Expression of long noncoding RNA GAS5 associated with clinic pathologic factors of gastric cancer

JOURNAL OF MEDICAL RESEARCH EXPRESSION OF LONG NONCODING RNA GAS5 ASSOCIATED WITH CLINIC PATHOLOGIC FACTORS OF GASTRIC CANCER Nguyen Dang Bao1, Nguyen Trong Tue2, Tran Hieu Hoc3, Nguyen Van Hung3, Tran Van Khanh2, Pham Duc Huan4, Ta Thanh Van2 General surgery Department, Gialai General Hospital, 2Center for Gene - Proteine Research, Hanoi Medical University, 3Bach mai Hospital, 4Hanoi Medical University Hospital Gastric cancer is the world’s third most common cause of cancer-related death It remains difficult to cure, particularly in less developed countries Several recent studies revealed that long noncoding RNAs (lncRNAs) could play a critical role in tumor biology Dysregulation of lncRNA expression has been reported in different types of cancers, including gastric cancer, but its role in gastric cancer remains unknown This study was designed to investigate the expression pattern, biological role and clinical significance of lncRNA GAS5 in gastric cancer LncRNA GAS5 was isolated from 48 cancer tissues and 48 non - cancer gastric tissues of gastric cancer patients in Vietnam LncRNA GAS5 levels were determined via quantitative reverse -transcription polymerase chain reaction (Qrt - PCR) and normalized to the expression of GAPDH Differences between groups were tested for significance using the -ΔΔCt method Our results show that expression of GAS5 was lower in gastric cancer tissues than in normal gastric tissues and was associated with tumor size, invasion depth and pathologic stage GAS5 may represent a new marker of prognosis for gastric cancer patients Keywords: Gastric cancer, Long noncoding RNA, GAS5, tumor suppressor, marker cancer I INTRODUCTION Worldwide, gastric of cancer mortality is tumor metastasis; thus, cancer currently prevails as the third most common cause of early diagnosis of gastric cancer is of particular significance to prevent early death cancer - related death Estimations suggest Eukaryotic genomes encode numerous that 35% of affected patients present with syn- long non - coding RNAs (lncRNAs), which chronous distant metastases [1] Approxi- represent a class of RNA molecules longer mately 9.5 million new gastric cancer cases than 200 nucleotides without open reading and 7.2 million deaths are recorded annually frames of significant length or with limited [2] Despite improvements in diagnostic tech- protein - coding potential [4] Recently, many niques and advances in treatments, patients studies have revealed that lncRNAs could play with advanced or metastatic gastric cancer a critical role in regulating gene expression at continue to face a poor prognosis Moreover, various levels, e.g., chromatin modification, the average survival period after diagnosis is transcription and post - transcriptional proc- less than year [3] One of the major causes essing [5], Furthermore, they also play an importnat role in many biological processes, Corresponding author: Nguyen Trong Tue, Center for Gene and Protein Research, Hanoi Medical University E-mail: ntt.bio@gmail.com Received: 06 November 2016 Accepted: 10 December 2016 JMR 105 E1 (7) - 2016 including cellular differentiation, invasion, and metastasis [6; 7] Based on their functions, lncRNAs can be roughly divided into oncogenic and tumor - suppressor groups [8] 47 JOURNAL OF MEDICAL RESEARCH Indeed, it is now widely acknowledged that ncRNA in other cancers For example, GAS5 lncRNAs are likely to be of crucial importance and/or its snoRNAs have been shown to be in the pathogenesis of cancer; therefore, a aberrantly expressed in breast cancer, head better understanding of lncRNA biology may and lead to novel and better approaches for cancer glioblastoma multiforme and non-small-cell diagnosis and treatment lung cancer [18] Abnormally low levels of neck squamous cell carcinoma, LncRNA expression has been