Nghiên cứu đột biến gen LDLR ở người tăng cholesterol máu có tính chất gia đình tt tiếng anh

MINISTRY OF EDUCATION AND TRAINING MINISTRY OF HEALTH HANOI MEDICAL UNIVERSITY HOANG THI YEN RESEARCH ON MUTATION OF LDLR GENE IN FAMILIAL HYPERCHOLESTEROLEMIA PATIENTS Specialized: Medical biochemistry Code number: 62720112 DOCTORAL THESIS SUMMARY HANOI - 2020 RESEARCH IS COMPLETED AT HANOI MEDICAL UNIVERSITY Scientific instructor: Assoc.Prof Ph.D Dang Thi Ngoc Dung Thesis defense committee members: Reviewer 1: Reviewer 2: Reviewer 3: The dissertation will be defended in the University Thesis Evaluation Council at Hanoi Medical University Research can be found in: - National Library of Vietnam Hanoi Medical University Library INTRODUCTION Importance of research problem: Familial hypercholesterolemia (FH) is a spontaneous disorder, characterized by lifelong increase of serum cholesterol related to low density lipoprotein (LDL) FH patients with LDLR gene mutations (accounting for 85% of LH patients) display a significant increase in total cholesterol (TC) and LDL-Cholesterol which leads to cholesterol deposition in the arteries at a very early age, consequently atherosclerosis and increased risk of myocardial infarction Especially with FH patients, myocardial infarction tends to develop faster and could cause sudden death, severe coronary heart disease (CHD) at a young age or other cardiovascular complications in the 40s or 50s of the patient’s life Death and coronary artery bypass grafting (CABG) rates in adolescence are considerably high among FH patients However, FH patients are still not diagnosed and treated timely or receive deficient treatment Cholesterol level solely is insufficient to accurately diagnose FH since cholesterol level in the blood may vary between ages, genders, population characteristics and it could be confused with acquired hypercholesterolemia Therefore, diagnostic criteria for FH consist of clinical symptoms and paraclinical examinations as well as family medical history of any dominant genotypes of early cardiovascular disease or hypercholesterolemia Currently in Vietnam, FH patients are not fully concerned, genetic examinations are rarely performed; many children have been admitted due to critical cardiovascular complications Researches on molecular biology identifying mutation forms of genes, especially LDLR gene in FH patients are still scarce This shortage hinders preventive consultation with the patients and other family members in order to decrease the risk of early complications of coronary disease Research objectives: Objective Identify mutations on regions of LDLR gene in pediatric patients with familial hypercholesterolemia Objective Detect mutations of LDLR gene and clinical, paraclinical signs in other members of the FH pediatric patient’s family tree Location of research: Research is conducted at the National Pediatric Hospital, Hanoi Medical University and Laboratory Department of Hanoi Heart Hospital New research contributions: 4.1 Identify mutations in 7/26 FH pediatric patients (26.92%): - Two mutations which were announced pathogenic: + Exon mutation c.664 T>C: pediatric patients, of them are heterozygous mutation and one is homozygous + Exon mutation c.1285G>A: pediatric patient (also carries c.664 T>C mutation) - Two new mutations have not been published but are likely to cause disease: + Exon mutation c.1335 C>T + Exon 13 mutation c.1978 C>T 4.2 Having established three pedigrees of FH patients with mutations in generations: - Identify 7/25 members in pedigrees with mutations but no Clinical manifestations of the disease and no increase in cholesterol - Determine the dominant genetic rule on the common chromosome of FH disease in these pedigrees Scientific and practical importance of research: This research has a high practical meaning; identify mutation of LDLR gene in familial hypercholesterolemia patients help doctors correctly diagnose the disease in order to perform medical treatment appropriately and timely as well as detect gene carriers, cascade screening, manage and consult patients and their families about preventing risks and complications related to