium) EDTA Ethylene Diamine Tetraacetic Acid GST Glutathione S-transferase IPTG Isopropyl P-D-1-thiogalactopyranoside kDa Kilodalton LB Luria Bertani NBT p- nitro blue tetrazolium chloride PAGE Điện di gel polyacrylaminde (Polyarylamide Gel Electrophoresis) PBS Muối chứa đệm phosphate (Phosphate Buffered Saline) PCR Phản ứng chuỗi polymerase (Polymerase Chain Reaction) PVDF Polyvinylidere Fluoride SDS Sodium Dodecyl Sulphate GST Glutathione S-transferase TSA TTFC Tryptic Soy Agar Phân đoạn đầu C độc tố uốn ván (C- terminal fragment of the tetanus toxin) WSSV Virus gây bệnh đốm trắng (White Spot Syndrome Virus) DANH MỤC BẢNG DANH MUC HÌNH • Hình 1.15: Mơ hình bi ểu protein ngoai b ề mặt bào tử B subtilis sử dụng protein lớp áo bào tử Protein dung hợp gồm phần màu xanh dướng protein chuyên chở phần màu hồng protein ngoại lai [74] 52 Hình 3.1: Nhân vp28 PCR từ mẫu tơm nhiễm WSSV địa điểm73 Hình 3.2: Điện di gel agarose sản phẩm PCR kiểm tra có mặt vp28 thể biến nạp sử dụng cặp mồi pGEM Fw/Rv cặp mồi VP28.1 Fw/Rv 74 Hình 3.3: So sánh mức độ tướng đồng trình tự nucleotide gen vp28 từ mâu WSSV thu thâp đước va trình tư vp28 Việt Nam đa công bô trước (AY168644) 77 67 Marks H., Goldbach R W., Vlak J M., Van Hulten M C (2004), "Genetic variation among isolates of White spot syndrome virus", Archives of Virology 149, pp 673-697 68 McCord J.M., Fridovich I (1969), "Superoxidase dismutase, an enzymic function for erythrocuprein (hemocuprein)", Journal of Biological Chemistry 244, pp 6049 -6055 69 Mejia-Ruiz C H., Vega-Pena S., Alvarez-Ruiz P., Escobedo-Bonilla C M (2011), "Double-stranded RNA against white spot syndrome virus (WSSV) vp28 or vp26 reduced susceptibility of Litopenaeus vannamei to WSSV, and survivors exhibited decreased susceptibility in subsequent re-infections", Journal of Invertebrate Pathology 107, pp 65-68 70 Mu Y., Lan J F., Zhang X W., Wang X W., Zhao X F., Wang J X (2012), "A vector that expresses VP28 of WSSV can protect red swamp crayfish from white spot disease", Developmental and Comparative Immunology 36, pp 442449 71 Nakano H., Koube H., Umezawa S., Momoyama K., Hiraoka M., Inouye K., Oseko S (1994), "Mass mortalities of cultured kuruma shrimp, Penaeus - japonicus, in Japan in 1993: epizootiological survey and infection trials", Fish Pathology 29, pp 135-139 72 Namikoshi A., Wu J L., Yamashita T., Nishizawa T., Nishioka T., Arimoto M., Muroga K (2004), "Vaccination trials with Penaeus japonicus to induce resistance to white spot syndrome virus", Aquaculture 229, pp 25-35 73 Nguyen V A., Huynh H A., Hoang T V., Ninh N T., Pham A T., Nguyen H A., Phan T N., Cutting S M (2013), "Killed Bacillus subtilis spores expressing streptavidin: a novel carrier of drugs to target cancer cells", Journal of Drug Targeting 21, pp 528-541 74 Ning D., Leng X., Li Q., Xu W (2011), "Surface-displayed VP28 on Bacillus subtilis spores induce protection against white spot syndromevirus in crayfish by oral administration", Journal of Applied Mierobiology 111, pp 1327-1336 75 Ning J F., Zhu W., Xu J P., Zheng C Y., Meng X L (2009), "Oral delivery of DNA vaccine encoding VP28 against white spot syndrome virus in crayfish by attenuated Salmonella typhimurium", Vaeeine 27, pp 1127-1135 76 Perazzolo L M., Barracco M A (1997), "The prophenoloxidase activating system of the shrimp