reported in GAS5 expression may therefore reduce the different types of cancers, including lung can- effectiveness of chemotherapeutic agents [19] cer, breast cancer, hepatocellular carcinoma Previous studies have also shown that lncRNA and gastric cancer [9 - 13] In addition, levels GAS5 was downregulated and served as a of circulating lncRNAs have been used for tumor-suppressor lncRNA in prostate cancer cancer diagnosis and prognosis [14; 15] and cells, renal cell carcinoma, cells and breast have also been considered as potential cancer cells [8; 19; 20] In this study, we biomarkers and therapeutic targets for gastric investigated the potential relationship between cancer [12] GAS5 lncRNA is a transcript of GAS5 lncRNA level in gastric cancer tissues the growth arrest - specific (GAS5) gene, a and the clinicopathologic features of the non-protein coding gene It was first isolated in disease, as well as the clinical outcome 1988 during a search for novel tumour II SUBJECTS AND METHODS suppressors, where subtractive cDNA cloning was used to identify genes that are preferentially expressed in growth - arrested cells [16] GAS5 lncRNA negatively regulates the growth Subjects Tissue collection of cell line in various cancers [17] and the ot- Samples were obtained from 48 patients her systems demonstrate that GAS5 exerts who had undergone surgery at the Hanoi complementary effects on cell proliferation Medical University Hospital, Viet Duc Hospital, (inhibitory) and apoptosis (stimulatory) and or Bach Mai Hospital from October 2015 to together these are likely to form the main ba- August 2016 The patients were diagnosed sis of its tumour suppressor activity in vivo with gastric cancer based on histopathological [17] Furthermore, another study showed that evaluation Clinicopathologic information was GAS5 was significantly downregulated in available for all samples (Table 1) These pa- gastric cancer tissues of Chinese patients and tients did not receive any treatment before the that GAS5 expression was associated with operation All specimens were immediately larger tumor size and advanced pathologic frozen in liquid nitrogen and stored at −80°C stage Patients with low GAS5 expression until RNA extraction levels had poorer disease - free survival and Methods overall survival than those with high GAS5 expression [12] Nevertheless, the overall RNA extraction and qRT-PCR analyses pathophysiological contributions of lncRNAs to Total RNA was extracted from tissues gastric unknown using the Rneasy Minikit QIAgen for qRT- Additionally, some evidence implicates GAS5 PCR RNA was reverse transcribed to cDNA 48 cancer remain largely JMR 105 E1 (7) - 2016 JOURNAL OF MEDICAL RESEARCH by using qScript™ cDNA SuperMix (Quanta GAS5 RNA levels in 48 pairs of gastric BioScience, America) Real-time PCR analy- cancer samples and adjacent, histologically ses were performed with "PerfeCTa® SYBR® normal tissues were examined by qRT - PCR Green BioScience, and normalized to GAPDH Figure showed America) Results were normalized to the that the GAS5 level was significantly de- expression of GAPDH The PCR primers for creased in 62.5% (30/48) of gastric cancer GAS5 or GAPDH were as follows: tissues compared with corresponding adjacent FastMix® (Quanta GAS5 - F1: 5’ -CCTGTGAGGTATGGTGCTGG non - tumorous tissues Moreover, in cancerous tissues, GAS5 expression in the cancer - 3’ GAS5 - F2: 5’ -CTGTGTGCCAATGGCTTGAG tissues was at a lower level than that of the normal comparison specimens These data - 3’ GAPDH - F1: 5’- CTTCTTTTGCGTCGCC- indicate that abnormal GAS5 expression may be related to gastric cancer pathogenesis AGCCG - 3’ GAPDH - F2: 5’- CTTCCCGTTCTCAGCCTTGAC - 3’ The relationship between GAS5 expression qRT - PCR and data collection were performed on Effpendor Realplex mastercycler The relative expression of GAS5 was analysed using the 2−ΔΔCt method for relative quantitation and normalized to