atherogenesis Vietnam’s disease patterns are shifting towards non-infectious diseases and senescence; this circumstance emphasizes the necessity of researches related to these diseases, aiming to improve the quality of the population This study has scientific meaning with suitable and systematic research design, logical layout and proper data processing methods Along with specialized research facility, advanced technology has been used for DNA sequencing to ensure the results are accurate and highly reliable Research structure: - Research is presented in 128 pages (excluding references and appendix) Research is divided into chapters: pages for introduction, 33 pages for chapter 1: Literature review, 16 pages for chapter 2: Research subjects and methodology, 34 pages for chapter 3: Results, 40 pages for chapter 4: Discussion, pages for Conclusions, page for Future Research Directions - Research includes 23 tables, 35 charts, figures and diagrams; 175 reference documents which include Vietnamese documents and 172 English documents Appendix includes: Medical record sample, DNA clean-up and concentration results, examination techniques used in research, DNA sequence analysis results; List of patients participated in the study Chapter 1: OVERVIEW FH epidemiology: Many studies have shown that FH is one of the most common gene inheritance disorders Global FH prevalence is estimated to be 1:500 to 1:300 (0.2-0.3%), which approximately 13 millions people all over the world and 600.000 Americans Some populations have even higher rate: Lebanese 1/85 European South African 1/100 to 1/72, Tunisian 1/165, French Canadian 1/270 Diagnostic criteria for FH: Simon Broome diagnostic criteria: (1) Total cholesterol greater than 7.5 mmol/L or LDL-C greater than 4.9 mmol/L in an adult; Total cholesterol greater than 6.7 mmol/L or LDL-C greater than 4.0 mmol/L in a child aged younger than 16 years (2) Associated symptoms: Tendon xanthomas or tendon xanthomas in first (parents, siblings) or second (grandparents, uncle, aunt) degree relatives (3) OR DNA-based evidence of an LDLR mutation, familial defective apo B-100 or PCSK9 mutation (4) Family history of myocardial infarction before age 50 years in a second-degree relative or before age 60 years in a first-degree relative (5) Family history of elevated total cholesterol greater than 7.5 mmol/L in an adult first or second-degree relative; greater than 6.7 mmol/L in a child, siblings age 16 years or younger Definitive diagnosis of FH: (1) + (2) or (3) Possible FH : (1) + (4) or (5) This study was conducted on pediatric patients so criteria (1)+(2) of Simon Broome was applied for diagnosis In order to accurately diagnose FH, we combine both clinical criteria and DNA analysis because DNA examination is not 100% sensitive Moreover, FH could be caused by other unevaluated factors so even when no mutation is detected, FH is still possible Mutation forms of LDLR gene and its effect on phenotype LDLR gene resides on the short (p) arm on chromosome 19 at the band 19p13.2, spans 45kb and includes 18 exons and 17 introns, consisted of 11.089.361 to 11.133.829 base pairs and decodes to a 5.4kb mRNA Mutation of LDLR gene is the most common cause of FH (about 80%) There are 1700 announced mutation on LDLR gene, 1295 are independent mutations (1064 are pathogenic, 143 are nonpathogenic, 88 unknown) FH caused by LDLR gene mutation shows various clinical phenotypes depends on the mutation form and the remaining allele and LDLR gene activity Clinical phenotypes of FH caused by LDLR mutation can be classified into severe mutation forms (homozygous mutation, compound heterozygous mutations, nonsense mutation ) and heterozygous mutation Polymorphism of LDLR gene Single nucleotide polymorphism (SNP) or many SNPs could solely or synergistically affect the haplotypes as well as pathogen risk If we assess SNP solely without considering the SNP-SNP interaction (SNP shows weak correlation with the estimated odds ratio), it will be difficult to examine the effect levels of SNPs on the carrier’s phenotype Management program and screening strategy for FH patients A few screening strategies for FH patients in