Penaeus paulensis and associated factors", Developmental and Comparative Immunology 21, pp 385-395 77 Rahman M N., Corteel M., Wille M., Aldaysanz V., Pensaert M B., Sorgeloos P., Nauwynck H J (2007), "The effect of raising water temperature to 33oC in Penaeus vannamei juveniles at different stages of infection with white spot syndrome virus (WSSV)", Aquaeulture 272, pp 240-245 78 Rajeshkumar S., Venkatesan C., Sarathi M., Sarathbabu V., Thomas J., Anver Basha K., Sahul Hameed A S (2009), "Oral delivery of DNA construct using chitosan nanoparticles to protect the shrimp from white spot syndrome virus (WSSV)", Fish and Shellfish Immunology 26, pp 429-437 79 Rameshthangam P., Ramasamy P (2007), "Antiviral activity of bis(2methylheptyl)phthalate isolated from Pongamia pinnata leaves against White Spot Syndrome Virus of Penaeus monodon Fabricius", Virus Research 126, pp 38-44 80 Reske A., Pollara G., Krummenacher C., Chain B M., Katz D R (2007), "Understanding HSV-1 entry glycoproteins", Reviews in Medieal Virology 17, pp 205-215 81 Robalino J., Browdy C L., Prior S., Metz A., Parnell P., Gross P., Warr G (2004), "Induction of antiviral immunity by double-stranded RNA in a marine invertebrate", Journal of Virology 78, pp 10442-10448 82 Robalino J., Payne C., Parnell P., Shepard E., Grimes A C., Metz A., Prior S., Witteveldt J., Vlak J M., Gross P S., Warr G., Browdy C L (2006), "Inactivation of White Spot Syndrome Virus (WSSV) by normal rabbit serum:implications for the role of the envelope protein VP28 in WSSV infection of shrimp", Virus Research 118, pp 55-61 83 Rout N., Kumar S., Jaganmohan S., Murugan V (2007), "DNA vaccines encoding viral envelope proteins confer protective immunity against WSSV in black tiger shrimp", Vaccine 25, pp 2778-2786 84 Sarathi M., Simon M C., Ahmed V P., Kumar S R., Hameed A S (2008), "Silencing VP28 gene of white spot syndrome virus of shrimp by bacterially expressed dsRNA", Marine Biotechnology (NY) 10, pp 198-206 85 Sathish S., Musthaq S., Hameed A S S., Narayanan R B (2004), "Production of recombinant structure protein from the Indian WSSV", Aquaculture 242, pp 69-80 - 86 Sharma S R., Shankar K M., Sathyanarayana M L., Sahoo A K., Patil R., Narayanaswamy H D., Rao S (2010), "Evaluation of immune response and resistance to diseases in tiger shrimp, Penaeus monodon fed with bioíilm of Vibrio alginolyticus", Fish and Shellfish Immunology 29, pp 724-732 87 Sithigorngul P., Chauychuwong P., Sithigorngul W., Longyant S., Chaivisuthangkura P., Menasveta P (2000), "Development of a monoclonal antibody specific to yellow head virus (YHV) from Penaeus monodon", Diseases of Aquatic Organisms 42, pp 27-34 88 Sốderhăll K (1999), "Invertebrate immunity", Developmental and Comparative Immunology 23, pp 263-266 89 Sritunyalucksana K., Sốderhăll K (2000), "The proPO and clotting system in crustaceans", Aquaculture 191, pp 53-69 90 Sritunyalucksana K., Wannapapho W., Lo C F., Flegel T W (2006), "PmRab7 is a VP28-binding protein involved in white spot syndrome virus infection in shrimp", Journal of Virology 80, pp 10734-10742 91 Syed M S., Kwang J (2011), "Oral vaccination of baculovirus-expressed VP28 displays enhanced protection against White Spot Syndrome Virus in Penaeus monodon", PloS One 6, p e26428 92 Syed M.S, Kwang J (2015), "Reprint of “Evolution