GAPDH and clinicopathologic factors in patients with gastric cancer The clinical pathology of the 48 gastric carcinoma patients included in this study are shown in table The patients were divided into two groups according to the relative GAS5 expression in their tumor tissues: a relative Statistical analysis Group comparisons, correlations and associations were performed using SPSS statistical software (version 16.0, SPSS Inc) and the Chi -Square test A p-value less than 0.05 was considered statistically significant when comparing the differences between patient groups high - GAS5 expression group (n = 30, GAS5 expression ratio ≥ 1) and a relative low - GAS5 expression group (n = 18, GAS5 expression ratio ≤ median ratio) (Figure 1) Clinicopathologic features were compared between the two groups (table 2) The low - GAS5 group was found to have greater tumor size (p = Research ethics: This research was approved by the ethics committee of the Hanoi Medical University, Approval No.187- HMUIRB, signed February 20, 2016 III RESULTS Expression of GAS5 is down - regulated in human gastric cancer tissues JMR 105 E1 (7) - 2016 0.032), higher TNM stage (p = 0.001), greater invasion depth (p = 0.037), more regional lymph nodes (p = 0.001) and more lymphatic metastases (p = 0.001) However, GAS5 expression level was not associated with other parameters such as gender (p = 0.431), age (p = 0.662), tumor location (p = 0.179) and histologic differentiation (p = 0.574) (table 2) 49 JOURNAL OF MEDICAL RESEARCH Table Clinicopathological characteristics and GAS5 expression in 48 tissue samples of patients with gastric cancer Clinical parameter n (%) Age (years) < 50 (16.7) > 50 40 (83.3) Gender Male 34 (70.8) Female 14 (29.2) Location Distal 35 (72.9) Middle 13 (27.1) Size < cm (10.4) - cm 24 (50) > cm 19 (39.6) Histologic diffentiation Moderately differentiated 11 (22.9) Poorly differentiated 25 (52.1) Undifferentiated 12 (25.0) Invasion depth T1 (6.2) T2 14 (29.2) T3 25 (52.1) T4 (12.5) TNM Stages IA (6.2) IB 4(8.3) II 11 (22.9) IIIA 20 (41.7) IIIB (4.2) IV (16.7) 50 JMR 105 E1 (7) - 2016 JOURNAL OF MEDICAL RESEARCH Clinical parameter n (%) Lymphatic metastasis Yes 35 (72.9) No 13 (27.1) Regional lymph nodes N0 13 (27.1) N1 20 (41.7) N2 11 (22.9) N3 (8.3) Distant metastasis Yes (12.5) No 42 (87.5) Low GAS5 expression High GAS5 expression Figure Relative expression of GAS5 in gastric cancer tissues (n = 48) compared with corresponding non - tumor normal tissues (n = 48) GAS5 expression was examined by qRT - PCR and normalized to GAPDH expression Data was presented as fold - change in tumor tissues relative to normal tissues Patients’ GAS5 expression was classified into two groups based on relative GAS5 expression in tumor tissues: a relative high - GAS5 expression group (n = 18, red columns) and a relative low-GAS5 expression group (n = 30, blue columns) JMR 105 E1 (7) - 2016 51 JOURNAL OF MEDICAL RESEARCH Table Correlation between GAS5 expression and clinicopathological characteristics in patients with gastric cancer GAS5 (number of case) Clinical parameter High - GAS5 group Low - GAS5 group < 50 > 50 15 25 Male 12 22 Female Distal 15 20 Middle 10 < cm - cm 11 > cm 18 Moderately Poorly 17 Undifferentiated 6 T1 T2 T3 19 T4 Chi - Square test p-value Age (years) 0.662 Gender 0.431 Location 0.179 Size 0.032 Histologic differentiation 0.574 Invasion depth 0.037 52 JMR 105 E1 (7) - 2016 JOURNAL OF MEDICAL RESEARCH GAS5 (number of case) Clinical parameter High-GAS5 group Low-GAS5 group IA IB II IIIA 16 IIIB IV Chi-Square test p-value TNM Stages 0.001 Lymphatic metastasis Yes 27 0.001 No 10 Regional lymph nodes N0 10 N1 13 N2 10 N3 Yes No 18 24 0.001 Distant metastasis 0.048 IV DISCUSSION metastasis by directly targeting chromatin Long non - coding RNAs are a class of modification complexes, indicating that the recently discovered non-protein coding RNAs abnormal expression of lncRNAs