the community: (1) Opportunistic screening (for initial patients) (2) Systematic screening (for children and adolescents – NICE guidelines) (3) Cascade screening (intentional screening for FH patient’s family) Cascade screening is valued as the most efficient method in detecting and timely treating FH in order to increase lifespan, decrease coronary disease risk and bring in economical benefit by reducing healthcare cost Chapter SUBJECTS AND METHODS OF THE STUDY 2.1 Research subjects 2.1.1 Pediatric FH patient group: Children under 16 years of age are examined and diagnosed with FH diseases at the National Pediatric Hospital according to the following selection and exclusion criteria Selection criteria: (1) TC is higher than 6.7 mmol/L or LDL-C above 4.0 mmol/L (2) PLUS: Tendon xanthomas in patient or a 1st degree relative (parent, sibling, child) or a 2nd-degree relative (grand parent, uncle, aunt) - Parents or guardians of pediatric patients and FH patients agree to allow children to participate in the study Exclusion criteria: - Children with one of the following diseases: Hyperthyroidism, hypothyroidism, nephrotic syndrome, diabetes mellitus, chronic liver disease 2.1.2 Group of children's family members: - Members of the pedigree of the three families of FH pediatric patients (MS02, MS03, MS15): Including 45 members + Of which 30/45 members in the genealogy of families are related to the genetic lineage of FH disease + The members of the genealogy of families agree to participate in the study 2.2 Research Methods 2.2.1 Study design: Retrospective combined with cross sectional description 2.2.2 Research techniques: Patients who met the selection criteria were chosen for data-collection according to a consistent study sample Patients were drawn for blood for several biochemical and immunological tests and genetic analysis - Technique for separating DNA from whole blood - DNA quality testing: DNA purity measurement technique and DNA concentration measurement - PCR technique to amplify exon 3, 4, 9, 13 and 14 + Designing primers: Designing primers is crucial to the success of the research The purpose of primer design is to amplify the exon 3, 4, 9, 13, and 14 of LDLR gene The priming design is strictly cohered with the primer design principle We designed pairs of primer for exons: exon 3, exon 4, exon 9; exon 13 and exon 14 The team designed a primer pair to cover the 13intron13-exon14 exon segment (431 bp) The sequences that cover the target sequence from NCBI are included in the Primer-BLAST software, selecting a minimum sequence length of 500 bp Table 2.1 The sequence of primers amplified exon 3, 4, 9, 13 and 14 of the LDLR gene Kích thước Mồi Trình tự (bp) Forward primer CTCAGTGGGTCTTTCCTTTG LDLR (5’-3’) Exon 400 Reverse primer CCTGACTGTGCGTGACAA ’ ’ LDLR (3 -5 ) Forward primer TGTTGGGAGACTTCACACGG LDLR (5’-3’) Exon 529 Reverse primer TCCACTTCGGCACCTAAATCA LDLR (3’-5’) Forward primer CTCTTTTTCTGGGTGCCTC LDLR (5’-3’) Exon 448 Reverse primer CTGGATGTCTCTGCTGATGA LDLR (3’-5’) Forward primer TAGTTGTGGAGAGAGGGTGGC LDLR (5’-3’) Exon 638 13, 14 Reverse primer AAAGTATGGTTATCCCGACTCA LDLR (3’-5’) 2.2.3 Genetic sequencing technique After purification, PCR products were conducted genetic sequencing on automatic sequencing machine Prism 3730xl - ABI (USA) 2.3 Ethics in research: - This study was approved by the Ethics Council, according to Decision No.187/HĐĐĐHYHN, dated February 20, 2016 of the Medical Ethics Council, Hanoi Medical University - Patients are fully voluntary to participate in the study and provide full and truthful information related to their diseases - Patient is notified of the result of genetic mutation test by the treating Doctor - The patient information, the diagnosis results are kept strictly confidential Research is conducted purely for scientific purposes, not for any other purpose 2.4 Data processing methods The results of gene sequencing were analyzed by Sequencing Scanner 2.0 and compared with sequences of a.a on genebank using ApE software Analysis to identify mutations, type of mutations or SNPs, combined with software to predict the likelihood of mutation or SNP Use SPSS 16.0 software