of specific immunity in shrimp - A vaccination perspective against white spot syndrome virus”", Developmental & Comparatỉve Immunology 48, pp.342-353 93 Syedmusthaq S., Yoganandhan K., Sudhakaran R., Hameed A S S (2006), "Neutralization of white spot syndrome virus of shrimp by antiserum raised against recombinant VP28", Aquaculture 253, pp 98-104 94 Takahashi Y., Fukuda K., Kondo M., Chongthaleong A., Nishi K., Nishimura M., Ogata K., Shinya I., Takise K., Fujishima Y., Matsumaura M (2003), "Detection and prevention of WSSV infection in cultured shrimp", Asỉan Aquaculture Magazỉne November/December 2003, pp 25-27 95 Takahashi Y., Itami T., Kondo M., Maeda M., Fujii R., Tomonaga S., Supamattaya K., Boonyaratpalin S (1994), "Electron microscopic evidence of bacilliform virus infection in Kuruma shrimp (Penaeus japonỉcusỴ, Fỉsh Pathology 29, pp 121-125 96 Takahashi Y., Kondo M., Itami T., Honda T., Inagawa H., Nishizawa T., Soma G I., Yokomizo Y (2000), "Enhancement of disease resistance against penaeid acute viraemia and induction of virus-inactivating activity in haemolymph of kuruma shrimp, Penaeus japonỉcus, by oral administration of Pantoea agglomerans lipopolysaccharide (LPS)", Fỉsh and Shellfỉsh Immunology 10, pp 555-558 97 Tang X., Wu J., Sivaraman J., Hew C L (2007), "Crystal structures of major envelope proteins VP26 and VP28 from white spot syndrome virus shed light on their evolutionary relationship", Journal of Vỉrology 81, pp 6709-6717 98 Tassanakajon A., Somboonwiwat K., Supungul P., Tang S (2013), "Discovery of immune molecules and their crucial functions in shrimp immunity", Fỉsh and Shellfỉsh Immunology 34, pp 954-967 99 Thomas A., Sudheer N S., Viswanathan K., Kiron V., Singh I S B., Narayanan R B (2014), "Immunogenicity and protective efficacy of a major White Spot Syndrome Virus (WSSV) envelope protein VP24 expressed in - Escherichia coli against WSSV", Journal of Invertebrate Pathology 123, pp 17-24 100 Tran T T H., Phuong T N., Vlak J (2008), "High variation of tandem repeat sequences in ORF94 among WSSV outbreak strains in the Mekong Delta, Vietnam", Handbook & Abstracts of the 7th Symposium on Diseases in Asian Aquaculture, Taipei, Taiwan, pp 222 - 222 101 Tsai J M., Wang H C., Leu J H., Hsiao H H., Wang A H., Kou G H., Lo C F (2004), "Genomic and proteomic analysis of thirty-nine structural proteins of shrimp white spot syndrome virus", Journal of Virology 78, pp 11360-11370 102 Tseng D Y., Ho P L., Huang S Y., Cheng S C., Shiu Y L., Chiu C S., Liu C H (2009), "Enhancement of immunity and disease resistance in the white shrimp, Litopenaeus vannamei, by the probiotic, Bacillus subtilis E20", Fish andShelựish Immunology 26, pp 339-344 103 Van Hulten M C., Goldbach R W., Vlak J M (2000), "Three functionally diverged major structural proteins of white spot syndrome virus evolved by gene duplication", The Journal of General Virology 81, pp 2525-2529 104 Van Hulten M C., Tsai M F., Schipper C A., Lo C F., Kou G H., Vlak J M (2000), "Analysis of a genomic segment of white spot syndrome virus of shrimp containing ribonucleotide reductase genes and repeat regions", The Journal of General Virology 81, pp 307-316 105 Van Hulten M C., Tsawestenberg M., Goodall S D., Vlak J M (2000), "Identification of two major virion protein genes of white spot syndrome