increases > 200 nucleotides in length, with a role in the chance of tumorigenesis and cancer mammalian cell development However, at present, only a few differentiation Their dysregulation has been lncRNAs have been functionally studied in detected in various diseases, most notably detail and many important questions remain cancer Recent studies have shown that many unanswered [21] Therefore, identification of lncRNAs are dysregulated in various solid cancer - associated lncRNAs and investigation tumors Several lncRNAs can regulate cancer of their clinical significance and functions may development JMR 105 E1 (7) - 2016 and 53 JOURNAL OF MEDICAL RESEARCH provide a missing piece of the well - known ciated with increased tumor size, higher TNM oncogenic and tumor suppressor network stage, greater invasion depth and increased puzzle regional lymph nodes (table 2) Our findings Human GAS5 is encoded at 1q25, a locus were similar to a previous study by Sun, M et that has been associated with abnormalities in al (2014) in Chinese gastric cancer patients, several types including but unlike Sun, et al.’s study, our findings re- prostate cancer cells, renal cell carcinoma vealed that low GAS5 was correlated with lym- cells and breast cancer cells [8; 19; 20] Low phatic metastasis (table 2) Furthermore, ecto- GAS5 expression is an adverse prognostic pic expression of GAS5 was demonstrated to factor for survival in breast cancer, cervical decrease gastric cancer cell proliferation and cancer, and gastric cancer [22; 12] Converse- induce apoptosis, while downregulation of en- ly, over-expression of GAS5 has been attribu- dogenous GAS5 could promote cell prolifera- ted to the prevention of several cancer cell tion in vitro and in vivo [12] These findings lines through regulation of apoptosis and the indicate that GAS5 may play a key tumor- cell cycle, under basal conditions as well as in suppressor some chemotherapeutic agents These results prognostic markers for gastric cancer suggest that GAS5 may have clinical signifi- V CONCLUSION of cancer cells, cance in the development of cancer therapies role and may be a novel Our study reveals that GAS5 expression [8; 12; 19; 20] This is the first study to investigate the level in gastric cancer tissue is associated with expression pattern and prognostic significance tumor size, TNM stage, invasion depth, num- of GAS5 in Vietnamese patients with gastric ber of regional lymph nodes and extent of lym- cancer GAS5 expression was retrospectively phatic metastasis Our results indicate that analyzed in 48 patients with gastric carcinoma GAS5 might represent a potential biomarker Its expression levels in gastric cancer tissues for the diagnosis and management of gastric were compared with those found in distal cancer normal tissue from the same patients A clear reduction of more than 62% in GAS5 expres- Acknowledgements sion level in the gastric cancer tissues We would like to express our sincerest compared with normal tissues was observed gratitude to the Center for Gene-Protein (Figure 1) This reduction was statistically sig- research at the Hanoi Medical University for nificant, reduction their help with our experiments We would also in GAS5 expression level is related to the like to thank the Hanoi Medical University development of gastric cancer Hospital, Viet Duc Hospital and Bach Mai suggesting that the Our results showed that GAS5 expression was significantly decreased in gastric cancer tissues Patients’ GAS5 expression levels hospital for giving us patient samples REFERENCES were then compared with their clinical fea- Mastoraki, A., Benetou C., Mastoraki tures A lower expression of GAS5 was asso- S et al (2016) The role of surgery in the 54 JMR 105 E1 (7) - 2016 JOURNAL OF MEDICAL RESEARCH therapeutic approach of gastric cancer liver ses stemness features of hepatocellular carci- metastases Indian J Gastroenterol, 35(5), 331 noma by