for statistical analysis Test and compare the average value of the variables according to the normal distribution by T-test, by Mann-Whitney test non-standard 11 The mutation caused a.a change in position 222 from Cysteine to Arginine This is a heterozygous transformation and was found in patients from group of 26 FH pediatric patients (MS02, MS03, MS08, MS18) Homozygous mutation on exon (c.664 T>C) Normal c.664T c.664 T>C Figure 3.6 Mutation of c.664 T>C on exon of LDLR gene The nucleotide in position 664 on exon of LDLR gene was replaced from Thymine to Cytosine This mutation caused the a.a change from Cysteine to Arginine This is a homozygous mutation, which was found in MS15 patient from group of 26 FH pediatric patients Heterozygous mutation on exon (c.1285G>A) Normal c.1285G c.1285 G>A Figure 3.7 Mutation of c.1285G>A on exon of LDLR gene 12 In this mutation, Guanin in position 1285 on exon of LDLR gene was replaced by Adenin This mutation caused the a.a change in position 429 from Valine to Methionine This mutation was published, named c.1285G>A in heterozygous mutation, it was found in MS02 patient in group of 26 FH pediatric patients Heterozygous mutation on exon (c.1335 C>T) Normal c.1335 C c.1335 C>T Figure 3.8 Mutation of c.1335 C>T on exon of LDLR gene Cytosine in position 1335 on exon of LDLR gene was replaced by Thymine This mutation did not cause the a.a alteration and has not been published before This heterozygous mutation was found in MS19 patient from group of 26 FH pediatric patients Heterozygous mutation on exon 13 (c.1978 C>T) Normal c.1978 C>T stop codon (CAGUAG) Figure 3.9 Mutation of c.1978 C>T 13 Cytosine in position 1978 on exon 13 of LDLR gene was replaced by Thymine This mutation caused the codon change in position 660, from CAG to UAG (UAG is a stop codon) This is a newly discovered mutation in the study, named c.1978 C>T - a heterozygous stop codon which is a nonsense mutation This mutation was found in MS23 patient in group of 26 FH pediatric patients 3.2.2 Results of polymorphisms identification of the LDLR gene Single polymorphism SNP rs1003723 (intron 9) (a) Normal (b) c.1359-30 C>T heterozygous (c) c.1359-30 C>T homozygous Figure 3.10 Heterozygous SNP rs1003723 and homozygous Image b: The nucleotide in position 1359 on intron of LDLR gene (before exon a distance of 30 nucleotides) was changed from Cytosine to Thymine This is a published SNP as SNP rs1003723 in heterozygous transformation This SNP was found in 11 patients in group of 26 FH pediatric patients 14 Image c: SNP rs1003723 in homozygous transformation This is a published SNP that was found in MS15 patient in group of 26 FH pediatric patients Single polymorphism SNP rs5925 (exon 13) (a) Normal (b) c.1959T>C heterozygous (c) c.1959T>C homozygous Figure 3.11 Heterozygous and homozygous SNP rs5925 Image (b): The nucleotide in position 1959 on exon 13 of LDLR gene was changed from Thymine to Cytosine This is a published SNP as SNP rs5925 in heterozygous transformation, this SNP did not cause the a.a change (p.Val653Val) and was found in patients in group of 26 FH pediatric patients Image (c): SNP rs5925 in homozygous transformation This SNP was published and found in MS15 patient in the study 15 3.2 Results of genealogy analysis 3.2.1 Family genealogy of MS02 and MS08 pediatric patients Diagnosis of MS02 pediatric patient Male pediatric patient born in 2006 was admitted to hospital because of many xanthomas under the skin on both sides of the knees Xanthomas have appeared since months of age (a) (b) (c) Figure 3.12 Xanthoma in the skin of MS02 patient Family genealogy Figure 3.13 Mutation on exon 4, in family genealogy of MS02 pediatric patient 16 Family genealogy of MS02 pediatric patient shows that 10 family members are related to blood type 1, and with MS02 patient 3.2.2 Family genealogy of MS03 patient Family genealogy of MS03 patient Genetic inheritance rate in family genealogy is in 5/12 members, results of sequencing determined that members in family genealogy have heterozygous transformation on exon of LDLR gene Figure 3.15 Mutation on exon in pedigree of MS03 patient MS03 patient inherited the c.664 