virus of shrimp", Virology 266, pp 227-236 - 106 Van Hulten M C., Vlak J M (2001), "Identiíication and phylogeny of a protein kinase gene of white spot syndrome virus", Virus Genes 22, pp 201207 107 Van Hulten M C., Witteveldt J., Peters S., Kloosterboer N., Tarchini R., Fiers M., Sandbrink H., Lankhorst R K., Vlak J M (2001), "The white spot syndrome virus DNA genome sequence", Virology 286, pp 7-22 108 Van Hulten M C., Witteveldt J., Snippe M., Vlak J M (2001), "White spot syndrome virus envelope protein VP28 is involved in the systemic infection of shrimp", Virology 285, pp 228-233 109 Vaseeharan B., Prem Anand T., Murugan T., Chen J C (2006), "Shrimp vaccination trials with the VP292 protein of white spot syndrome virus", Letters in AppliedMicrobiology 43, pp 137-142 110 Venegas C A., Nonaka L., Mushiake K., Nishizawa T., Murog K (2000), "Quasi-immune response of Penaeus japonicus to penaeid rod-shaped DNA virus (PRDV)", Diseases of Aquatic Organisms 42, pp 83-89 111 Wang C S., Tang K F J., Kou G H., Chen S N (1996), "Yellow head disease-like virus infection in the kuruma shrimp Penaeus japonicus cultured in Taiwan", Fish Pathology 31, pp 177-182 112 Wang Q., White B L., Redman R M., Lightner D V (1999), "Per os challenge of Litopenaeus vannamei postlarvae and Farfantepenaeus duorarum juveniles with six geographic isolates of white spot syndrome virus", Aquaculture 170, pp 179-194 113 Wang Y., Zhang X., Yuan L., Xu T., Rao Y., Li J., Dai H (2008), "Generation of recombinant monoclonal antibodies to study structure-function of envelope protein VP28 of white spot syndrome virus from shrimp", Biochemical and Biophysical Research Communications 372, pp 902-906 114 Witteveldt J., Vlak J M., Van Hulten M C (2004), "Protection of Penaeus monodon against white spot syndrome virus using a WSSV subunit vaccine", Fish and Shellfish Immunology 16, pp 571-579 115 Wongprasert K., Khanobdee K., Glunukarn S S., Meeratana P., Withyachumnarnkul B (2003), "Time-course and levels of apoptosis in various tissues of black tiger shrimp Penaeus monodon infected with white-spot syndrome virus", Diseases of Aquatic Organisms 55, pp 3-10 116 Wongteerasupaya C., Vickers J E., Sriurairatana S., Nash G L., Alarajamorn A., Boonsaeng V (1995), "A non-occluded, systemic baculovirus that occurs incells of ectodermal and mesodermal origin and causes high mortality in the black tiger prawn Penaeus monodon", Diseases of Aquatic Organisms 21, pp 69-77 117 Wongteerasupaya C., Wongwisansri S., Boonsaeng V., Panyim S., Pratanpipat P., Nash G L (1996), "DNA fragment of Penaeus monodon baculovi-rus PmNOBII gives positive in situ hybridization with white spot viral infections in six Penaeid shrimp species", Aquaculture 143, pp 23-32 118 Wu C., Yang F (2006), "Localization studies of two white spot syndrome virus structural proteins VP51 and VP76", Virology Journal 3, pp 76-83 119 Wu J L., Nishioka T., Mori K., Nishizawa T., Muroga K (2002), "A timecourse study on the resistance of Penaeus japonicus induced by artificial infection with white spot syndrome virus", Fish and Shellfish Immunology 13, pp 391-403 120 Xie X., Xu L., Yang F (2006), "Proteomic analysis of the major envelope and nucleocapsid proteins of white spot syndrome virus", Journal of Virology 80, pp 10615-10623 121 Xie X., Yang F (2005), "Interaction