derepression of CTNNB1 Hepatolo- - 336 gy, 63(2), 499 - 511 Catalano, V., Labianca R., Beretta G 12 Sun, M., Jin F Y., Xia R et al (2014) D et al (2009) Gastric cancer Crit Rev Oncol Decreased expression of long noncoding RNA Hematol, 71(2), 127 - 164 GAS5 indicates a poor prognosis and promo- Vogiatzi, P., Vindigni C., Roviello F et al (2007) Deciphering the underlying genetic and epigenetic events leading to gastric carcinogenesis J Cell Physiol, 211(2), 287 - 295 Crew, K D and Neugut A I (2006) Epidemiology of gastric cancer World J Gastroenterol, 12(3), 354 - 362 Cao, J (2014) The functional role of long non-coding RNAs and epigenetics Biol Proced Online, 16, 11 Pinheiro, H., Bordeira-Carrico R., Seixas S et al (2010) Allele-specific CDH1 downregulation and hereditary diffuse gastric cancer Hum Mol Genet, 19(5), 943 - 952 Guttman, M., Amit I., Garber M et al (2009) Chromatin signature reveals over a thousand highly conserved large non-coding RNAs in mammals Nature, 458(7235), 223 227 Qiao, H P., Gao W S., Huo J X et al (2013) Long non-coding RNA GAS5 functions as a tumor suppressor in renal cell carcinoma Asian Pac J Cancer Prev, 14(2), 1077 - 1082 Ponting, C P., Oliver P L., Reik W (2009) Evolution and functions of long noncoding RNAs Cell, 136(4), 629 - 641 tes cell proliferation in gastric cancer BMC Cancer, 14, 319 13 Arita, T., Ichikawa D., Konishi H et al (2013) Circulating long non-coding RNAs in plasma of patients with gastric cancer Anticancer Res, 33(8), 3185 - 3193 14 Zhang, E., He X., Yin D et al (2016) Increased expression of long noncoding RNA TUG1 predicts a poor prognosis of gastric cancer and regulates cell proliferation by epigenetically silencing of p57 Cell Death Dis, 7, e2109 15 Qi, P., Zhou X Y and Du X (2016) Circulating long non-coding RNAs in cancer: current status and future perspectives Mol Cancer, 15(1), 39 16 Schneider, C., King R M., Philipson L (1988) Genes specifically expressed at growth arrest of mammalian cells Cell, 54(6), 787 - 793 17 Pickard, M R and Williams G T (2015) Molecular and Cellular Mechanisms of Action of Tumour Suppressor GAS5 LncRNA Genes (Basel), 6(3), 484 - 499 18 Renganathan, A., Kresoja-Rakic J., 10 Xu, N., Chen F., Wang F et al (2015) Echeverry N et al (2014) GAS5 long non- Clinical significance of high expression of coding RNA in malignant pleural mesothelio- circulating serum lncRNA RP11-445H22.4 in ma Mol Cancer, 13, 119 breast cancer patients: a Chinese population- 19 Pickard, M R., Mourtada-Maarabouni based study Tumour Biol, 36(10), 7659 - M and Williams G T (2013) Long non- 7665 coding RNA GAS5 regulates apoptosis in 11 Yuan, S X., Wang J., Yang F et al (2016) Long noncoding RNA DANCR increaJMR 105 E1 (7) - 2016 prostate cancer cell lines Biochim Biophys Acta, 1832(10), 1613 - 1623 55 JOURNAL OF MEDICAL RESEARCH 20 Mourtada-Maarabouni, M.,Pickard M R., Hedge V L et al (2009) GAS5, a non-coding RNA in human carcinomas Mol Cancer, 10, 38 non - protein - coding RNA, controls apoptosis 22 Cao, S., Liu W., Li F et al (2014) and is downregulated in breast cancer Onco- Decreased expression of lncRNA GAS5 pre- gene, 28(2), 195 - 208 dicts a poor prognosis in cervical cancer Int J 21 Gibb, E A., Brown C J and Lam W L 56 (2011) The functional role of Clin Exp Pathol, 7(10), 6776 - 6783 long JMR 105 E1 (7) - 2016 ... (87.5) Low GAS5 expression High GAS5 expression Figure Relative expression of GAS5 in gastric cancer tissues (n = 48) compared with corresponding non - tumor normal tissues (n = 48) GAS5 expression. .. plasma of patients with gastric cancer Anticancer Res, 33(8), 3185 - 3193 14 Zhang, E., He X., Yin D et al (2016) Increased expression of long noncoding RNA TUG1 predicts a poor prognosis of gastric. .. Correlation between GAS5 expression and clinicopathological characteristics in patients with gastric cancer GAS5 (number of case) Clinical parameter High - GAS5 group Low - GAS5 group < 50 > 50 15