T>C heterozygous transformation from the maternal side, dominance on normal chromosomes Maternal grandmother (I.1), mother (II.6) and older brother (III.3) of MS03 patient also have the same mutation and hypercholesterolemia 3.3.3 Family genealogy of MS15 patient Diagnosis of MS15 patient A female pediatric patient born in 2011 was admitted to hospital because of many subcutaneous xanthomas of her buttocks, knees, wrists and elbows on both sides Xanthomas have appeared since year old 17 Figure 3.16 Images of melanoma in skin of MS15 patient (buttocks, knees, elbows) Family genealogy of MS15 patient Figure 3.17 Exon mutation results in pedigree of MS15 patient Genetic rate of the disease in pedigrees in 16/22 members, detected 14/16 members with mutation c.664 T>C, including 13 members with heterozygous mutations, 01 member with homozygous mutation 18 CHAPTER 4: DISCUSSION 4.1 Discuss mutations and SNP found in FH pediatric patients The TC and LDL-C concentrations of 26 FH patients in our study were lower than that of Fairoozy et al (2017) with a sample of 16 patients in Iran But this result is much higher than that of patients with mutations detected from pedigrees in this study and TC and LDL-C results from Ramaswani (2009), Guardamagna (2017), Groselj (2018), Klančar (2015), especially compared with the study results in 3064 FH pediatric patients from European countries (2020) The dissimilarity between the studies on results of TC and LDL-C can be explained: (1) Due to differences in social and economic conditions in researching countries: large sample studies were conducted in developed countries in Europe - countries with good economic conditions, developed societies, people's awareness of health and health care is much higher than Vietnam and Iran These countries invest a lot of money in the implementation of cascade screening tests for family members of FH patients and FH screening projects conducted in the community Therefore, the subject of FH is detected early, at a very young age, the test of TC and LDL-C in the blood had not changed much yet Meanwhile, the group of 26 patients in our study was only tested and diagnosed with FH when they came to the hospital for examination and showed clinical manifestations of xanthoma (2) Due to differences in sample size: studies with large sample sizes have similar TC and LDL-C test results Mutation c.664 T>C (Exon 4) The c.664 T>C mutation on exon at the nucleotide site 664, Thymine was replaced by Cytosine, resulting in the transformation of a.a Cysteine at 222 to a.a Arginine The mutation was discovered and published in a study by Sozen M.M (2005) In our study, there were 19 patients with this mutation This is a missense mutation with the replacement of a.a, which affects protein activity and involves binding LDL-C to LDLr Exon encodes the LDLr ligand region mediating the interaction with lipoprotein The mutation on exon is found with a high percentage in many research results, the reason for this phenomenon is partly due to the superiority of the CpG sequences in this exon, Another reason for this is that the unique location encodes both apoB and apoE, the segments in the ligand binding region only encode the apoB mount Mutations in this key region often significantly affect the function of LDLr Therefore, individuals carrying these mutations often exhibit typical lipid disorders, from which the patient is more easily detected and exon is the longest of the 18 exons of the LDLR gene To Predict the pathogenicity of the missense mutation with a change of aa, prediction software can be used : PolyPhen program (Polymorphism Phenotyping version 2), MutationTaster software and SIFT software (Sorting Intolerant) From Tolerant) Predicting results with the Polyphen-2 prediction software shows that the c.664 T>C mutation is almost certainly pathogenic with a maximum score is (100% specificity) Using MutationTaster software will bring about the accuracy and speed in data analysis to predict the pathogenic potential of mutation Using this prediction software showed that the c.664 T>C mutation is also potentially pathogenic, a.a conservation score is 194 with high