of white spot syndrome virus VP26 protein with actin", Virology 336, pp 93-99 122 Xu H., Yan F., Deng X., Wang J., Zou T., Ma X., Zhang X., Qi Y (2009), "The interaction of white spot syndrome virus envelope protein VP28 with shrimp Hsc70 is specific and ATP-dependent", Fish and Shellfish Immunology 26, pp 414-421 123 Yang F., He J., Lin X., Li Q., Pan D., Zhang X., Xu X (2001), "Complete genome sequence of the shrimp White spot syndrome baciliform virus", Journal of Virology 75, pp 11811-11820 124 Yi G., Wang Z., Qi Y., Yao L., Qian J., Hu L (2004), "Vp28 of shrimp white spot syndrome virus is involved in the attachment and penetration into shrimp cells", Journal of Biochemistry andMolecular Biology 37, pp 726-734 125 Zhang X., Huang C., Tang X., Zhuang Y., Hew C L (2004), "Identification of structural proteins from shrimp white spot syndrome virus (WSSV) by 2DEMS", Proteins 55, pp 229-235 126 Zhang X., Huang C., Xu X., Hew C L (2002), "Transcription and identiíication of an envelope protein gene (p22) from shrimp white spot syndrome virus", The Journal of General Virology 83, pp 471-477 127 Zhang X., Xu X., Hew C L (2001), "The structure and function of a gene encoding a basic peptide from prawn white spot syndrome virus", Virus Research 79, pp 137-144 128 Zhu Y., Ding Q., Yang F (2007), "Characterization of a homologous- regionbinding protein from white spot syndrome virus by phage display", Virus Research 125, pp 145-152 129 Wei K Q., Xu Z R (2005), "Effect of white spot syndrome virus envelope protein Vp28 expressed in silkworm (Bombyx mori) pupae on disease resistence in Procambarus clarkii", Shi Yan Sheng Wu Xue Bao 38, pp 190-198 130 OIE (2003) "Manual of diagnostic tests for aquatic animals" 4th edtition World Organization for Animal Health, Paris 358pp 131 Wang C H., Lo C F., Leu J H., Chou C M., Yeh P Y., Chou H Y (1995), "Purification and genomic analysis of baculovirus associated with white spot syndrome (WSBV) of Penaeus monodon", Diseases of Aquatic Organisms 23, pp.239-242 - 501>AGTĨGGCACCTTTGĨGTGĨGGTACCACCĨTTGGCGCACCAAĨTGCAGCTACCGCCGGĨGGAAAĨCĨĨĨTCGACATGTACGTGCACGTCACCĨACĨCĨGGC>600 501>AGTTGGCACCĨTTGTGTGĨGGĨACCACCTTTGGCGCACCAAĨĨGCAGCĨACCGCCGGĨGGAAAĨCTTTTCGACATGTACGĨGCACGTCACCTACTCTGGC>600 501 >AGTTGGCACCĨĨĨGĨ GĨGĨGGTACCACCTĨTGGCGCACCAAĨTGCAGCĨACCGCCGGĨGGAAAĨCTĨTTCGACAĨGTACGĨGCACGTCACCTACTCĨGGO6 0 - 501 >AGTTGGCACCTĨTGĨ(^GTGGTACCACCĨTTGGCGCACCAAĨĨGCAGCĨACCGCCGGĨGGAAATCĨTĨTCGACATGTACGĨGCACGTCẰCCĨACTCĨGGC>6 0 - 601>ACTGÀGACCGAGTAA>615 601>ACĨGAGACCGAGTAA>615 601>ACĨGAGACCGAGĨAA>615 601>ACTGAGACCGAGTAA>615 601>ACTGAGACCGAGTAA>615 Hình 3.3: So sánh mức độ tương đồng trình tự nucleotide gen vp28 từ mâu WSSV thu thập trình tự vp28 Việt Nam đa cơng bô trươc - (AY168644) ... biểu bề mặt bào tử Bacillus subtilis gen mã hóa kháng nguyên VP28 virus gây bệnh đốm trắng tôm? ?? để tạo bào tử Bacillus subtilis biểu kháng nguyên VP28 virus gây bệnh đốm trắng làm sở cho việc... NHIÊN Phạm Kiên Cường NHÂN DÒNG VÀ BIỂU HIỆN TRÊN BỀ MẶT BÀO TỬ Bacillus subtilis GEN MÃ HÓA KHÁNG NGUYÊN VP28 CỦA VIRUS GÂY BỆNH ĐỐM TRẮNG Ở TƠM Chun ngành: Hóa sinh học Mã số: 62 42 01 16 LUẬN... chủng B subtilis tái tổ hợp biểu gen mã hóa protein kháng nguyên VP28 WSSV bề mặt bào tử - Buớc đầu đánh giá đuợc khả phòng bệnh đốm trắng tôm thẻ chân trắng bào tử B subtilis biểu VP28 bề mặt Đối