confidence When using the SIFT prediction software there is also a conclusion about the high likelihood of causing the mutation Mutation c.1285 G>A (Exon 9) The c.1285G>A mutation on exon replaced Guanine with Adenine at position c.1285, changing the coding triad for a.a Valine at 429 to Methionine In this study, we found patient with this mutation 20 and this is a mutation that was discovered and published from the research results of Ranheim T (2006) The c.1285G>A mutation is a missense mutation that has been confirmed to cause disease because the lipoprotein binds to LDLr, are localized but cannot be recycled, due to recycling defects in mutant receptors The study by Ranheim T et al (2006) describes the phenotypic characteristics of some LDLR gene mutations by both microscope and flow cell tests on CHO and HepG2 cell model systems The results showed that the c.1285G>A mutation is disease-causing Mutation c.1335 C>T (p.Asp445Asp - Exon9) The c.1335 C>T mutation on exon of the LDLR gene, a new mutation, was discovered in the study and one FH pediatric patient had this mutation The mutation replaced the Cytosin nucleotide with Thymin at c.1335, changing the GAC coding trio into GAU Despite the change in nucleotide, the two triplets encoding GAU and GAC both encode for a.a Aspartate Most mutations that not change aa are neutral mutations, however, using the MutationTaster mutant prediction software showed that the c.1335 C>T mutation is pathogenic and can cause disease at the CM950764 site, which was published in the human mutation data bank (The Human Gene Mutation Database – HGMD) Mutation c.1978 C>T (heterozygous) on Exon 13 c.1978 C>T Figure 4.5 Mutation location c.1978 C>T create stop codon code 21 Heterozygous type mutation c.1978 C>T on exon 13 of LDLR gene is a novel mutation, detected in 01 FH patient with xanthoma expression and typical elevated blood lipid test When the mutation replaced the cytosin nucleotide with Thymine at the nucleotide position of 1978, the translation process at position a.a 660 will be changed into a set of three UAG encodings, which is one of the three ending sets (UAG, UAA, UGA) Immediately, the translation process is stopped and the LDLr protein synthesis process is stopped in this position Stopping the translation process causes the structures after the mutant site of the LDLr protein (including part of the EGF-like region, the OLS region, the TM transmembrane region and the cytoplasmic region) to not be formed, thus creates an abnormal protein and causes nonsense mutation The nonsense mutations are often confirmed to cause disease Single polymorphisms (SNP): SNP rs5925 and rs1003723 SNP rs5925 and rs1003723 appeared with high rate in the study, respectively 26.92% (7/26) and 42.31% (11/26) SNP rs1003723 found in high frequency in the Danish community (44%) has been shown to be associated with the conservation of coupling efficacy when expressed in vitro These two SNPs have been previously linked to hypercholesterolemia and hypertriglyceridemia in the past SNP rs1003723 (c.1359-30 C> T or IVS9-30 C> T) on the intron of the LDLR gene has been shown by several studies that the T-carrier group (CT or TT) is associated with increased TC and LDL-C was significantly higher than the CC genotype with p = 0.002 and p = 0.01 respectively 4.2 Discuss mutation of the LDLR gene in members of the genealogy The mutant analysis results are consistent with the clinical situation at the time of diagnosis of FH and consistent with the genetic 22 characteristics of the mutation: dominant genetics on the normal chromosome Our research results are completely consistent with many studies in the world on the hereditary rate of FH disease when conducting cascade screening Setia's study (2018) conducted cascade screening on 133 family members of FH patients with mutant, 88 members with first, second and third kinship relationship with FH patients (66,16 %) has mutations Of the 26 members with mutations in pedigree families of pediatric patients, members did not increase or slightly increase lipid level Sturm’s (2018) research in the USA showed that patients with FH had mutations with LDL-C test